Development and evaluation of novel tumor-targeting paclitaxel-loaded nano-carriers for ovarian cancer treatment: in vitro and in vivo

Loctite, PLA, ethanol, diethyl ether, methanol, tetrahydrofuran (THF), dichloromethane (DCM), polyvinyl alcohol, acetonitrile, epoxy ethane, PTX (99% purity), MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), hexamethyl-disiliconate potassium (KHMDS), dimethyl sulfoxide, SYBR Green Master Mix, and FA were purchased from Fule Biological Technology Co., Ltd. (Jinan, China). TRIzol reagent was supplied by Pufei (Shanghai, China). Moloney murine leukemia virus (M-mlV), dNTPs, and RNase inhibitor were obtained from Promega Corp. (Madison, WI, USA).

In an argon (Ar) gas environment, 10 g of recrystallized lactide was added to conjoined bottle A. THF (20 ml), KHMDS (1.5 ml), and epoxy ethane (2.4 ml) were added to conjoined bottle B, which then was stirred for 2 days. Subsequently, the solution in bottle B was poured into bottle A and stirred for 2 h at 25 °C. Finally, 20 ml of anhydrous acetic acid was added to bottle A and stirred again for 30 min. HCL (0.2 ml) was added to stop the action to form a PEG-PLA block co-polymer. FA was then added for another 24 h of stirring to form PEG-PLA-FA-NP.

PEG-PLA-NP or PEG-PLA-FA-NP (300 mg) dissolved in THF (1 ml) was mixed with PTX (50 mg) dissolved in methylene chloride (1 ml). Subsequently, 3 ml of polyvinyl alcohol was added. The mixed solution was then added to ultrapure water at a speed of 0.4 to 0.6 ml/min and ultra-sonicated at 300 W for 20 min. The emulsion was stirred for 4 h to obtain the precipitate. The PTX-loaded nano-carriers were then ready.

The particle size and zeta potential (ZP) of PTX-PEG-PLA-NP and PTX-PEG-PLA-FA-NP were analyzed using 90-Plus Zeta PALS instrument (Malvern Instruments Ltd., Malvern, UK). Transmission electron microscopy (TEM; Tecnai G2F20 S-Twin, FEI Company, Hillsboro, OR, USA) was used to determine the morphology and surface characteristics of the nano-carriers. Nuclear magnetic resonance spectroscopy (HNMR) was used to test the chemical formula of PEG-PLA-NP and PEG-PLA-FA-NP. The amount of PTX encapsulated in the nano-carriers was measured using high-performance liquid chromatography (HPLC, Agilent Technologies, Palo Alto, CA, USA). The drug encapsulation efficacy (EE) and drug loading (DL) were obtained through the following equations:

The release profiles of PTX from nano-carriers were investigated using the dialysis method. First, PTX-PEG-PLA-NP, PTX-PEG-PLA-FA-NP, and free PTX were dissolved in THF (1 ml) and then placed in a dialysis bag (SnakeSkin, Pierce Biotechnology, Rockford, IL, USA) (3500 KDa) and then immersed in 50 ml of phosphate-buffered saline (PBS). At each predetermined time point (1, 2, 4, 6, 12, 24, 48, 72, 96, 125, and 160 h), 5 ml of PBS was removed and another 5 ml of fresh PBS was added. The PTX concentration in the removed PBS was then analyzed using HPLC to determine the released PTX content.

Human ovarian carcinoma cell lines SK-OV-3, HO-8910, and A2780 were supplied by the Gynecology Oncology Key Laboratory of Qilu Hospital. The expression levels of folic acid receptor α (FARα) in 3 ovarian cancer cell lines were determined using real-time polymerase chain reaction (RT-PCR) testing. A2780, SKOV3 and HO8910 cells (STR for A2780, SK-OV-3 and HO-8910 cells were shown in Additional file 1: Figures S1-S3.) were cultured in RPMI 1640 medium with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin/streptomycin combination. Total RNA was isolated from the above cells using Trizol reagent respectively. Qualitative reverse transcription PCR was performed using Fast-Start Universal SYBR Green Master Mix. Primers for FR gene expression detection were 5′–GAACGCCAAGCACCACAAG–3′ (forward) and 5′–GGTCGACACTGCTCATGCAA–3′ (reverse). Data analysis was performed using the comparative Ct method (2ΔΔCt).

