Skip to main content
Erschienen in: Virology Journal 1/2018

Open Access 01.12.2018 | Short report

Development of a GFP expression vector for Cucurbit chlorotic yellows virus

verfasst von: Ying Wei, Xiaoyu Han, Zhenyue Wang, Qinsheng Gu, Honglian Li, Linlin Chen, Bingjian Sun, Yan Shi

Erschienen in: Virology Journal | Ausgabe 1/2018

download
DOWNLOAD
print
DRUCKEN
insite
SUCHEN

Abstract

Background

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date.

Finding

We constructed a CCYV GFP expression vector using the “add a gene” strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFPSGC, pCCYVGFPCGC, and pCCYVGFPCGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFPCGC-infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFPSGC and pCCYVGFPCGS were mainly found in single cells. Further observation of pCCYVGFPCGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves.

Conclusions

We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.
Abkürzungen
CCYV
Cucurbit chlorotic yellows virus
CEs
controller elements
GFP
green fluorescent protein
SPCSV
Sweet potato chlorotic stunt virus
Cucurbit chlorotic yellows virus (CCYV), a recently discovered cucurbit-infecting crinivirus in the family Closteroviridae [17], is among the largest single-strand positive-sense RNA viruses [8]. The bipartite RNA genome comprises a 8607 nucleotide [nt] RNA1 and a 8041-nt RNA2. Recent studies on CCYV [912] have been hampered due to lack of reverse genetic tools. The construction of full-length infectious cDNA clones will facilitate the investigation of viral determinants of virus replication and movement, as well as the interactions between viral proteins and host factors. Our previous study developed two sets of full-length CCYV cDNA clones under the control of the T7 RNA polymerase promoter and 35S promoter [13].
Virus-based vectors are useful tools for the study of plant molecular biology. A number of plant virus vectors have been developed to express heterologous genes of interest in plants [1418]. Only LIYV has been reported to construct a green fluorescence protein (GFP) vector for crinivirus using the ORF fusion strategy. Part of LIYV RNA1 encoded P34 protein was replaced by a GFP gene and further observation of Nicotiana benthamiana (Nb) leaves agro-infiltrated by the resultant clone displayed occasional single cells green fluorescence. Limited GFP expression has been observed in Nicotiana benthamiana plants, but in no other hosts. Cucumber is an economically important cultivated plant, and the available GFP expression vector of cucurbit viruses is limited [19]. In this study, we constructed a CCYV GFP expression vector using the “add a gene” strategy with an extra subgenomic RNA and a foreign GFP protein, according to a previous study of the closterovirus Citrus tristeza virus [20], which suggested that this strategy would be more appropriate than ORF substitution or ORF fusion. We examined the systemic leaves of cucumber plants regarding the resulting GFP fluorescence.
We chose to insert gfp ORF before the CP gene, because the CP subgenomic controller elements (CEs) are more suitable than other CEs [2023]. The full-length CCYV RNA2 clone was modified to accommodate the gfp gene immediately upstream of the CP open reading frame via overlapping polymerase chain reaction (PCR). Sweet potato chlorotic stunt virus (SPCSV) CP CEs were used to direct the expression of the CCYV CP gene or GFP. The strategy used to construct the full-length cDNA clones of RNA1 and RNA2 is outlined in Fig. 1. The resulting clones were named pCCYVGFPSGC, pCCYVGFPCGC, and pCCYVGFPCGS. To construct the clone pCCYVGFPCGS, four overlapping fragmens were amplified using the primer pairs showed in Table 1 and the recombinant fragment were obtained