Skip to main content
Erschienen in: Virology Journal 1/2015

Open Access 01.12.2015 | Research

Development of a real-time reverse transcription loop-mediated isothermal amplification method for the rapid detection of porcine epidemic diarrhea virus

verfasst von: Xuewu Yu, Lin Shi, Xiaoping Lv, Wei Yao, Minghui Cao, Hanxun Yu, Xiurong Wang, Shimin Zheng

Erschienen in: Virology Journal | Ausgabe 1/2015

Abstract

Background

Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease characterized by severe enteritis, vomiting and watery diarrhea in swine. Recently, the outbreak of the epidemic disease has been a serious problem in swine industry. The objective of this study is to develop a rapid, sensitive, and real-time reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for the detection of porcine epidemic diarrhea virus (PEDV) in less equipped laboratories.

Results

The optimal reaction condition of the current real-time RT-LAMP for PEDV was 62 °C for 45 min. It was capable of detecting PEDV from clinical samples and differentiating PEDV from several related porcine viruses, while it did not require additional expensive equipment. The minimum detection limit of the real-time RT-LAMP assay was 0.07PFU per reaction for PEDV RNA, making this assay approximately 100-fold more sensitive than that of one-step RT-PCR. By screening a panel of clinical specimens, the results showed that this method presented a similar sensitivity with real-time RT-PCR and was somewhat sensitive than one-step RT-PCR in detection of clinical samples.

Conclusions

In this study, we have developed a new real-time RT-LAMP method, which is rapid, sensitive and efficient to detect PEDV.This method holds great promises not only in laboratory detection and discrimination of PEDV but also in large scale field and clinical studies.
Hinweise
Xuewu Yu and Lin Shi contributed equally to this work.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

XWY, LS and SMZ conceived the study and wrote the paper. XWY and LS designed the Oligonucleotide primer, XWY and LS carried out this study, XPL and WY analyzed the data, HXY and WY collected the clinical samples, XRW and MHC revised the manuscript critically. All of the authors read and approved the final version of this manuscript.

Background

Porcine epidemic diarrhea (PED) is an acute, highly contagious and devastating enteric disease characterized by severe enteritis, vomiting and watery diarrhea in swine [1]. PED is caused by porcine epidemic diarrhea virus (PEDV), which was firstly identified in Belgium in 1978 [2]. PEDV is an enveloped, single-strand, and positive-sense RNA virus, which belongs to the Coronaviridae family [3]. The PEDV genome is ~28 kb in length and comprised of a 5′ untranslated region (UTR), a 3′ UTR, and at least seven open reading frames (ORFs) that encode four structural proteins [spike (S),envelope (E), membrane (M),and nucleocapsid (N)] and three non-structural proteins(replicase 1a and 1b, and ORF3) [4].
In China, PED was firstly occurred in Shanghai in 1973. So far, PEDV has been observed on most swine breeding farms in most provinces since late 2010 in China [5].The economic losses caused by PEDV infection have been continuous and serious in China [6]. Recently, PEDV has suddenly emerged in the United States and rapidly spread across the country, resulting in high mortality in infected newborn piglets, which have posed serious economic losses to the swine industry in the USA [7, 8]. Rapid diagnosis and timely monitoring of potential PED outbreaks are among the first important steps in the prevention and control of PED. Currently, several conventional methods are available for the detection of PEDV, including virus isolation, fluorescence assay, immune electron microscopy, enzyme-linked immuno- sorbent assay and molecular biological characterization [9]. However, the isolation and identification of viruses require extended periods of time ranging from days to weeks; so this method does not meet the time requirements needed for the prevention of epidemics. Therefore, these rapid, sensitive and specific molecular biological techniques, including RT-PCR and real-time RT-PCR, have played important roles in the rapid detection of PEDV [10]. Nevertheless, all of these techniques require sophisticated instrumentation (such as PCR machines and quantitative fluorescence PCR machines), limiting the effectiveness of these procedures in smaller, under-equipped laboratories.
The loop-mediated isothermal amplification (LAMP) technique is a molecular biology method used to amplify specific DNA fragments in vitro [11]. This method only requires a water bath or heating block to amplify large amounts of nucleic acids in 30 ~ 60 minutes without additional expensive equipments [12]. In addition, there is no need to use nucleic acid electrophoresis to assess the result, for the reason that the result can be easily observed in the presence of a fluorescent dye [13]. These characteristics make the LAMP method a simple, fast, effective and practical DNA amplification method, which has been successfully implemented for the detection of avian influenza A viruses [14], porcine reproductive and respiratory syndrome virus [15], foot-and mouth disease virus [16] and PEDV [17]. The PEDV M protein, the most abundant envelope component, is a triple-spanning membrane glycoprotein with a short amino-terminal domain outside of the virus and a long carboxy-terminal domain inside [18]. The M protein plays an important role in the virus-assembly process, and induces antibodies that neutralize the virus in the presence of its complement [19]. In this study, five primer sets were designed based on the conserved regions of the M gene, and a real-time RT-LAMP method was developed for the detection of PEDV.

