Background
Osteoarthritis (OA) is the most common chronic disorder of joints, such as knee joints, hip joints, and small finger joints [
1]. In China, approximately 10% of the total population experiences OA [
2]. The main symptoms of patients with OA are pain, swelling, and joint deformity because of cartilage breakdown [
3]. There is no cure due to the long-term nature of the disease and multiple mechanisms associated with it, but physical activity, improving joint mobility and flexibility using assistive devices, and surgery can help improve symptoms [
4,
5]. Thus, studies on etiological factors of OA are important.
Many studies have reported on factors that contribute to the development of OA, such as obesity, fracture, surgery or ligament tears, and genes [
6,
7]. Various genes make individuals more susceptible to OA. Researchers have found that fatty acid amide hydrolase (
FAAH) expression is related to increased pain sensitivity and is upregulated in patients with knee OA than in people without OA [
8]. Subsequently,
FAAH inhibitors, such as URB597, PF-04457845, and OL-135, have been focused on for OA treatment [
9‐
11]. In addition, long and short proteins, which are encoded by
DVWA and related to knee OA susceptibility, are mainly expressed in articular cartilage [
12].
Transcription factors (TFs) are proteins that control the rate of transcription in molecular biology, which regulates gene expression [
13]. The expression of SAF-1, an inflammation-responsive TF, was found to be overexpressed in moderate-to-severely damaged OA cartilage tissues [
14]. Therefore, screening the key genes and TFs associated with OA is important for determining OA pathology.
Through bioinformatics tools, the present study aimed to understand the mechanism of genes associated with the development of OA. Differentially expressed genes (DEGs) were identified using four gene expression profiling datasets, GSE55235, GSE55457, GSE1919, and GSE12021, based on a meta-analysis. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed with MATHT (
www.biocloudservice.com). Subsequently, a protein–protein interaction (PPI) network was constructed for these DEGs. Significant network modules were identified using ReactomeFIViz, and the pathway of each module was enriched using MATHT. In addition, TFs in the DEGs were identified, and the key DEGs were verified using quantitative real-time polymerase chain reaction (qRT-PCR). These findings may provide a novel understanding of the molecular mechanisms underlying OA.
Methods
Data acquisition
Four datasets, GSE55235, GSE55457, GSE1919, and GSE12021, including human OA and healthy control samples were downloaded from the Gene Expression Omnibus (
http://www.ncbi.nlm.nih.gov/geo/) database. The characteristics of each dataset are shown in Table
1.
Table 1
The characteristic of four datasets
GSE55235 | 10 | 10 | Affymetrix Human Genome U133A Array |
GSE55457 | 10 | 10 | Affymetrix Human Genome U133A Array |
GSE1919 | 5 | 5 | Affymetrix Human Genome U95A Array |
GSE12021 | 20 | 13 | Affymetrix Human Genome U133A Array, Affymetrix Human Genome U133B Array |
Data preprocessing
Raw CEL files were read using the Affy package in R software (version 1.28.0,
http://www.bioconductor.org/packages/release/bioc/html/affy.html) [
15]. Subsequently, data preprocessing was performed with RMA [
16], such as background correction, normalization, and expression calculation. Each probe ID was transformed into a gene symbol. The probes corresponded to gene symbols according to the latest annotation file. If any probe corresponded to multiple genes, its expression value was removed. If more than one probe corresponded to the same gene symbol, the mean of the probe was used as the expression level of the gene.
Identification of DEGs using a meta-analysis
The MetaDE package in R software was used to integrate the data in the four datasets [
17], and the DEGs in OA samples were identified from genes in the control samples. The expression value of each gene on different platforms was evaluated for heterogeneity and unbias, including
τ2 (estimated amount of heterogeneity) and
Qpval (
P values for the heterogeneity test). If
τ2 = 0 and
Qpval > 0.05, the gene was homogeneous and unbiased. The differential expression of genes was then detected, and only genes with
P < 0.05 were considered significant. Subsequently, the false discovery rate (FDR) of each gene was calculated using Benjamini–Hochberg correction. Genes with
τ2 = 0,
Qpval > 0.05,
P < 0.05, and FDR < 0.01 were identified as DEGs. On the basis of these DEGs, the log
2 fold change (log
2FC) was calculated for each gene in the four datasets. If log
2FC > 0, gene expression was upregulated in OA samples; otherwise, it was downregulated in OA samples.
GO enrichment function and pathway analysis
To determine the DEGs involved in biological processes (BPs), cellular components (CCs), molecular functions (MFs), and pathways, GO and KEGG pathway enrichment analyses were performed with MATHT based on Fisher’s test. A P value of < 0.05 was considered significant.
Construction of the PPI network
The interaction between proteins was analyzed using STRING (version 10.0) for the DEGs using default parameters. The threshold value was required confidence (combined score) > 0.4. Subsequently, the PPI network was visualized using Cytoscape (version 3.2.0,
http://www.cytoscape.org/). In the network, the node represents a protein, the line represents the interaction, and the degree represents the number of interactions. Then, CytoNCA in Cytoscape was used to analyze the network topology under the “without weight” condition. The degree centrality, betweenness centrality, and closeness centrality of each node were obtained.
Module analysis in the PPI network
The ReactomeFIViz app-applied MCL graph clustering algorithm was used to generate a subnetwork for a list of significant network modules [
18]. In addition, the average Pearson correlation coefficient among genes involved in the same module was calculated. On the basis of the subnetwork, the pathway in each module was enriched using MATHT.