Cellular uptake characteristics of two kinds of nano-carriers were analyzed by fluorescence microscopy (Olympus, Tokyo, Japan). Fluorescent marker FITC was combined with PEG-PLA-NP or PEG-PLA-FA-NP. Two kinds of FITC-NP solutions were co-incubated with 3 different ovarian cancer cells for different intervals (1, 2, 4, 6, and 12 h). We normalized the FITC fluorescence to DAPI to test the different cellular densities of different cell types to in the cell uptake experiment. PEG-PLA-FA-NP samples with different FA percentages (5%, 10%, and 20%) were also prepared and co-incubated with SK-OV-3 cells to verify the influence of the FA concentration on cellular uptake. In order to verity FAR-mediated tumor targeting, competition assay using different concentration FA contained culture medium (0 μg/ml, 5 μg/ml, 20 μg/ml and 50 μg/ml in cell culture medium) were performed to test whether PTX-PEG-PLA-FA-NP uptake is FAR-specific on SK-OV-3 cells or not. The intracellular fluorescence images were observed, and the fluorescence intensity was analyzed using Image J software (National Institutes of Health, Rockville, MD, USA).

The cytotoxicity of the blank NP solution and two kinds of PTX-NPs were assessed by the MTT assay. Different concentrations of the PEG-PLA-NP solutions (0–100 μg/ml) were used to test the cytotoxicity of the blank nano-carriers. Furthermore, standard solutions (PTX, PTX-PEG-PLA-NP, and PTX-PEG-PLA-FA-NP with 10, 25, 50, 75, and 100 μg/ml in PTX concentration) were co-incubated with SK-OV-3 cells at different intervals (12, 24, 36, and 48 h). The MTT test was then performed as described before [16].

The experimental protocol of the animals in this research was approved by the Animal Ethics Committee of Shandong University (DWLL-2015-001). Healthy female athymic mice (BALB/c nu-nu) (4–6 weeks old) were supplied by the Experimental Animal Center of Shandong University in Jinan, China. SK-OV-3 ovarian cancer cells (1.0 × 10⁷) were implanted subcutaneously or intraperitoneally into the mice to establish subcutaneous or abdominal tumor-bearing models. To establish the standard curve of PTX, blood and tissue samples (liver, spleen, kidney, heart, lung, uterus, small intestine, and tumor tissues) from tumor-bearing mice were homogenized with 5 ml of PBS. Subsequently, 20 μl different quantitative standard PTX solutions (0.95, 1.9, 9.5, 19, 38, 76, and 152 μg/ml) were added to homogenate samples (200 μl), followed by an HPLC test. The linear regression equation was then established based on the PTX concentration (X) and AUC (Y) value from the HPLC test. Abdominal tumor-bearing mice were randomly divided into 3 groups (30 mice/group). Each mouse was intravenously injected with either PTX or PTX nano-carriers solution (6 mg/kg). At predetermined time points (1, 2, 4, 6, 12, and 24 h), 5 mice in each group were euthanized; their plasma and tissue samples were quickly collected for an HPLC test and then calculated based on the linear regression equation mentioned above to determine the PTX concentration in the samples.

The subcutaneous tumor-bearing animal mice were randomly divided into 4 groups (7/group). A single dose of PTX (6 mg/kg) in free PTX, PTX-PEG-PLA-NP, or PTX-PEG-PLA-FA-NP groups was intravenously administered to each mouse and saline solution was used as a control. Each injection was repeated every 3 days for a total of 6 consecutive injections [17]. The tumor sizes and animal body weights were then measured every 3 days. Tumor size was calculated using the formula V = (ab²)/2, where a represents the longest diameter and b represents the diameter orthogonal to a (mm).

Statistical evaluations of data were performed using Student’s unpaired t-test. Statistical analysis was performed using SPSS 20.0 software (SPSS, Inc., Chicago, IL, USA). A value of p < 0.05 was considered statistically significant.