Results

Primer set screening for real-time RT-LAMP assay

To select the optimal primer set for the real-time RT-LAMP assay, the primer set screening assay was investigated at 63 °C for 45 min using the LA-320C Loopamp real-time turbidimeter (Teramecs, Japan). As show in Fig. 1a, the first primer set was the best one for the real-time RT-LAMP assay of PEDV among the five primer sets. However, in the end of the RT-LAMP amplification reactions, the real-time turbidity of the fifth primer set was somewhat higher than that of other primer sets; and there were no significant difference in the fluorescence intensities of the products among using these five primer sets (Fig. 1b). As a result, the first primer set was used in subsequent studies.

Optimal temperature for real-time RT-LAMP assay

Using the first primer set, the effect of reaction temperature on the real-time RT-LAMP was investigated. As show in Fig. 2, the best temperature for the real-time RT-LAMP assay of PEDV was at 62 °C. However, in the end of the RT-LAMP amplification reactions, the real-time turbidity of DNAs from the reactions at 60 °C was somewhat higher than that at other reaction temperatures, but which was not determined as the optimal temperature for the real-time RT-LAMP amplifying PEDV M gene.

Sensitivity of real-time RT-LAMP

To evaluate the sensitivity of the real-time RT-LAMP assay, the detection limit of the assay was determined by testing 10-fold serial dilutions of the PEDV (LNsy201401), which has a defined median tissue culture infective dose (TCID50). The real-time RT-LAMP sensitivity assay was performed at 62 °C for 60 min. The kinetic analysis of the real-time turbidity revealed that the real-time RT-LAMP assay was able to detect the PEDV at the level of 10−1 TCID50/mL per tube, which equal to a virus titer of 0.07 PFU (Fig. 3a). The assay sensitivity was also confirmed by visual inspection. As shown in Fig. 3b, the clear fluorescence signals were observed at the concentrations ranging from 104.0 to 10−1 TCID50/mL per tube. There were no differences observed in the sensitivity between the real-time turbidity and visual fluorescence detections that were associated with the real-time LAMP assay.
When the same RNA template was subjected to one-step RT-PCR and real-time RT-PCR, the detection limit of the one-step RT-PCR was 101.0 TCID50/mL per tube, which equal to a virus titer of 7.0 PFU (Fig. 3c); while the detection limit of the real-time RT-PCR was 10−1 TCID50/mL per tube, which equal to a virus titer of 0.07 PFU (Fig. 3d). The results indicated that the sensitivity of the real-time RT-LAMP assay was approximately 100-fold higher than that of one-step RT-PCR, and the real-time RT-LAMP had a similar sensitivity as the real-time RT-PCR.
The results suggested that the real-time turbidity of DNAs from the reactions at concentrations ranging from 104.0 to 10−1 TCID50/mL showed high intensities when the reaction was performed for 45 min (Fig. 3a). Therefore, the optimal reaction condition of the current real-time RT-LAMP for PEDV was 62 °C for 45 min.

Specificity of real-time RT-LAMP

Following the optimization of the conditions of the real-time RT-LAMP, several related porcine viruses (including CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, PPV and PrV) were tested using the real-time RT-LAMP assay to evaluate the primer specificity. PEDV (LNsy201401) was used as the positive control, and the reactions that were performed in the absence of the template were used as negative controls. Only the PEDV was positive, and no LAMP products were detected in the reactions that were performed with RNAs or DNAs harvested from other relevant swine viruses used in this study (Fig. 4a and b). These results indicated that the real-time RT-LAMP assay was specific and can used to specifically amplify PEDV.

