Background
Avian leukosis viruses (ALVs) belong to the genus
Alpharetrovirus of the family
Retroviridae and can induce different pathotypes of neoplastic diseases in birds including lymphoid and myeloid leukosis, resulting in severe economic losses in the poultry industry worldwide. Based on the variation in the nucleotide sequence of
gp85, ALV strains from chickens have been classified into subgroups A, B, C, D, E, J, and the recently identified subgroup K [
1-
3]. It is noteworthy that subgroup A, B, and J are the most common pathogenic exogenous viruses. Subgroup J was first isolated in commercial broiler breeders with myelocytomatosis and has caused significant economic losses in the broiler industry because of increased tumor-induced mortality, decreased weight gain, serious immunosuppression and cost for eradication [
4-
6]. ALV A and B (ALV-A/B) mainly infect layer and breeder chickens leading to higher incidence of lymphoid leukosis (LL) or erythroblastosis (EB) in susceptible chickens and cause severe economic losses due to decreased productivity, including reduction in weight gain, egg production and breeding potential [
7-
9]. Currently, there are no effective vaccines or drugs against ALV. Therefore, early identification and removal of virus-shedding birds are key measurements in the control of exogenous ALV infections.
Different methods have been established for detecting exogenous ALV, including traditional virus isolation plus an antigen-capture enzyme-linked immunosorbent assay (ELISA) for group-specific p27 antigen of ALV, immunofluorescence assay (IFA), loop-mediated isothermal amplification (LAMP), and quantitative competitive reverse transcription PCR (QC-RT-PCR)[
10-
13]. However, each of these methods has limitations. For instance, ELISA and IFA are both time-consuming and quantitative data can’t be acquired by the current LAMP method. Although QC-RT-PCR can be quantitative, it is not a convenient method to use. Currently, a quantitative real-time PCR method based on a TaqMan probe is used for rapid, sensitive and accurate diagnosis of ALV-J and ALV-A/B [
14,
15]. Though real-time PCR using fluorescent probe detection is specific, it is relatively expensive and difficult to design specific probe. In contrast, the SYBR Green I real-time PCR assay is relatively inexpensive and more convenient in that it does not require a specific probe but rather requires specific primers.
The current study was undertaken to develop a simple, inexpensive, sensitive and specific SYBR Green I quantitative real-time PCR method for separate detection of ALV-J and multiplex detection of ALV-A/B, respectively. The real-time PCR method was further applied to evaluate clinical plasma samples and investigate the distribution of ALV-J in poultry organs at the later stage of infection.
Discussion
Although the epidemic of ALV-A/B infection was under control in the modern-intensive chicken farms throughout the world by the 1980s, both ALV- A and ALV-B viruses are still isolated from chickens and wild birds in recent years in China [
16-
18]. More seriously, ALV-J isolates have frequently been recovered from broiler breeders and layer chickens in most parts of China during the past twenty years [
19]. Lack of effective vaccines or drugs to prevent or treat ALV infections and the widespread distribution of ALV via vertical and/or horizontal transmission in chicken flocks, especial the local chicken breeds, have presented major challenges for the control and eradication of exogenous ALV; thus, it is necessary to be able to promptly identify and remove virus-shedding birds early to minimize the spread of congenital and contact infection.
ALV is a retrovirus, in which the RNA genome in the viral particles is reversely transcribed into a DNA form, i.e., the provirus, in the infected cells. Hence, detection of the virus by PCR amplification of the specific fragment within the genome is usually carried out. Classification of ALV subgroups is based on the gene sequence of the ALV gp85 gene. We designed primers for ALV-A/B and ALV-J, after aligning published gp85 sequences available by DNAStar. Furthermore, we found ALV-A/B and ALV-J primers shared no complementary reaction with other subgroups of ALV via primer-BLAST search. The specificity of the ALV-A/B duplex qRT-PCR was evaluated, and no specific dissociation curve was detected from ALV J and E subgroups as well as other common avian viruses, including AIV and NDV. Likewise, the specificity of the ALV-J real-time detection methods was examined, and the melting curve showed a single peak that could only be detected for ALV-J. The detection limits of the method were as low as 55 copies for ALV-J, 11 copies for ALV-A and 35 copies for ALV-B, which is at least 100 times more sensitive than that of the conventional PCR with a detection limit of 103 copies. The variation coefficient of repeat tests for plasmids pMDA, pMDB, pMDJ and pMDG were all less than 5%.