Figure 1a/b represents the HNMR feature of PEG-PLA-NP and PEG-PLA-FA-NP. It shows that there was a peak at 2.60 ppm in PEG-PLA-FA-NP compared to PEG-PLA-NP, which successfully confirmed that FA was linked to PEG-PLA-NP. The particle sizes were 167.54 ± 13.80 nm for PTX-PEG-PLA-NP, as shown in Fig. 1c, and 192.32 ± 21.33 nm for PTX-PEG-PLA-FA–NP, as seen in Fig. 1d. Figure 1e shows the particle size of two different nanoparticles, there is no statistically significant of the two types of nanoparticles (P > 0.05). Figure 1f shows the TEM images of the nano-carriers, which were well separated, spherical in shape, and had a smooth surface. The ZP values in two kinds of PTX-NPs were − 39.81 ± 3.45 mV and − 18.47 ± 1.45 mV, respectively. The EE was approximately 73.75% for PTX-PEG-PLA-NP and 81.50% for PTX-PEG-PLA-FA-NP, while the amounts of DL were 12.29% and 5.42%, respectively.

As shown in Fig. 2a, the drug release rates of the two nano-carriers were 6.98% and 5.44%, which were much less than that of the free PTX solution (10.84%) at 4 h. Moreover, the cumulative release rate of PTX in the free PTX solution increased markedly after 4 h compared with the two PTX-NP groups, which indicated that nano-carriers had the advantage of drug slow-release effect.

Standard curves were established for calculating the PTX concentrations in various tissues and plasma. Linear regression analysis provided the linear regression equation between the PTX concentration (X) and AUC (Y) (Table 1). Pharmacokinetic features are shown in Fig. 2b. The elimination phases (t_1/2,β) of PTX-PEG-PLA-FA-NP and PTX-PEG-PLA-NP (15.92 h and 13.47 h, respectively) were much longer than those of the free PTX (6.41 h, p < 0.05). The AUC was 159.81 μg/ml/h for PTX-PEG-PLA-NP and 132.72 μg/ml/h for PTX-PEG-PLA-FA-NP (p > 0.05), which were both approximately 3-fold greater than the free PTX (52.65 μg/ml/h, p < 0.05). Based on these results, the PTX loaded into the nano-carriers was cleared much more slowly than the free PTX in blood circulation. The slow-release effect of the nano-carriers was proved again in addition to the results of the drug release study.

As shown in Fig. 3b, the FARα levels in the SK-OV-3 cells (79.91 ± 9.78) were much higher than in the other two cells HO-8910 (66.71 ± 5.23) and A2710 (1.00 ± 0.05) (p < 0.05). Based on this result, SK-OV-3 was used in the following experiments.

As shown in Additional file 2: Figure S1, we normalized the FITC fluorescence to DAPI to test the different cellular densities of different cell types in the cell uptake experiment. The results showed that there were no statistical difference among groups (p > 0.05), which indicated that the number of cells in each group was the same. As shown in Fig. 3a, the SK-OV-3 cells took up more PEG-PLA-FA-NP than PEG-PLA-NP. In addition, more PEG-PLA-FA-NP was taken up by the SK-OV-3 cells than the HO-8910 and A2780 cells. The fluorescence intensity of PEG-PLA-NP in three ovarian cancer cell lines (A2780, HO-8910, and SK-OV-3) were 12.62 ± 2.63 a.u., 34.58 ± 6.22 a.u., and 29.19 ± 7.63 a.u. (p > 0.05), respectively. In the PEG-PLA-FA-NP group, the fluorescence intensities were 20.83 ± 6.27 a.u., 40.56 ± 13.44 a.u., and 61.245 ± 1.47 a.u. (p < 0.05), respectively. In the SK-OV-3 cells, the fluorescence intensity of PEG-PLA-FA-NP was much higher than PEG-PLA-NP, as shown in Fig. 3c, while in the other two cancer cell lines, there were no statistical differences between the two groups (p > 0.05). Figure 3d shows that the fluorescence intensity peaked at 4 h in all three kinds of cancer cells. Figure 3e shows that in the SK-OV-3 cells, the PEG-PLA-FA-NP solution with 10% FA had greater uptake than both 5% FA and 20% FA. Based on these results, PEG-PLA-FA-NP-based tumor-targeting characteristics were confirmed in vitro, and several parameters such as the SK-OV-3 cells, 4 h after drug delivery, and 10% FA contents were used in the following experiments. Figure 3f shows the cellular uptake results of PTX-PEG-PLA-FA-NP in SK-OV-3 cells in different concentration FA contained culture medium (0 μg/ml, 5 μg/ml, 20 μg/ml and 50 μg/ml) by fluorescence microscopy; The images showed that more PTX-PEG-PLA-FA-NP was taken up by SK-OV-3 cells in the FA-free culture medium. With FA concentration increase from 5 μg/ml to 50 μg/ml the fluorescence signals in the SK-OV-3 cells decreased accordingly, with suggested that PTX-PEG-PLA-FA-NP uptake were FAR-specific on SK-OV-3 cells; Fig. 3g shows the fluorescence intensity of PTX-PEG-PLA-FA-NP in SK-OV-3 cells with different concentration FA contained culture medium (0 μg/ml, 5 μg/ml, 20 μg/ml, 50 μg/ml).