Detection of PEDV in clinical samples

To evaluate the ability of the real-time RT-LAMP assay to detect PED viruses from clinical samples, 52 clinical samples were collected from ten pig farms in Liaoning province. All samples were tested by real-time RT-LAMP, one-step RT-PCR and real-time RT-PCR simultaneously. As shown in Table 1, real-time RT-LAMP gave 31 positive cases of 52 samples; one-step RT-PCR gave 27 positive cases and real-time RT-PCR gave 30 positive cases. The positive rates detected by real-time RT-LAMP, one-step RT-PCR and real-time RT-PCR were 59.6 % (31/52), 51.9 % (27/52) and 57.8 % (30/52), respectively. The real-time RT-LAMP had a similar sensitivity with real-time RT-PCR and was somewhat sensitive than one-step RT-PCR in detection of PEDV in clinical samples.
Table 1
Detection of PEDV in clinical samples by real-time RT-LAMP, real-time RT-PCR, and one-step RT-PCR
Types of samples
Total number of samples
PEDV positive samples
RT-PCR
real-time RT-PCR
RT-LAMP
Feces
37
18
20
21
Intestinal contents
15
9
10
10
Total
52
27
30
31

Discussion

PEDV infection has caused continuous and severe economic loss in China. although inactivated vaccines against PEDV are used in some regions in China [5]. At present, the control of PEDV infection primarily depends on the early identification to prevent the further spread of the virus. Therefore, the development of a simple and rapid diagnostic method for PEDV is extremely significant. Even now, diagnostic methods for detecting PEDV all require high-precision instruments. Therefore, they are unsuitable for detecting PEDV in fields and in less well-equipped laboratories.
In this study, a real-time RT-LAMP assay with the PEDV M gene specific primers was successfully developed and optimized. The reaction conditions of the the real-time RT-LAMP were optimized by selecting primers sets and performing the test at different temperatures. Subsequently, its sensitivity was compared with that of one-step RT-PCR. The real-time RT-LAMP assay was able to detect PEDV with a detection limit of 10−1 TCID50/mL, which equals to a virus titer of 0.07 PFU (Fig. 3a). The 104.0 TCID50/mL PEDV had an RNA viral load of 106.846(7.02 × 106) copies. The results showed that the specificity of real-time RT-LAMP for PEDV was approximately 100-fold more sensitive than that of one-step RT-PCR. Moreover, the sensitivity between real-time RT-LAMP and real-time RT-PCR was compared using the same PEDV RNA template. The real-time RT-LAMP had a similar sensitivity with real-time RT-PCR. Four clinical samples were determined to be PEDV negative by one-step RT-PCR, but the real-time RT-LAMP was able to detect them as PEDV positive. The results further suggested that the real-time RT-LAMP assay was slightly more sensitive than one-step RT-PCR for the detection of the PEDV M gene. The developed PEDV M gene real-time RT-LAMP method has a higher sensitivity (10−1 TCID50/mL) than the RT-LAMP method developed for N gene with detection limit 100.75 TCID50/ml, which was determined to be more sensitive than gel-based RT-PCR and ELISA in previous study [17].
The real-time RT-LAMP method developed using this primer set was used to examine PEDV and eight additional porcine pathogens. The viruses such as CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, PPV or PrV may cause co-infection in pigs; PEDV and TGEV belong to the Group I coronaviruses which are closely related [20]. The results showed that this method specifically amplified only the PEDV M gene sequences without any other porcine virus genes demonstrating that the real-time RT-LAMP possesses a high level of specificity for PEDV.
In conclusion, the real-time RT-LAMP method for PEDV established in this study demonstrated a high level of sensitivity and specificity. With the real-time RT-LAMP method, the results can be read visually in the absence of a real-time turbidimeter. The isothermal conditions required for LAMP can be provided with a conventional water bath or heat block, which can be applied in less well-equipped laboratories and fields for rapid detection of PEDV. Thus, compared to the requirements associated with one-step RT-PCR and real-time RT-PCR, the simplicity and affordability of the LAMP assay allow for the most convenient identification of PEDV among the three methods. This method offers a simple, effective, rapid and economical early diagnostic technique for the detection and potential control of PEDV.