The qRT-PCR assay was more effective than conventional PCR and virus culture isolation in the examination of 40 clinical samples, where three samples and seven samples were negative by conventional PCR and virus isolation tests, respectively, but they were positive by the qRT-PCR. DF-1 cells inoculated with viral loads ranging from 101 to 105 copies of GD13-1 strain were detected using three methods consisting of p27 detection, routine PCR and real-time PCR. The results demonstrated that the minimum virus detection limit of real-time PCR (as low as 10 TCID50 units) was at least 10 times lower than that of the routine PCR (102 TCID50 units), which was 10 fold lower than that of virus isolation with p27 detection (103 TCID50 units).
When real-time PCR is widely used to quantify viral genes, a host gene expressed steadily in a host cells or tissue samples as an internal control becomes one pivot point for calculating the copy number of specific viral genes. Zhou et al., used the
gp85 gene and the chicken
β-actin gene as PCR targets for viral gene and the host cell, respectively [
15]. This allows the errors in RNA or DNA extraction in different samples to be minimized as a result of the use of an internal control host gene. In addition, the mRNA expression of target genes in different samples or different experimental groups can be compared. In this study, the host gene, GAPDH, was used as an internal control for calculating the copy number of ALV-J in various organ tissues. An animal experiment using SPF chickens infected with the CHN06 and the NX0101 strains was carried out to determine the extent of virus distribution and load of ALV-J in different organs in each group at 30 weeks post-infection by p27 antigen detection, routine PCR and real-time PCR methods. The results showed that various organ tissues of infected group were all positive by the three methods, indicating that the ALV-J was found in all detected organs at 30 weeks post-infection. As shown in Figure
5, virus copies of CHN06 group were higher than that of NX0101 group in various organ tissues except in lung. This result suggested that the replication rates in organ tissues of the respective ALV-J strains CHN06 and NX0101 associated with hemangioma and myelocytoma were different. Combined with previous experimental results that the replication rates in DF-1 cells of CHN06 strain were higher than NX0101 strain (data not shown), it was speculated that the number of virus copies is correlated to viral replication capacity. The difference of virus copies in lung between the CHN06 and NX0101 groups implied that tissue tropisms of the two strains exist. It was reported that env and LTR regions of ALV were responsible for distinctive tissue tropisms [
20,
21]. Therefore, we propose that the difference of virus copies in lung between CHN06 and NX0101 groups may be related to the diversity in the gene expression of env and LTR regions. In our study, the highest number of copies for ALV-J was in heart and kidney tissues at 30 weeks post-infection, during which the tumors were mainly formed. However, we didn’t study organs distributions of ALV-J at the other infective stages. It is also possible that the results of organs distributions may be associated with sampling time, strain, infective stage and individual variation.
Real-time RT-PCR methods with SYBR green and fluorescence probe have been widely used in the detection of many pathogenic microorganisms. Nevertheless, they share the common limitations of false-positive due to high sensitivity requiring no more than 10 viral copies in the samples for detection. Although TaqMan probes provide additional specificity relative to SYBR green, it is relatively more expensive and inconvenient for clinical and experimental detection. In contrast, SYBR green real-time RT-PCR method is low-cost and convenient for detection. Our study performed using both methods allowed to limit non-specific amplifications, assisted with specific primer designed for SYBR green real-time RT-PCR.
In conclusion, SYBR GreenIreal-time PCR assays for the separate detection of subgroup J avian leukosis virus and multiplex detection of avian leukosis virus subgroups A and B are specific, sensitive, inexpensive, rapid, and convenient. Moreover, this assay can be used to analyze viral load quantification in various organ tissues and explore the tissue tropisms of ALV strains. The developed real-time PCR methods will promote the detection of ALV and study of virus replication and infection.
Materials and methods
Ethics statement
None of the experiments in our study involved human participants. Forty plasma samples including twenty-five p27 antigen-positive samples and fifteen p27 antigen-negative samples were collected from forty yellow chickens of Guangdong province in China during an ALV epidemiological investigation conducted by our laboratory. The animal research obtained specific approval and guidance from South China Agriculture University’s Institutional Animal Care and Use Committee. Animal research in our study had also been approved by Guangdong Province Animal Disease Control Center.