using overlap PCR. Restriction enzymes MluI and NruI were used to insert the fragment into the pCBCCYVRNA2 to acquire the GFP-tagged vector pCCYVGFPCGS. Based on pCCYVGFPCGS, a fragment from 4811 to 5193 nt covering CCYVCP CEs and partial CP sequence was amplified using primer pair CCYVCcgccF2F/CCYVCcgscF2R. pCCYVGFPCGS and the fragment were digested by PacI and NruI to acquire the recombinant clone pCCYVGFPCGC. pCCYVGFPSGC vector was cloned based on pCCYVGFPCGC. Three overlapping fragments were amplified using primer pairs CCYVcgscF1F/CCYVsgccF1R, CCYVsgccSPCSVCPpF/CCYVsgccSPCSVCPpR, and CCYVsgccGFPF/CCYVcgscF2R, and overlap PCR was used to ligate the fragments and inserted into pCBCCYVRNA2 vector using restriction enzymes MluI and NruI. The resultant clones were transformed into Agrobacterium tumefaciens strain GV3101 for agroinfiltration. At 25 days after agroinfiltration of pCCYVGFP with pCBCCYVRNA1 and pCBP1/HC-Pro in C. sativus, the adaxial side of leaf was used to observe the GFP fluorescence using epifluorescence microscope (Nikon ECLIPSE Ti-S) with the excitation of 460-480 nm and emission wavelength of 500-540 nm, respectively (Fig. 2a). GFP fluorescence was detectable not only in leaf veins, but also in the surrounding cells. This result is consistent with that of a previous study of CCYV localization in leaf laminae using immunoblots [9]. We observed that pCCYVGFPCGC-inoculated cucumber leaves exhibited cell spread at 25 dpi, whereas the other two constructs were mainly found in single cells (Fig. 2b). The number of pCCYVGFPCGC fluorescent cells was significantly higher than that of pCCYVGFPCGS fluorescent cells. Further observation of pCCYVGFPCGC at 30 dpi showed that GFP was mainly vein-limited in cucumber systemic leaves (Fig. 3). Time course observation of pCCYVGFPCGC GFP fluorescence showed that at 40 dpi the GFP fluorescence was mainly focused in the second systemic leaf and at 50 dpi the fluorescence was mainly focused in the main vein of systemic leafs showing the most fluorescence in the third systemic leaf (Fig. 3).
Table 1
Primer sets used in the paper
Primer name
Sequence (5′-3′)
CCYVcgscF1F
CTACTATTGGACGCGTTATTG
CCYVcgscF1GFPR
CTCGCCCTTGCTCACCATATTTAATGTAGATCGAGT
CCYVcgscGFPF
ACTCGATCTACATTAAATATGGTGAGCAAGGGCGAG
CCYVcgscGFPR
ATACCAAGTTTTAATTAATCAAAGATCTACCATGTACAGC
CCYVcgscSPCSVCPpF
AGATCTTTGATTAATTAAAACTTGGTATCGCGGTTG
CCYVcgscSPCSVpCPR
ATTGTCAGTCTTCTCCATACTCGTCTCACTGCTTAG
CCYVcgscF2F
CTAAGCAGTGAGACGAGTATGGAGAAGACTGACAAT
CCYVcgscF2R
CGAAATCCCTCATACACTGTTC
CCYVCcgccF2F
CGCTTAATTAATCAGTGATTATCTTCAAATTC
CCYVsgccF1R
ACCAACCGCGATACCAAGTTTCAGTTAAAAAATTTTGGTA
CCYVsgccSPCSVCPpF
TACCAAAATTTTTTAACTGAAACTTGGTATCGCGGTTGGT
CCYVsgccSPCSVCPpR
CCTCGCCCTTGCTCACCATACTCGTCTCACTGCTTAGTT
CCYVsgccGFPF
AACTAAGCAGTGAGACGAGTATGGTGAGCAAGGGCGAGG
As previously reported for the closterovirus CTV, a heterologous BYV sgRNA CE to control GFP expression was stable and worked best of the stratefies examined [20]. The closterovirus beet yellow stunt virus (BYSV) 248 bp upstream of the CP coding region was chosen to direct the expression of BYV CP, and the original CP promoter was used to direct GFP expression [24]. We chose a 201-bp CE sequence upstream of the SPCSV CP coding region to test the heterologous effect, and a 131-bp CE of CCYV CP to test the homologous effect. According to our results, the homologous sequence repeats in the vector promoted the GFP expression of CCYV, whereas when we used the CE of SPCSV CP to direct expression of CCYV CP or GFP, GFP expression was delayed. Hence, pCCYVGFPCGC can be used as a candidate for further study of GFP expression. Here we tested the insertion of GFP before the CP coding region. Other positions could be tested further to see if the other position would work better.

