Background
Porcine epidemic diarrhea (PED) is an acute, highly contagious and devastating enteric disease characterized by severe enteritis, vomiting and watery diarrhea in swine [
1]. PED is caused by porcine epidemic diarrhea virus (PEDV), which was firstly identified in Belgium in 1978 [
2]. PEDV is an enveloped, single-strand, and positive-sense RNA virus, which belongs to the Coronaviridae family [
3]. The PEDV genome is ~28 kb in length and comprised of a 5′ untranslated region (UTR), a 3′ UTR, and at least seven open reading frames (ORFs) that encode four structural proteins [spike (S),envelope (E), membrane (M),and nucleocapsid (N)] and three non-structural proteins(replicase 1a and 1b, and ORF3) [
4].
In China, PED was firstly occurred in Shanghai in 1973. So far, PEDV has been observed on most swine breeding farms in most provinces since late 2010 in China [
5].The economic losses caused by PEDV infection have been continuous and serious in China [
6]. Recently, PEDV has suddenly emerged in the United States and rapidly spread across the country, resulting in high mortality in infected newborn piglets, which have posed serious economic losses to the swine industry in the USA [
7,
8]. Rapid diagnosis and timely monitoring of potential PED outbreaks are among the first important steps in the prevention and control of PED. Currently, several conventional methods are available for the detection of PEDV, including virus isolation, fluorescence assay, immune electron microscopy, enzyme-linked immuno- sorbent assay and molecular biological characterization [
9]. However, the isolation and identification of viruses require extended periods of time ranging from days to weeks; so this method does not meet the time requirements needed for the prevention of epidemics. Therefore, these rapid, sensitive and specific molecular biological techniques, including RT-PCR and real-time RT-PCR, have played important roles in the rapid detection of PEDV [
10]. Nevertheless, all of these techniques require sophisticated instrumentation (such as PCR machines and quantitative fluorescence PCR machines), limiting the effectiveness of these procedures in smaller, under-equipped laboratories.
The loop-mediated isothermal amplification (LAMP) technique is a molecular biology method used to amplify specific DNA fragments
in vitro [
11]. This method only requires a water bath or heating block to amplify large amounts of nucleic acids in 30 ~ 60 minutes without additional expensive equipments [
12]. In addition, there is no need to use nucleic acid electrophoresis to assess the result, for the reason that the result can be easily observed in the presence of a fluorescent dye [
13]. These characteristics make the LAMP method a simple, fast, effective and practical DNA amplification method, which has been successfully implemented for the detection of avian influenza A viruses [
14], porcine reproductive and respiratory syndrome virus [
15], foot-and mouth disease virus [
16] and PEDV [
17]. The PEDV M protein, the most abundant envelope component, is a triple-spanning membrane glycoprotein with a short amino-terminal domain outside of the virus and a long carboxy-terminal domain inside [
18]. The M protein plays an important role in the virus-assembly process, and induces antibodies that neutralize the virus in the presence of its complement [
19]. In this study, five primer sets were designed based on the conserved regions of the M gene, and a real-time RT-LAMP method was developed for the detection of PEDV.
Discussion
PEDV infection has caused continuous and severe economic loss in China. although inactivated vaccines against PEDV are used in some regions in China [
5]. At present, the control of PEDV infection primarily depends on the early identification to prevent the further spread of the virus. Therefore, the development of a simple and rapid diagnostic method for PEDV is extremely significant. Even now, diagnostic methods for detecting PEDV all require high-precision instruments. Therefore, they are unsuitable for detecting PEDV in fields and in less well-equipped laboratories.
In this study, a real-time RT-LAMP assay with the PEDV M gene specific primers was successfully developed and optimized. The reaction conditions of the the real-time RT-LAMP were optimized by selecting primers sets and performing the test at different temperatures. Subsequently, its sensitivity was compared with that of one-step RT-PCR. The real-time RT-LAMP assay was able to detect PEDV with a detection limit of 10
−1 TCID
50/mL, which equals to a virus titer of 0.07 PFU (Fig.
3a). The 10
4.0 TCID
50/mL PEDV had an RNA viral load of 10
6.846(7.02 × 10
6) copies. The results showed that the specificity of real-time RT-LAMP for PEDV was approximately 100-fold more sensitive than that of one-step RT-PCR. Moreover, the sensitivity between real-time RT-LAMP and real-time RT-PCR was compared using the same PEDV RNA template. The real-time RT-LAMP had a similar sensitivity with real-time RT-PCR. Four clinical samples were determined to be PEDV negative by one-step RT-PCR, but the real-time RT-LAMP was able to detect them as PEDV positive. The results further suggested that the real-time RT-LAMP assay was slightly more sensitive than one-step RT-PCR for the detection of the PEDV M gene. The developed PEDV M gene real-time RT-LAMP method has a higher sensitivity (10
−1 TCID
50/mL) than the RT-LAMP method developed for N gene with detection limit 10
0.75 TCID50/ml, which was determined to be more sensitive than gel-based RT-PCR and ELISA in previous study [
17].