Figure 4a shows that up to a concentration of 100 μg/ml, PEG-PLA-NP did not obviously inhibit the SK-OV-3 cells, with a relative cell viability rate of 80%, which confirmed the hypotoxicity of PEG-PLA-NP. Figure 4b indicates that PTX-PEG-PLA-FA-NP had more cytotoxicity against the SK-OV-3 cells at multiple dosages than the other two groups given the same PTX concentrations (co-incubated for 24 h) (p < 0.05). However, PTX-PEG-PLA-NP showed an equivalent inhibitory efficacy to free PTX (p > 0.05). For example, at a PTX dose of 50 μg/ml, the cell inhibition rates were 0.15 ± 0.05, 0.36 ± 0.05, and 0.53 ± 0.04 in the PTX, PTX-PEG-PLA-NP, and PTX-PEG-PLA-FA-NP groups, respectively (p < 0.05). Once loaded into PEG-PLA-FA-NP, only a half dose of PTX could achieve the same toxicity as the full dose of free PTX. Figure 4c shows that the toxicities of the three different groups (PTX concentration was 50 μg/ml) were time-dependent and the cytotoxicity peaked 48 h after drug delivery.

The PTX levels in plasma and other tissues at different time points after drug delivery are shown in Fig. 5. First, the peak reach times were extended in both nano-carrier groups (6 h) compared to the free PTX group (2 h) in all tissues, including the tumor tissue, as shown in Fig. 6a. These results once again confirmed the slow-release effect of nano-carriers similar to the pharmacokinetics study results. Second, in tumor tissues, the PTX concentrations in the PTX-PEG-PLA-FA-NP group (15.27 ± 0.48 μg/ml) at 6 h after drug delivery were much higher than in the free PTX (4.66 ± 0.36 μg/ml, p < 0.05) and PTX-PEG-PLA-NP groups (5.88 ± 0.67 μg/ml, p < 0.05), as shown in Fig. 6b, while there was no statistical difference between the latter two groups. We also obtained the same results at other time points. All these results indicated the tumor-targeting characteristic of PTX-PEG-PLA-FA-NP based on FA-mediated active targeting. Third, except for the liver, uterus, and tumor tissues, PTX-PEG-PLA-NP had greater uptake than in the PTX-PEG-PLA-FA-NP group by other tissues at most time points. Interestingly, the PTX concentration was at low levels in the kidney, heart, lungs, and small intestine in the PTX-PEG-PLA-FA-NP group compared to the liver and uterine tissues.

The final tumor sizes in the treated mice were notably reduced in the PTX-PEG-PLA-FA-NP group, as seen in Fig. 7b, while there was no statistical difference between the free PTX and PTX-PEG-PLA-NP groups (p > 0.05). The final tumor size in the PTX-PEG-PLA-FA-NP group was 477.89 ± 4.66 mm³, which was much smaller than in the PTX-PEG-PLA-NP (591.89 ± 9.37 mm³, p < 0.05) and free PTX (608.38 ± 6.05 mm³, p < 0.05) groups as well as the control group (822.31 ± 43.10 mm³, p < 0.05). All treatment groups exhibited obvious anti-tumor effects compared to the control group (p < 0.05). The tumor growth curve showed that the PTX-PEG-PLA-FA-NP group had a much stronger anti-tumor effect than the other groups, as shown in Fig. 7c. The tumor inhibitory rates based on tumor volume were 41.88% in the PTX-PEG-PLA-FA-NP group, which was around 1.5 times higher than in the PTX-PEG-PLA-NP (28.02%) and free PTX groups (25.99%). Figure 7d shows the body weight changes of the animals. There was no significant difference among the four groups (p > 0.05), which indicated that there were no obvious side effects in the nano-carriers group.