Conclusions

We have developed an efficient approach to rapidly detect PEDV. This method holds great promises not only in laboratory detection and discrimination of PEDV but also in large scale field and clinical studies.

Materials and methods

Viruses

PEDV LNsy201401 was isolated from intestinal tissue of piglets; and its M gene was sequenced (TaKaRa, Dalian, China). PEDV was propagated in African green monkey kidney (Vero) cells according to reference with modification [21, 22]. The median tissue culture infective dose per milliliter (TCID50/ml) of PEDV was 105.0. Porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PRV), porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), and pseudorabies virus (PrV) were propagated in susceptible cells. Swine influenza virus (SIV, H1N1) was propagated in the allantoic sac and amniotic cavity of 9-day-old specific pathogen-free (SPF) chicken embryos for 48 to 72 hours at 37 °C [23, 24].

Primers

Based on the M gene sequence of PEDV (JX435310), five sets of primers were designed using the Primer Explorer version 4 software (Eiken Chemical Co., Ltd., Tokyo, Japan; http://​primerexplorer.​jp/​elamp4.​0.​0/​index.​html) and synthesized by Shanghai Sangon Co., Ltd. A set of primers included two outer primers (forward primer M-F3 and reverse primer M-B3), two inner primers (forward inner primer M-FIP and reverse inner primer M-BIP). For comparative purposes, conventional RT-PCR methods based on N and M genes were both constructed. The developed PEDV N gene conventional RT-PCR method sensitivity was higher, in comoparison to the conventional RT-PCR developed for M gene. Therefore, the pair of primers based on N gene (JQ743655, named P1 and P2) designed to amplify a 428-bp fragment was utilized in further study. The primers and probes used for real-time RT-PCR targeting N gene were listed in Table 2 [25]. The specificity of the primers for real-time RT-LAMP was confirmed against random nucleotide sequences using a BLAST search in GenBank databases located in the National Center for Biotechnology Information (NCBI, http://​www.​ncbi.​nlm.​nih.​gov/​BLAST/​).
Table 2
Sequences of the primers and probe used in this study
Application
Primer name
Length(bp)
Primer/probe sequence(5′ to 3′)
Set 1 primers for RT-LAMP
M1-F3
20
GGACACATTCTTGGTGGTCT
M1-B3
20
CCAACACGTCCGTAGACAAT
M1-FIP
42
TGGTGCTCCAAGCACTGGAATGACGCGCTTCTCACTACTTCT
M1-BIP
40
AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA
Set 2 primers for RT-LAMP
M2-F3
18
ACAGACGCGCTTCTCACT
M2-B3
20
CCAACACGTCCGTAGACAAT
M2-FIP
39
AGCGTTACACCAGTTGGTGCTCTTCTGTGATGGGCCGAC
M2-BIP
40
AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA
Set 3 primers for RT-LAMP
M3-F3
19
GCGCAGGACACATTCTTGG
M3-B3
19
TTGGCGACTGTGACGAAAT
M3-FIP
40
GGAATGCAGACCTGTCGGCCTCAATCCTGAAACAGACGCG
M3-BIP
41
TGGAGCACCAACTGGTGTAACGGTACGCCAGTAGCAACCTT
Set 4 primers for RT-LAMP
M4-F3
18
CCGACAGGTCTGCATTCC
M4-B3
20
CCAGTGCCAGATGAAGCATT
M4-FIP
42
CCTGTACGCCAGTAGCAACCTTGAGCACCAACTGGTGTAACG
M4-BIP
41
ATTTCGTCACAGTCGCCAAGGCGACTGAACGACCAACACGT
Set 5 primers for RT-LAMP
M5-F3
20
AGCTTTCAGGTCAATTGGGT
M5-B3
20
GGAGTGTTAGCGTTACACCA
M5-FIP
42
TGCGCCACAACCGAATGCTATTCAGCATCCTTATGGCTTGCA
M5-BIP
41
TCAATCCTGAAACAGACGCGCTTGCTCCAAGCACTGGAATG
RT-PCR
P1
21
TTCCCAGCGTAGTTGAGATTG
P2
21
CGAAGTGGCTCTGGATTTGTT
real-time RT-PCR
PED-NF
24
CGCAAAGACTGAACCCACTAATTT
PED-NR
24
TTGCCTCTGTTGTTACTTGGAGAT
PED-Cy5
24
Cy5-TGTTGCCATTGCCACGACTCCTGC-BHQ3

