Background
Leishmaniasis is caused by the protozoan
Leishmania parasites, which are transmitted by the bite of infected sandflies. Depending on the infecting species,
Leishmania infection can cause cutaneous leishmaniasis (CL), mucocutaneous leishmaniasis (MCL) or visceral leishmaniasis (VL). VL, also known as kala-azar, is the most serious form of the disease and is frequently fatal if left untreated [
1,
2]. VL is highly endemic in the Indian subcontinent, East Africa and parts of South America. An estimated 50,000 to 90,000 new cases of VL occur worldwide each year (
http://www.who.int/news-room/fact-sheets/detail/leishmaniasis). Due to the AIDS epidemic, coinfection with human immunodeficiency virus (HIV) has increased VL cases in some parts of the world [
3]. In addition,
Leishmania infantum infection causes visceral disease in domestic dogs, which are the major vertebrate reservoirs for transmission to humans in Latin America and Southern Europe [
4,
5].
VL is characterized by irregular bouts of fever, weight loss, enlargement of the spleen and liver, and anemia. However, these clinical features are not specific and can be mistaken for other common illnesses associated with fever including malaria. Moreover, infection with
Leishmania does not always lead to clinical illness, asymptomatic infections are common, and it is unknown whether these individuals represent a source of transmission [
6,
7]. Although there are some drawbacks associated with the current treatments, VL is a life-threatening disease that is curable with proper treatment [
7]. Therefore, rapid and accurate diagnosis of visceral
Leishmania infection is important for patients to receive prompt treatment, determine cure or an indication of relapse, and thus prevent further transmission of this disease [
7].
Currently, diagnosis of VL is made by combining clinical symptoms with parasitological or serological tests. Assays based on detection of parasite-specific antibodies (such as the rK39 test) have proven to be efficient for VL diagnosis. The rK39 immunochromatographic test (ICT) is easy to perform, rapid and inexpensive. However, because the rK39 ICT detects antibodies, it cannot distinguish relapse cases from past infection, or active disease from asymptomatic infection and cannot be used as a test of cure [
8‐
10]. The rK39 ICT is less effective in VL patients co-infected with HIV and is more sensitive for VL diagnosis in Asia than in Africa [
8‐
10], though the new rK28 ICT has improved the detecting sensitivity of VL cases in Africa [
11].
Nucleic acid-based diagnostics such as polymerase chain reaction (PCR) are the most sensitive method to detect the presence of parasites in clinical samples, but they are expensive and restricted to referral hospitals and research centers, though this situation could be improved with development of loop-mediated isothermal amplification (LAMP) assays where there has been recent progress [
12‐
17]. Definitive diagnosis of VL still requires microscopic identification of the parasite in internal organs such as in spleen, liver or bone marrow aspirates, an invasive and dangerous process with varied sensitivity (53–99%) [
8‐
10]. Therefore, development of an assay that can sensitively detect
Leishmania antigen from blood or urine samples would be helpful for rapid and definitive VL diagnosis, test of cure and relapse [
18‐
24].
Based on the hypothesis that abundant
Leishmania proteins could be easier to detect than low abundance proteins, we raised rabbit polyclonal antibodies against eight
Leishmania proteins previously reported to be highly abundant in
Leishmania [
25‐
27]
. With these rabbit antisera, we developed a direct enzyme-linked immunosorbent assay (ELISA), and a sandwich ELISA with purified antibodies labeled with biotin for detection of the
Leishmania antigens. The sandwich ELISA against the
Leishmania 40S ribosomal protein S12 provided the highest sensitivity and specificity. Importantly, the sandwich ELISA could detect
Leishmania 40S ribosomal protein S12 antigen in PBMC lysates prepared from VL patients and post-kala-azar dermal leishmaniasis (PKDL) patients. These results suggest that the 40S ribosomal protein S12 sandwich ELISA could represent a useful test for confirming VL diagnosis and for monitoring treatment progress and relapse.