Virus and clinical plasma samples
ALV A subgroup strain GD13-1, ALV B subgroup strain CD08, and ALV J subgroup strain CHN06 were isolated and identified by our laboratory and each was proliferated in DF-1 cells for extraction of total cellular RNA followed by cDNA synthesis. The ALV J isolate NX0101 was a gift from Professor Zhizhong Cui of Shandong Agricultural University. The cDNA from Newcastle Disease virus (NDV) strain GM, Avian Influenza Virus (AIV) strain H9N2 and genomic DNA from ALV E subgroup strain HN1301 were maintained in our laboratory and used to check the specificity of the qRT-PCR assay. Forty plasma samples (including twenty-five p27 antigen-positive samples and fifteen p27 antigen-negative samples) collected from forty yellow chickens of Guangdong province in China during the ALV epidemiological investigation conducted by our laboratory were proliferated in DF-1 cells, which are known to be susceptible to exogenous ALV for 7 days [
22]. After repeated freezing and thawing for three times, the DF-1 cells were centrifuged in 4°C at 2,000 g for 2 min. The supernatants were harvested and used to determine ALV p27 with a commercial ELISA kit (IDEXX, Inc., Westbrook, MA) and total cellular RNA was extracted from DF-1 cells with the RNAfast200 kit (Fastagen), followed by cDNA synthesis with the RevertAid First strand cDNA synthesis kit (Fermentas) according to the manufacturer’s instructions. The generated cDNA was then used for routine PCR and real-time PCR amplification.
Cell infection
The DF1 cells grown to monolayer were digested with 0.25% trypsin (Gibco), and the cells were then adjusted to density of 2.0 × 105 cells/mL in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) with 10% FBS (Gibco) in 6-well cell culture plates at 37°C and 5% CO2 until they reached approximately 80% confluence. Five different virus titers from 101 TCID50 to 105 TCID50 per 0.2 ml of ALV-A (GD13-1 strain) were inoculated per well in two 6-well cell culture plates containing DF-1 cells. Two wells on each plate served as the negative control. Each dilution of virus was performed in duplicate. After the inoculum was removed, maintenance medium containing DMEM with 2% FBS was added and the plates were incubated at 37°C and 5% CO2 for another 5 days. The supernatant fluid was then harvested for ALV p27 antigen detection, while total RNA and cDNA from the infected cells were extracted and synthesized as described above.
Samples from ALV-J (CHN06 and NX0101 strains) infected SPF chickens
A total of 30 one-day-old specific-pathogen-free (SPF) egg laying types of chickens (Beijing Merial Vital laboratory Animal Technology Co., Ltd., Beijing, China) were randomly assigned to three study groups: CHN06 infected group, NX0101 infected group and control group with ten chickens per group. Infected groups were intraperitoneally inoculated at a dose of 0.2 mL (104.5 TCID50 /0.2 mL). Control group was injected with DMEM media alone. All groups were reared separately in negative-pressure isolators. Heart, liver, spleen, lung, kidney, bursa, and sternum samples from each bird were collected at 30 weeks post-infection and stored at −80°C until further used. Tissue samples (0.2 g each) were homogenized in phosphate-buffered saline (PBS) and subsequently centrifuged at 1,4000 g for 5 min at 4°C after three rounds of continuous freeze-thawing. Supernatant was gathered and stored at −80°C. A portion of the supernatant was used for p27 antigen detection using an avian leukosis virus antigen test kit. The remaining portion was subjected to total RNA extraction and the RNA concentration of each organ tissue was diluted to the unified level followed by cDNA synthesis according to the methods described above. The animal research obtained specific approval and guidance from South China Agriculture University’s Institutional Animal Care and Use Committee. And our animal research in our study had been approved by Guangdong Province Animal Disease Control Center.