RNA extraction

The total RNAs were extracted from the culture supernatants of PEDV, CSFV, PRRSV, TGEV, PRV, SIV(H1N1) using the TRIzol reagent (Invitrogen, CA, USA) and the genomic DNAs of PCV2, PPV and PrV were extracted with the DNAzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. The extracted RNA or DNA was resuspended in 20 μL of diethylpyrocarbonate water or sterile water.

Real-time RT-LAMP

The real-time RT-LAMP reaction was performed in a final reaction volume of 25 μL by using a Loopamp RNA amplification kit (Eiken Chemical Co. Ltd., Japan) containing 1 μL RNA template, 40 pmol each of inner primers M-FIP and M-BIP, 5 pmol each of outer primers M-F3 and M-B3, 1.4 mM dNTPs mix, 0.8 M betaine, 0.1 % Tween20, 10 mM (NH4)2SO4, 8 mM MgSO4, 10 mM KCl, 20 mM Tris–HCl (pH 8.8), 16 U Bst DNA polymerase (New England Biolabs, USA), 0.125 U AMV (Invitrogen, CarlsBad, CA, USA) and 1 μL fluorescent detection reagent (FD) (Eiken Chemical Co. Ltd., Japan).
Amplification reactions were performed at 63 °C for 60 min using either a LA-320C Loopamp real-time turbidimeter (Teramecs, Japan) or in a water bath. The mixtures were heated at 80 °C for 10 min to terminate the reactions. The turbidity of the reaction was measured in real time, and the result was indicated by the graph on the monitor of real-time turbidimeter, verifying the start of the amplification. LAMP products were then evaluated with a fluorescent detection reagent (Eiken Chemical Co., Ltd., Japan). A negative control (a sample devoid of template) was included in each reaction.

Optimization of the real-time RT-LAMP assay

To determine the optimal reaction temperature, the real-time RT-LAMP reaction mixtures were incubated at 60, 61, 62, 63, 64, or 65 °C for 1 h. The optimal reaction time was determined by performing the RT-LAMP real-time sensitivity assay at the optimal temperature.

RT-PCR and real-time RT-PCR

RT-PCR was performed with primers (P1 and P2) specific for the PEDV N gene using a PrimeScript™ one-step RT-PCR kit(Takara, Dalian, China). RT-PCR conditions were optimized. RT-PCR parameters included 50 °C for 30 min, 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 40 s, followed by the final extension at 72 °C for 2 min. The RT-PCR products were subjected to electrophoresis on a 1.5 % agarose gel, and the target bands were visualized by staining with ethidium bromide.
The real-time RT-PCR was performed with the primers (PED-NF and PED-NR) and the probe (PED-Cy5) specific for the N gene of PEDV, as described previously [20]. The quantitative one-step RT-PCR kit (Invitrogen Life Technologies™, USA) was used for real-time RT-PCR. In brief, real-time RT-PCR was carried out in a 20 μL reaction containing 0.8 μL of ThermoScript™ plus/ Platinum® Taq Enzyme Mix, 10 μL of 2× ThermoScript Reaction Mix (a final concentration of 3 mM MgCl2), 0.5 μL of both PEDV forward and reverse primer, 0.5 μL of PEDV-Cy5 probe, 2 μL of RNA, and 5.7 μL of water. The reaction was carried out in an ABI7500 (Applied Bio systems) under the following conditions: initial reverse transcription at 58 °C for 30 min, followed by initial denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 30 s, and annealing and extension at 60 °C for 1 min. The intensities of the fluorescent dyes in each reaction were read automatically during PCR cycling and optical data were analyzed with 7500 software v2.0.6.