Acknowledgements

We thank Dr. Fengmin Yan for helpful comments on the preparation of this manuscript.

Funding

Financial support was provided by National Natural Science Foundation of China (31701944).
Not applicable.
All the authors consent to publish.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Abrahamian P, Sobh H, Abou-Jawdah YA. First report of Cucurbit chlorotic yellows virus on cucumber in Lebanon. Plant Dis. 2012;96:1704.CrossRef Abrahamian P, Sobh H, Abou-Jawdah YA. First report of Cucurbit chlorotic yellows virus on cucumber in Lebanon. Plant Dis. 2012;96:1704.CrossRef
2.
Zurück zum Zitat Gu QS, Liu YH, Wang YH, Huangfu WG, Gu HF, Xu L, Song FM, Brown JK. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in China. Plant Dis. 2011;95:1168.CrossRef Gu QS, Liu YH, Wang YH, Huangfu WG, Gu HF, Xu L, Song FM, Brown JK. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in China. Plant Dis. 2011;95:1168.CrossRef
3.
Zurück zum Zitat Huang LH, Tseng HH, Li JT, Chen TC. First report of Cucurbit chlorotic yellows virus infecting cucurbits in Taiwan. Plant Dis. 2010;94:1168.CrossRef Huang LH, Tseng HH, Li JT, Chen TC. First report of Cucurbit chlorotic yellows virus infecting cucurbits in Taiwan. Plant Dis. 2010;94:1168.CrossRef
4.
Zurück zum Zitat Keshawarz T, Shams-Bakhsh M, Izadpanah K, Malboobi MA. Occurrence and genome analysis of Cucurbit chlorotic yellows virus in Iran. J Phytopathol. 2014;162:523–6.CrossRef Keshawarz T, Shams-Bakhsh M, Izadpanah K, Malboobi MA. Occurrence and genome analysis of Cucurbit chlorotic yellows virus in Iran. J Phytopathol. 2014;162:523–6.CrossRef
5.
Zurück zum Zitat Okuda M, Okazaki S, Yanasaki S, Okuda S, Sugiyama M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus crinivirus. Phytopathology. 2010;100:560–6.CrossRefPubMed Okuda M, Okazaki S, Yanasaki S, Okuda S, Sugiyama M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus crinivirus. Phytopathology. 2010;100:560–6.CrossRefPubMed
6.
Zurück zum Zitat Orfanidou C, Maliogka VI, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis. 2014;98:1446–7.CrossRef Orfanidou C, Maliogka VI, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis. 2014;98:1446–7.CrossRef
7.
Zurück zum Zitat Hamed K, Menzel W, Dafalla G, Gadelseed AMA, Winter S. First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis. 2011;95:1321.1.CrossRef Hamed K, Menzel W, Dafalla G, Gadelseed AMA, Winter S. First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis. 2011;95:1321.1.CrossRef
8.
Zurück zum Zitat Martelli IM, Agranovsky AA, Bar-Joseph M, Boscia D, Candresse T, Coutts RHA, et al. Closteroviridae. In: Andrew MQ, King MJA, Carstens EB, Lefkowitz EJ, editors. Virus taxonomy classification and nomenclature of viruses ninth report of the international committee taxonomy of viruses. USA: Elsevier Inc.; 2012. p. 987–1001. Martelli IM, Agranovsky AA, Bar-Joseph M, Boscia D, Candresse T, Coutts RHA, et al. Closteroviridae. In: Andrew MQ, King MJA, Carstens EB, Lefkowitz EJ, editors. Virus taxonomy classification and nomenclature of viruses ninth report of the international committee taxonomy of viruses. USA: Elsevier Inc.; 2012. p. 987–1001.
9.