The real-time RT-LAMP method developed using this primer set was used to examine PEDV and eight additional porcine pathogens. The viruses such as CSFV, PRRSV, TGEV, PRV, SIV(H1N1), PCV2, PPV or PrV may cause co-infection in pigs; PEDV and TGEV belong to the Group I coronaviruses which are closely related [
20]. The results showed that this method specifically amplified only the PEDV M gene sequences without any other porcine virus genes demonstrating that the real-time RT-LAMP possesses a high level of specificity for PEDV.
In conclusion, the real-time RT-LAMP method for PEDV established in this study demonstrated a high level of sensitivity and specificity. With the real-time RT-LAMP method, the results can be read visually in the absence of a real-time turbidimeter. The isothermal conditions required for LAMP can be provided with a conventional water bath or heat block, which can be applied in less well-equipped laboratories and fields for rapid detection of PEDV. Thus, compared to the requirements associated with one-step RT-PCR and real-time RT-PCR, the simplicity and affordability of the LAMP assay allow for the most convenient identification of PEDV among the three methods. This method offers a simple, effective, rapid and economical early diagnostic technique for the detection and potential control of PEDV.
Materials and methods
Viruses
PEDV LNsy201401 was isolated from intestinal tissue of piglets; and its M gene was sequenced (TaKaRa, Dalian, China). PEDV was propagated in African green monkey kidney (Vero) cells according to reference with modification [
21,
22]. The median tissue culture infective dose per milliliter (TCID
50/ml) of PEDV was 10
5.0. Porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PRV), porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), and pseudorabies virus (PrV) were propagated in susceptible cells. Swine influenza virus (SIV, H1N1) was propagated in the allantoic sac and amniotic cavity of 9-day-old specific pathogen-free (SPF) chicken embryos for 48 to 72 hours at 37 °C [
23,
24].
Primers
Based on the M gene sequence of PEDV (JX435310), five sets of primers were designed using the Primer Explorer version 4 software (Eiken Chemical Co., Ltd., Tokyo, Japan;
http://primerexplorer.jp/elamp4.0.0/index.html) and synthesized by Shanghai Sangon Co., Ltd. A set of primers included two outer primers (forward primer M-F3 and reverse primer M-B3), two inner primers (forward inner primer M-FIP and reverse inner primer M-BIP). For comparative purposes, conventional RT-PCR methods based on N and M genes were both constructed. The developed PEDV N gene conventional RT-PCR method sensitivity was higher, in comoparison to the conventional RT-PCR developed for M gene. Therefore, the pair of primers based on N gene (JQ743655, named P1 and P2) designed to amplify a 428-bp fragment was utilized in further study. The primers and probes used for real-time RT-PCR targeting N gene were listed in Table
2 [
25]. The specificity of the primers for real-time RT-LAMP was confirmed against random nucleotide sequences using a BLAST search in GenBank databases located in the National Center for Biotechnology Information (NCBI,
http://www.ncbi.nlm.nih.gov/BLAST/).
Table 2
Sequences of the primers and probe used in this study
Set 1 primers for RT-LAMP | M1-F3 | 20 | GGACACATTCTTGGTGGTCT |
M1-B3 | 20 | CCAACACGTCCGTAGACAAT |
M1-FIP | 42 | TGGTGCTCCAAGCACTGGAATGACGCGCTTCTCACTACTTCT |
M1-BIP | 40 | AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA |
Set 2 primers for RT-LAMP | M2-F3 | 18 | ACAGACGCGCTTCTCACT |
M2-B3 | 20 | CCAACACGTCCGTAGACAAT |
M2-FIP | 39 | AGCGTTACACCAGTTGGTGCTCTTCTGTGATGGGCCGAC |
M2-BIP | 40 | AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA |
Set 3 primers for RT-LAMP | M3-F3 | 19 | GCGCAGGACACATTCTTGG |
M3-B3 | 19 | TTGGCGACTGTGACGAAAT |
M3-FIP | 40 | GGAATGCAGACCTGTCGGCCTCAATCCTGAAACAGACGCG |
M3-BIP | 41 | TGGAGCACCAACTGGTGTAACGGTACGCCAGTAGCAACCTT |
Set 4 primers for RT-LAMP | M4-F3 | 18 | CCGACAGGTCTGCATTCC |
M4-B3 | 20 | CCAGTGCCAGATGAAGCATT |
M4-FIP | 42 | CCTGTACGCCAGTAGCAACCTTGAGCACCAACTGGTGTAACG |
M4-BIP | 41 | ATTTCGTCACAGTCGCCAAGGCGACTGAACGACCAACACGT |
Set 5 primers for RT-LAMP | M5-F3 | 20 | AGCTTTCAGGTCAATTGGGT |
M5-B3 | 20 | GGAGTGTTAGCGTTACACCA |
M5-FIP | 42 | TGCGCCACAACCGAATGCTATTCAGCATCCTTATGGCTTGCA |
M5-BIP | 41 | TCAATCCTGAAACAGACGCGCTTGCTCCAAGCACTGGAATG |
RT-PCR | P1 | 21 | TTCCCAGCGTAGTTGAGATTG |
P2 | 21 | CGAAGTGGCTCTGGATTTGTT |
real-time RT-PCR | PED-NF | 24 | CGCAAAGACTGAACCCACTAATTT |
PED-NR | 24 | TTGCCTCTGTTGTTACTTGGAGAT |
PED-Cy5 | 24 | Cy5-TGTTGCCATTGCCACGACTCCTGC-BHQ3 |
The total RNAs were extracted from the culture supernatants of PEDV, CSFV, PRRSV, TGEV, PRV, SIV(H1N1) using the TRIzol reagent (Invitrogen, CA, USA) and the genomic DNAs of PCV2, PPV and PrV were extracted with the DNAzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. The extracted RNA or DNA was resuspended in 20 μL of diethylpyrocarbonate water or sterile water.