Detection of PEDV in clinical samples by one-step RT-PCR, real-time RT-PCR, and real-time RT-LAMP

In total, fifty-two clinical samples (including feces and intestinal samples) from piglets with signs of severe watery diarrhea, dehydration were collected from ten pig farms in Liaoning province in China between February 2014 and June 2014. The samples were homogenized with phosphate-buffered saline (PBS, pH 7.4) as a 10 % (w/v) suspension and centrifuged for 10 min at 1700× g at 4 °C. The supernatant were collected and stored at −80 °C until used. The supernatant was subjected to RNA extraction with above-mentioned RNA extraction kit. The resulting RNA was used as a template for one-step RT-PCR, real-time RT-PCR and real-time RT-LAMP according to above-mentioned protocols.

Acknowledgment

This study was supported by the Doctoral Scientific Research Foundation of Liaoning Province (20141167).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

XWY, LS and SMZ conceived the study and wrote the paper. XWY and LS designed the Oligonucleotide primer, XWY and LS carried out this study, XPL and WY analyzed the data, HXY and WY collected the clinical samples, XRW and MHC revised the manuscript critically. All of the authors read and approved the final version of this manuscript.
Literatur
1.
Zurück zum Zitat Song D, Park B. Porcine epidemic diarrhea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44:167–75.PubMedCrossRef Song D, Park B. Porcine epidemic diarrhea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44:167–75.PubMedCrossRef
2.
Zurück zum Zitat Pensaert MB, de Bouck P. A new coronavirus-like particle associated with diarrhea in swine. Arch Virol. 1978;58:243–7.PubMedCrossRef Pensaert MB, de Bouck P. A new coronavirus-like particle associated with diarrhea in swine. Arch Virol. 1978;58:243–7.PubMedCrossRef
3.
Zurück zum Zitat Hofmann M, Wyler R. Quantitation, biological and physicochemical properties of cell culture- adapted porcine epidemic diarrhea coronavirus (PEDV). Vet Microbiol. 1989;20:131–42.PubMedCrossRef Hofmann M, Wyler R. Quantitation, biological and physicochemical properties of cell culture- adapted porcine epidemic diarrhea coronavirus (PEDV). Vet Microbiol. 1989;20:131–42.PubMedCrossRef
4.
Zurück zum Zitat Miller MJ. Summary of current nomenclature, taxonomy, and classification of various microbial agents. Viral taxonomy Clin Infect Dis. 1993;16:612–3.CrossRef Miller MJ. Summary of current nomenclature, taxonomy, and classification of various microbial agents. Viral taxonomy Clin Infect Dis. 1993;16:612–3.CrossRef
5.
Zurück zum Zitat Chen J, Wang C, Shi H, Qiu H, Liu S, Chen X, et al. Molecular epidemiology of porcine epidemic diarrhea virus in China. Arch Virol. 2010;155:1471–6.PubMedCrossRef Chen J, Wang C, Shi H, Qiu H, Liu S, Chen X, et al. Molecular epidemiology of porcine epidemic diarrhea virus in China. Arch Virol. 2010;155:1471–6.PubMedCrossRef
6.
Zurück zum Zitat Chen J, Liu X, Shi D, Shi H, Zhang X, Li C, et al. Detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in China. Viruses. 2013;5:2601–13.PubMedCentralPubMedCrossRef Chen J, Liu X, Shi D, Shi H, Zhang X, Li C, et al. Detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in China. Viruses. 2013;5:2601–13.PubMedCentralPubMedCrossRef
8.
Zurück zum Zitat Huang YW, Dickerman AW, Piñeyro P, Li L, Fang L, Kiehne R, et al. Origin, evolution,and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. MBio. 2013;4:e00737–13.PubMedCentralPubMedCrossRef Huang YW, Dickerman AW, Piñeyro P, Li L, Fang L, Kiehne R, et al. Origin, evolution,and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. MBio. 2013;4:e00737–13.PubMedCentralPubMedCrossRef
9.