Zurück zum Zitat Kubota K, Usugi T, Tsuda S. Production of antiserum and immunodetection of Cucurbit chlorotic yellows virus, a novel whitefly-transmitted crinivirus. J Gen Plant Pathol. 2011;77:116–20.CrossRef Kubota K, Usugi T, Tsuda S. Production of antiserum and immunodetection of Cucurbit chlorotic yellows virus, a novel whitefly-transmitted crinivirus. J Gen Plant Pathol. 2011;77:116–20.CrossRef
10.
Zurück zum Zitat Okuda S, Okuda M, Sugiyama M, Sakata Y, Takeshita M, Iwai H. Resistance in melon to Cucurbit chlorotic yellows virus, a whitefly-transmitted crinivirus. Eur J Plant Pathol. 2013;135:313–21.CrossRef Okuda S, Okuda M, Sugiyama M, Sakata Y, Takeshita M, Iwai H. Resistance in melon to Cucurbit chlorotic yellows virus, a whitefly-transmitted crinivirus. Eur J Plant Pathol. 2013;135:313–21.CrossRef
11.
Zurück zum Zitat Wang Z, Gu Q, Sun H, Li H, Sun B, Liang X, et al. One-step reverse transcription loop mediated isothermal amplification assay for sensitive and rapid detection of Cucurbit chlorotic yellows virus. J Virol Methods. 2014;195:63–6.CrossRefPubMed Wang Z, Gu Q, Sun H, Li H, Sun B, Liang X, et al. One-step reverse transcription loop mediated isothermal amplification assay for sensitive and rapid detection of Cucurbit chlorotic yellows virus. J Virol Methods. 2014;195:63–6.CrossRefPubMed
12.
Zurück zum Zitat Wang ZY, Wang YZ, Sun H, Gu QS, Li HL, Sun BJ, et al. Two proteins of Cucurbit chlorotic yellows virus, P59 and P9, are self-interacting. Virus Genes. 2015;51:152–5.CrossRefPubMed Wang ZY, Wang YZ, Sun H, Gu QS, Li HL, Sun BJ, et al. Two proteins of Cucurbit chlorotic yellows virus, P59 and P9, are self-interacting. Virus Genes. 2015;51:152–5.CrossRefPubMed
13.
Zurück zum Zitat Shi Y, Chen L, Sun B, Sun X, Wang Z, Gu Q, et al. Infectious clones of the crinivirus Cucurbit chlorotic yellows virus are competent for plant systemic infection and vector transmission. J Gen Virol. 2016;97(6):1458–61.CrossRefPubMed Shi Y, Chen L, Sun B, Sun X, Wang Z, Gu Q, et al. Infectious clones of the crinivirus Cucurbit chlorotic yellows virus are competent for plant systemic infection and vector transmission. J Gen Virol. 2016;97(6):1458–61.CrossRefPubMed
14.
Zurück zum Zitat Baulcombe DC, Chapman S, Santa Cruz S. Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 1995;7(6):1045–53.CrossRefPubMed Baulcombe DC, Chapman S, Santa Cruz S. Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 1995;7(6):1045–53.CrossRefPubMed
15.
Zurück zum Zitat Toth RL, Chapman S, Carr F, Santa Cruz S. A novel strategy for the expression of foreign genes from plant virus vectors. FEBS Lett. 2001;489(2-3):215–9.CrossRefPubMed Toth RL, Chapman S, Carr F, Santa Cruz S. A novel strategy for the expression of foreign genes from plant virus vectors. FEBS Lett. 2001;489(2-3):215–9.CrossRefPubMed
16.
Zurück zum Zitat Liu Z, Kearney CM. A tobamovirus expression vector for agroinfection of legumes and Nicotiana. J Biotechnol. 2010;147(3-4):151–9.CrossRefPubMed Liu Z, Kearney CM. A tobamovirus expression vector for agroinfection of legumes and Nicotiana. J Biotechnol. 2010;147(3-4):151–9.CrossRefPubMed
17.
Zurück zum Zitat Shivprasad S, Pogue GP, Lewandowski DJ, Hidalgo J, Donson J, Grill LK, et al. Heterologous sequences greatly affect foreign gene expression in tobacco mosaic virus-based vectors. Virology. 1999;255(2):312–23.CrossRefPubMed Shivprasad S, Pogue GP, Lewandowski DJ, Hidalgo J, Donson J, Grill LK, et al. Heterologous sequences greatly affect foreign gene expression in tobacco mosaic virus-based vectors. Virology. 1999;255(2):312–23.CrossRefPubMed