Construction of the transcriptional regulatory network
On the basis of the TF–target gene data from the Transcriptional Regulatory Relationships Unraveled by Sentence-based Text Mining website, the TFs in the DEGs were identified. The network was visualized using Cytoscape.
Animal model of OA
To establish the animal model of OA, male rats were randomly divided into control and model groups (30 rats per group). After acclimatization for 3 days, rats in the control group were given normal food without any other treatment. The left knee joints of rats in the model group were subjected to anterior cruciate ligament transaction, and the right knee joints served as the control [
19]. Subsequently, the rats were sacrificed and the joints were harvested at 8 weeks post surgery.
Verification of qRT-PCR results
To confirm the results, expression levels of
FOS,
TWIST1,
POU2F1,
SMARCA4, and
CREBBP were detected using qRT-PCR. Total RNA was extracted from the synovial tissues of rats using TRIzol reagent following the manufacturer’s instructions (TAKARA, Dalian, China) under low temperature. Subsequently, first-strand cDNA was prepared from the RNA obtained from synovial tissues using PrimeScript™RT Master Mix according to the manufacturer’s instructions (RR036A, TAKARA). Rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control. Primers used for
FOS,
TWIST1,
POU2F1,
SMARCA4, and
CREBBP and GAPDH were based on the rat sequences (Table
2). Relative amounts of mRNAs were obtained using the Relative Expression Software Tool.
Table 2
The rat sequences of primers used for RT-PCR
GAPDH-F | AGACAGCCGCATCTTCTTGT |
GAPDH-R | CTTGCCGTGGGTAGAGTCAT |
FOS-F | GTGACAGCCATCTCCACCAG |
FOS-R | TCCTTTCCCTTCGGATTCTC |
TWIST1-F | TTTCACAAGAATCAGGGCGTG |
TWIST1-R | CCGTTGCCTCTGGGAATCTC |
POU2F1-F | GAGCAGCGAGTCAAGATGAGA |
POU2F1-R | GGGCTGCTTCTCAAAGTCCA |
SMARCA4-F | GGACGCTGTGATCAAGTACA |
SMARCA4-R | GGTTTCGGATGCGTTCCTTG |
CREBBP-F | CCAGGCAGGTGTTTCACAG |
CREBBP-R | ACAGGAGTGGATGGCTGAGT |
Statistical analysis
The OA and control groups were compared using unpaired Student’s t test by SPSS Statistics V22.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered significant.
Discussion
In this study, downregulated DEGs, such as FOS, TWIST1, POU2F1, SMARCA4, and CREBBP, were identified as TFs. RT-PCR showed that the expression levels of Fos, Twist1, Pou2f1, Smarca4, and Crebbp decreased in mice with OA. In addition, FOS, TWIST1, SMARCA4, and CREBBP were involved in the positive regulation of transcription from the RNA polymerase II promoter. In the PPI network, FOS interacted with CREBBP, TWIST1, and SMARCA4 and CREBBP interacted with SMARCA4.
TWIST1 encodes a basic helix–loop–helix TF that plays an important role in osteoblast metabolism and differentiation [
20].
TWIST1, as a critical regulator of osteoblast differentiation in OA pathology, was also identified from the trabecular bone of patients with end-stage OA [
21]. In addition,
TWIST1 expression decreased in OA patients and was correlated with the inhibition of normal mineralization in OA patients [
22]. Similarly,
TWIST1 expression was downregulated in synovial tissues in OA. In a previous study, the downregulated gene
TWIST1 was a target of the WNT signaling pathway [
23], which is related to bone remodeling and pathologies such as OA [
24]. Therefore, the downregulated gene
TWIST1 is a key regulator in OA development.
POU2F1 (also known as OCT1) downregulation facilitates osteosarcoma tumorigenesis [
25]. Although
POU2F1 has not been reported in OA pathology, it interacts with adenomatous polyposis coli, which negatively regulates the WNT pathway [
26,
27]. In addition,
POU2F1 can regulate
TWIST1 expression in the transcriptional regulatory network. Therefore,
POU2F1 might also be a candidate gene connected with OA pathology.
TWIST1 can regulate
FOS expression in the transcriptional regulatory network, and
TWIST1 and
FOS interact with each other in the PPI network. Kinne et al. found that compared to patients with OA or normal joints, c-fos was highly expressed in the synovial membrane of patients with rheumatoid arthritis [
28]. In addition, c-fos expression was detected in the superficial layer of cartilage only in 20% of OA patients [
29]. A small molecule, harpagoside, as a therapeutic for preventing OA development, can inhibit IL-6 expression by blocking the expression of
c-FOS in primary human OA chondrocytes [
30]. However, FOS expression decreased in our study, probably because the sample sizes and patients from different countries in the present study were not the same as in previous studies. In the transcriptional regulatory network,
SMARCA4 as a TF that modifies
FOS was also downregulated in OA patients. Besides,
FOS interacted with
CREBBP (a hub gene) and
SMARCA4 and
SMARCA4 interacted with
CREBBP in the PPI network. As reported, the upstream regulator
SMARCA4 interacted with Nur77, which modulates inflammatory gene expression in the transcriptome of bone marrow-derived macrophages [
31]. In samples from mice with OA,
Smarca4 and
Crebbp expression decreased compared to that in control samples. Therefore,
SMARCA4 and
CREBBP are candidate genes involved in OA pathology.