Zurück zum Zitat Wang L, Zhang Y, Byrum B. Development and evaluation of a duplex real-time RT-PCR for detection and differentiation of virulent and variant strains of porcine epidemic diarrhea viruses from the United States. J Virol Methods. 2014;207:154–7.PubMedCrossRef Wang L, Zhang Y, Byrum B. Development and evaluation of a duplex real-time RT-PCR for detection and differentiation of virulent and variant strains of porcine epidemic diarrhea viruses from the United States. J Virol Methods. 2014;207:154–7.PubMedCrossRef
10.
Zurück zum Zitat Zhao PD, Bai J, Jiang P, Tang TS, Li Y, Tan C, et al. Development of a multiplex TaqMan probe-based real-time PCR for discrimination of variant and classical porcine epidemic diarrhea virus. J Virol Methods. 2014;206:150–5.PubMedCrossRef Zhao PD, Bai J, Jiang P, Tang TS, Li Y, Tan C, et al. Development of a multiplex TaqMan probe-based real-time PCR for discrimination of variant and classical porcine epidemic diarrhea virus. J Virol Methods. 2014;206:150–5.PubMedCrossRef
11.
Zurück zum Zitat Yoshikawa T, Ihira M, Akimoto S, Usui C, Miyake F, Suga S, et al. Detection of human herpesvirus DNA by loopmediated isothermal amplification. J Clin Microbiol. 2010;42:1348–52.CrossRef Yoshikawa T, Ihira M, Akimoto S, Usui C, Miyake F, Suga S, et al. Detection of human herpesvirus DNA by loopmediated isothermal amplification. J Clin Microbiol. 2010;42:1348–52.CrossRef
12.
Zurück zum Zitat Yuan W, Wang J, Sun M, Zheng Y, Li L, Zhang X, et al. Rapid detection of encephalomyocarditis virus by one-step reverse transcription loop-mediated isothermal amplification method. Virus Res. 2014;189:75–8.PubMedCrossRef Yuan W, Wang J, Sun M, Zheng Y, Li L, Zhang X, et al. Rapid detection of encephalomyocarditis virus by one-step reverse transcription loop-mediated isothermal amplification method. Virus Res. 2014;189:75–8.PubMedCrossRef
13.
Zurück zum Zitat Notomi T, Okayama Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63.PubMedCentralPubMedCrossRef Notomi T, Okayama Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63.PubMedCentralPubMedCrossRef
14.
Zurück zum Zitat Postel A, Letzel T, Frischmann S, Grund C, Beer M, Harder T. Evaluation of two commercial loop-mediated isothermal amplification assays for detection of avian influenza H5 and H7 hemagglutinin genes. J Vet Diagn Invest. 2010;22:61–6.PubMedCrossRef Postel A, Letzel T, Frischmann S, Grund C, Beer M, Harder T. Evaluation of two commercial loop-mediated isothermal amplification assays for detection of avian influenza H5 and H7 hemagglutinin genes. J Vet Diagn Invest. 2010;22:61–6.PubMedCrossRef
15.
Zurück zum Zitat Gou H, Deng J, Pei J, Wang J, Liu W, Zhao M, et al. Rapid and sensitive detection of type II porcine reproductive and respiratory syndrome virus by reverse transcription loop-mediated isothermal amplification combined with a vertical flow visualization strip. J Virol Methods. 2014;209:86–94.PubMedCrossRef Gou H, Deng J, Pei J, Wang J, Liu W, Zhao M, et al. Rapid and sensitive detection of type II porcine reproductive and respiratory syndrome virus by reverse transcription loop-mediated isothermal amplification combined with a vertical flow visualization strip. J Virol Methods. 2014;209:86–94.PubMedCrossRef
16.
Zurück zum Zitat Dukes JP, King DP, Alexandersen S. Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch Virol. 2006;151:1093–106.PubMedCrossRef Dukes JP, King DP, Alexandersen S. Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch Virol. 2006;151:1093–106.PubMedCrossRef
17.
Zurück zum Zitat Ren X, Li P. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of porcine epidemic diarrhea virus. Virus Genes. 2011;42:229–35.PubMedCrossRef Ren X, Li P. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of porcine epidemic diarrhea virus. Virus Genes. 2011;42:229–35.PubMedCrossRef