18.
Zurück zum Zitat Canizares MC, Lomonossoff GP, Nicholson L. Development of cowpea mosaic virus-based vectors for the production of vaccines in plants. Expert Rev Vaccines. 2005;4(5):687–97.CrossRefPubMed Canizares MC, Lomonossoff GP, Nicholson L. Development of cowpea mosaic virus-based vectors for the production of vaccines in plants. Expert Rev Vaccines. 2005;4(5):687–97.CrossRefPubMed
19.
Zurück zum Zitat Rhee S-J, Jang YJ, Lee GP. Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector. Arch Virol. 2016;161(6):1527–38.CrossRefPubMed Rhee S-J, Jang YJ, Lee GP. Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector. Arch Virol. 2016;161(6):1527–38.CrossRefPubMed
20.
Zurück zum Zitat Folimonov AS, Folimonova SY, Bar-Joseph M, Dawson WO. A stable RNA virus-based vector for citrus trees. Virology. 2007;368(1):205–16.CrossRefPubMed Folimonov AS, Folimonova SY, Bar-Joseph M, Dawson WO. A stable RNA virus-based vector for citrus trees. Virology. 2007;368(1):205–16.CrossRefPubMed
21.
Zurück zum Zitat Ayllon MA, Gowda S, Satyanarayana T, Dawson WO. cis-acting elements at opposite ends of the Citrus tristeza virus genome differ in initiation and termination of subgenomic RNAs. Virology. 2004;322(1):41–50.CrossRefPubMed Ayllon MA, Gowda S, Satyanarayana T, Dawson WO. cis-acting elements at opposite ends of the Citrus tristeza virus genome differ in initiation and termination of subgenomic RNAs. Virology. 2004;322(1):41–50.CrossRefPubMed
22.
Zurück zum Zitat Gowda S, Satyanarayana T, Davis CL, Navas-Castillo J, Albiach-Marti MR, Mawassi M, et al. The p20 gene product of Citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology. 2000;274(2):246–54.CrossRefPubMed Gowda S, Satyanarayana T, Davis CL, Navas-Castillo J, Albiach-Marti MR, Mawassi M, et al. The p20 gene product of Citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology. 2000;274(2):246–54.CrossRefPubMed
23.
Zurück zum Zitat Kurth EG, Peremyslov VV, Prokhnevsky AI, Kasschau KD, Miller M, Carrington JC, et al. Virus-derived gene expression and RNA interference vector for grapevine. J Virol. 2012;86(11):6002–9.CrossRefPubMedPubMedCentral Kurth EG, Peremyslov VV, Prokhnevsky AI, Kasschau KD, Miller M, Carrington JC, et al. Virus-derived gene expression and RNA interference vector for grapevine. J Virol. 2012;86(11):6002–9.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Peremyslov VV, Hagiwara Y, Dolja VV. HSP70 homolog functions in cell-to-cell movement of a plant virus. Proc Natl Acad Sci U S A. 1999;96(26):14771–6. Peremyslov VV, Hagiwara Y, Dolja VV. HSP70 homolog functions in cell-to-cell movement of a plant virus. Proc Natl Acad Sci U S A. 1999;96(26):14771–6.
Metadaten
Titel
Development of a GFP expression vector for Cucurbit chlorotic yellows virus
verfasst von
Ying Wei
Xiaoyu Han
Zhenyue Wang
Qinsheng Gu
Honglian Li
Linlin Chen
Bingjian Sun
Yan Shi
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2018
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-018-1004-9

Weitere Artikel der Ausgabe 1/2018

Virology Journal 1/2018 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.