Primer design
The
gp85 gene sequences of ALV-A/B strains aligned using DNAStar (DNASTAR, Inc.,Madison) were retrieved from the GenBank database (GenBank acc. nos. M37980, M19113, L10922.1, HM775328, HM452341, HM452342, HM452339, HM452340, DQ365814, M14902 and HM446005) and the full-length proviral genome sequence of the isolate GD13-1 [
23]. Only a highly conserved region was used to design primers for the multiplex detection of avian leukosis virus subgroups A and B. To detect and distinguish ALV-J from other chicken ALV subgroups (ALV-A, ALV-B, ALV-C, ALV-D, and ALV-E), a pair of primers was designed by aligning the
gp85 gene sequences of ALV-A/B strains described above and previously published ALV sequences including ALV-C: PragueC (J02342), ALV-E:RAV-0(M12172), ALV-J:HPRS103(Z46390), NX0101(DQ115805), HN06(HQ900844). The primer sequences of GAPDH were designed based on a conserved region of chicken GAPDH gene (NM_204305). The optimal primers (Table
6) were syntheszsed by Invitrogen (Shanghai, China).
Table 6
Primers used in this study
env gene amplification of ALV- A/B strains | A/B-F | CACGGTTCCTCCTTAGACA | 242 |
A/B-R | CCGATTAACCCATATCCCTCC |
env gene amplification of ALV J strain | J-F | TGTGTGCGTGGTTATTATTTC | 144 |
J-R | AATGGCGAGGTCGCTGACTGC |
GAPDH gene amplification of chicken | G-F | GAACATCATCCCAGCGTCCA | 112 |
G-R | CGGCAGGTCAGGTCAACAAC |
Real-time PCR
Real-time PCR were performed on an ABI 7500 Real-time PCR System (Applied Biosystems) using iQ SYBR Green Supermix reagents (BIO-RAD) according to the Manufacturer’s specification. The reaction was performed in a 20 μL system containing 10 μL 2 × iQ SYBR Green Supermix, 0.5 μL of 20 μM forward primer, 0.5 μL of 20 μM reverse primer, 0.8 μL of cDNA and 8.2 μL double-distilled water (ddH2O). The real-time PCR was carried out as follows: 1 cycle of 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 35 s. Fluorescent signals were collected during the elongation step.
Plasmid standard preparation
To construct a recombinant plasmid containing the env and GAPDH genes for establishing a standard curve, conventional RT-PCR amplification of the env genes from ALV-A GD13-1 cDNA , ALV-B CD08 cDNA , ALV-J CHN06 cDNA and GAPDH gene from DF-1 cell cDNA were carried out respectively and the primers used are listed in Table
6. Following amplification, the PCR fragments were cloned into the pMD-18 T vector (TaKaRa) to obtain the recombinant plasmids pMDA from GD13-1 cDNA, pMDB from CD08 cDNA, pMDJ from CHN06 cDNA and pMDG from DF-1 cell cDNA. The plasmid concentration was determined with the ND-1000 spectrophotometer (NanoDrop), and the copy number was calculated using the following formula: number of copies = (concentration in ng × 6.02 × 10
23)/(genome length × 10
9 × 650) [
24]. The recombinant plasmids (10
10 copies/μL) were 10-fold serially diluted with ddH
2O and used for the construction of standard curves.
Routine PCR
Routine PCR amplification of different subgroups exogenous ALVs from GD13-1 cDNA , CD08 cDNA and CHN06 cDNA were performed with the subgroup-specific primers described in Table
7 [
25-
27]. Subsequently, the PCR product was purified to construct a recombinant plasmid according to the methods described above. The sensitivity of this conventional RT-PCR assay was evaluated with the newly constructed plasmid diluted serially 10-fold and compared with those of Real-time PCR assay.
Table 7
Primers employed to detect ALV
| F: H5 | GGATGAGGTGACTAAGAAAG | 692 bp |
R: capA | AGAGAAAGAGGGGTGTCTAAGGAGA |
| F: BD-F | CGAGAGTGGCTCGCGAGATGG | 1.1 kb |
R: BD-R | AGCCGGACTATCGTATGGGGTAA |
| F: H5 | GGATGAGGTGACTAAGAAAG | 545 bp |
R: H7 | CGAACCAAAGGTAACACACG |
Statistical analysis
Statistical comparisons were made by GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA) and statistical significance was represented by P values of >0.05, <0.05, 0.01 or 0.001.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
Conceived and designed the experiments: MD ML WC. Performed the experiments: MD MF. Analyzed the data: MD. Contributed reagents/materials/analysis tools: MF MD. Wrote the paper: MD DL. All authors read and approved the final manuscript.