18.
Zurück zum Zitat Saif LJ. Coronavirus immunogens. Veterinary Microbiol. 1993;37:285–97.CrossRef Saif LJ. Coronavirus immunogens. Veterinary Microbiol. 1993;37:285–97.CrossRef
19.
Zurück zum Zitat De Haan CA1, Kuo L, Masters PS, Vennema H, Rottier PJ. Coronavirus particle assembly: primary structure requirements of the membrane protein. J Virol. 1998;72:6838–50.PubMedCentralPubMed De Haan CA1, Kuo L, Masters PS, Vennema H, Rottier PJ. Coronavirus particle assembly: primary structure requirements of the membrane protein. J Virol. 1998;72:6838–50.PubMedCentralPubMed
20.
Zurück zum Zitat Bridgen A, Duarte M, Tobler K, Laude H, Ackermann M. Sequence determination of the nucleocapsid protein gene of the porcine epidemic diarrhoea virus confirms that this virus is a coronavirus related to human coronavirus 229E and porcine transmissible gastroenteritis virus. J Gen Virol. 1993;74:1795–804.PubMedCrossRef Bridgen A, Duarte M, Tobler K, Laude H, Ackermann M. Sequence determination of the nucleocapsid protein gene of the porcine epidemic diarrhoea virus confirms that this virus is a coronavirus related to human coronavirus 229E and porcine transmissible gastroenteritis virus. J Gen Virol. 1993;74:1795–804.PubMedCrossRef
21.
Zurück zum Zitat Pan Y, Tian X, Li W, Zhou Q, Wang D, Bi Y, et al. Isolation and characterization of a variant porcine epidemic diarrhea virus in China. Virol J. 2012;9:195–204.PubMedCentralPubMedCrossRef Pan Y, Tian X, Li W, Zhou Q, Wang D, Bi Y, et al. Isolation and characterization of a variant porcine epidemic diarrhea virus in China. Virol J. 2012;9:195–204.PubMedCentralPubMedCrossRef
22.
Zurück zum Zitat Hofmann M, Wyler R. Propagation of the virus of porcine epidemic diarrhea in cell culture. J Clin Microbiol. 1988;26:2235–9.PubMedCentralPubMed Hofmann M, Wyler R. Propagation of the virus of porcine epidemic diarrhea in cell culture. J Clin Microbiol. 1988;26:2235–9.PubMedCentralPubMed
23.
Zurück zum Zitat Bowman AS, Nelson SW, Edwards JL, Hofer CC, Nolting JM, Davis IC, et al. Comparative effectiveness of isolation techniques for contemporary Influenza A virus strains circulating in exhibition swine. J Vet Diagn Invest. 2013;25:82–90.PubMedCrossRef Bowman AS, Nelson SW, Edwards JL, Hofer CC, Nolting JM, Davis IC, et al. Comparative effectiveness of isolation techniques for contemporary Influenza A virus strains circulating in exhibition swine. J Vet Diagn Invest. 2013;25:82–90.PubMedCrossRef
24.
Zurück zum Zitat Webster R, Krauss S. WHO Manual on animal influenza diagnosis and surveillance. Geneva, Switzerland: World Health Organization; 2002. Webster R, Krauss S. WHO Manual on animal influenza diagnosis and surveillance. Geneva, Switzerland: World Health Organization; 2002.
25.
Zurück zum Zitat Kim SH, Kim IJ, Pyo HM, Tark DS, Song JY, Hyun BH. Multiplex real-time RT-PCR for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus. J Virol Methods. 2007;146:172–7.PubMedCrossRef Kim SH, Kim IJ, Pyo HM, Tark DS, Song JY, Hyun BH. Multiplex real-time RT-PCR for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus. J Virol Methods. 2007;146:172–7.PubMedCrossRef
Metadaten
Titel
Development of a real-time reverse transcription loop-mediated isothermal amplification method for the rapid detection of porcine epidemic diarrhea virus
verfasst von
Xuewu Yu
Lin Shi
Xiaoping Lv
Wei Yao
Minghui Cao
Hanxun Yu
Xiurong Wang
Shimin Zheng
Publikationsdatum
01.12.2015
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2015
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-015-0297-1

Weitere Artikel der Ausgabe 1/2015

Virology Journal 1/2015 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.