Real-time RT-LAMP
The real-time RT-LAMP reaction was performed in a final reaction volume of 25 μL by using a Loopamp RNA amplification kit (Eiken Chemical Co. Ltd., Japan) containing 1 μL RNA template, 40 pmol each of inner primers M-FIP and M-BIP, 5 pmol each of outer primers M-F3 and M-B3, 1.4 mM dNTPs mix, 0.8 M betaine, 0.1 % Tween20, 10 mM (NH4)2SO4, 8 mM MgSO4, 10 mM KCl, 20 mM Tris–HCl (pH 8.8), 16 U Bst DNA polymerase (New England Biolabs, USA), 0.125 U AMV (Invitrogen, CarlsBad, CA, USA) and 1 μL fluorescent detection reagent (FD) (Eiken Chemical Co. Ltd., Japan).
Amplification reactions were performed at 63 °C for 60 min using either a LA-320C Loopamp real-time turbidimeter (Teramecs, Japan) or in a water bath. The mixtures were heated at 80 °C for 10 min to terminate the reactions. The turbidity of the reaction was measured in real time, and the result was indicated by the graph on the monitor of real-time turbidimeter, verifying the start of the amplification. LAMP products were then evaluated with a fluorescent detection reagent (Eiken Chemical Co., Ltd., Japan). A negative control (a sample devoid of template) was included in each reaction.
Optimization of the real-time RT-LAMP assay
To determine the optimal reaction temperature, the real-time RT-LAMP reaction mixtures were incubated at 60, 61, 62, 63, 64, or 65 °C for 1 h. The optimal reaction time was determined by performing the RT-LAMP real-time sensitivity assay at the optimal temperature.
RT-PCR and real-time RT-PCR
RT-PCR was performed with primers (P1 and P2) specific for the PEDV N gene using a PrimeScript™ one-step RT-PCR kit(Takara, Dalian, China). RT-PCR conditions were optimized. RT-PCR parameters included 50 °C for 30 min, 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 40 s, followed by the final extension at 72 °C for 2 min. The RT-PCR products were subjected to electrophoresis on a 1.5 % agarose gel, and the target bands were visualized by staining with ethidium bromide.
The real-time RT-PCR was performed with the primers (PED-NF and PED-NR) and the probe (PED-Cy5) specific for the N gene of PEDV, as described previously [
20]. The quantitative one-step RT-PCR kit (Invitrogen Life Technologies™, USA) was used for real-time RT-PCR. In brief, real-time RT-PCR was carried out in a 20 μL reaction containing 0.8 μL of ThermoScript™ plus/ Platinum® Taq Enzyme Mix, 10 μL of 2× ThermoScript Reaction Mix (a final concentration of 3 mM MgCl
2), 0.5 μL of both PEDV forward and reverse primer, 0.5 μL of PEDV-Cy5 probe, 2 μL of RNA, and 5.7 μL of water. The reaction was carried out in an ABI7500 (Applied Bio systems) under the following conditions: initial reverse transcription at 58 °C for 30 min, followed by initial denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 30 s, and annealing and extension at 60 °C for 1 min. The intensities of the fluorescent dyes in each reaction were read automatically during PCR cycling and optical data were analyzed with 7500 software v2.0.6.
Detection of PEDV in clinical samples by one-step RT-PCR, real-time RT-PCR, and real-time RT-LAMP
In total, fifty-two clinical samples (including feces and intestinal samples) from piglets with signs of severe watery diarrhea, dehydration were collected from ten pig farms in Liaoning province in China between February 2014 and June 2014. The samples were homogenized with phosphate-buffered saline (PBS, pH 7.4) as a 10 % (w/v) suspension and centrifuged for 10 min at 1700× g at 4 °C. The supernatant were collected and stored at −80 °C until used. The supernatant was subjected to RNA extraction with above-mentioned RNA extraction kit. The resulting RNA was used as a template for one-step RT-PCR, real-time RT-PCR and real-time RT-LAMP according to above-mentioned protocols.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
XWY, LS and SMZ conceived the study and wrote the paper. XWY and LS designed the Oligonucleotide primer, XWY and LS carried out this study, XPL and WY analyzed the data, HXY and WY collected the clinical samples, XRW and MHC revised the manuscript critically. All of the authors read and approved the final version of this manuscript.