Methods
Selection of abundant Leishmania proteins
The ten soluble and abundant
Leishmania proteins we selected (Table
1) were based on previous
Leishmania proteomic analysis, these proteins were present as large and dense spots in two-dimension gel electrophoresis and were identified using mass spectrometry [
25,
26]. The abundance of these selected proteins was also confirmed by our own more recent proteomic study on
L. donovani [
27]. Most of these abundant
Leishmania proteins except aldolase (LmjF.36.1260) have low homology to human proteins.
Table 1
A list of abundant Leishmania proteins selected for production of recombinant proteins in E. coli
LmjF.05.0350 | 535a | Trypanothione reductase | 53.1 |
LmjF.05.0450 | 545 | Kinetochore related protein | 22.3 |
LmjF.05.0830 | 583 | Methylthioadenosine phosphorylase | 33.4 |
LmjF.13.0570 | 1357 | 40S ribosomal protein S12 | 15.6 |
LmjF.24.1500 | 2415 | Translationally controlled tumor protein | 19.4 |
LmjF.32.0460 | 3246a | Prostaglandin F synthase | 31.8 |
LmjF.35.0820 | 3582 | Aspartate aminotransferase | 45.9 |
LmjF.24.2110 | 24,211 | 3-Hydroxy-3-methyl glutaryl-CoA synthase | 55.2 |
LmjF.36.1260 | 36,126 | Fructose-1,6-bisphosphate aldolase | 40.8 |
LmjF.36.6760 | 36,676 | ATP synthase delta (OSCP) subunit | 28.9 |
Construction of bacterial expression vectors
For convenience of cloning, we have replaced the sequence (
Nde I to
Not I) containing the S. Tag and the multiple cloning sites in pET29 bacterial expression vector (Novagen) with following sequence containing a His-Tag sequence and new multiple cloning sites (
Hind III,
Kpn I,
EcoR I,
BamH I,
Bgl II and
Not I): CATATGGCACATCACCACCACCATCACAAGCTTGGTACCGAATTCGGATCCAGATCT GTAGCGGCCGC. We re-named the modified pET29 vector as pET29w. Accordingly, the primers with corresponding restriction enzyme site added at the 5′ end were designed and used to amplify the gene sequences of these abundant
Leishmania proteins by PCR using
L. donovani genomic DNA as the template. The
Leishmania gene PCR products with expected sizes were digested with restriction enzymes and cloned into the corresponding sites of pET29w bacterial expression vector. A list of these primer pairs is shown in Table
2.
Table 2
A list of primers used to amplify genes encoding abundant Leishmania proteins
LmjF.05.0350 | 5’ cccaagcttaccATGTCCCGCGCGTACGACCTCG | 1476 |
5’ ggaagatctgtGAGGTTGCTGCTCAGCTTTTCG |
LmjF.05.0450 | 5’ cccaagcttaccATGGCTGACGAAGGCGCTATAGA | 591 |
5’ ggaagatctgtCTTCTTCGTCGTGGCCTTCACAG |
LmjF.05.0830 | 5’ cccaagcttaccATGTACGGCAACCCGCACAAGGA | 921 |
5’ ggaagatctgtCGGGGCGAACTGCGGGTACTTGC |
LmjF.13.0570 | 5’ cggggtaccATGGCTGAGGAAACCGTCCGTGTTG | 426 |
5’ cgcggatccgtGTGCAGCTGAGACAGCAGGTAGTCC |
LmjF.24.1500 | 5’ cggggtaccATGAAGATCTTCAAGGACGTGCTG | 513 |
5’ cgcggatccgtGACGCGCTCGCCCTTCAAGCCATC |
LmjF.32.0460 | 5’ cccaagcttaccATGGCTGTTAAGTGCACGCACG | 840 |
5’ ggaagatctgtCTTGCGCTCGGTTGGGAAGAAGG |
LmjF.35.0820 | 5’ cccaagcttaccATGTCCACGCAGGCGGCCATG | 1239 |
5’ ggaagatctgtCTCACGATTCACATTGCGCACA |
LmjF.24.2110 | 5’ cggggtaccATGATGCGCAACACCTGTCTTAG | 1506 |
5’ cgcggatccgtCTGGATGTAGCGGTAGTACTCA |
LmjF.36.1260 | 5’ cccaagcttaccATGTCGCGTGTGACGATCTTTCAG | 1116 |
5’ cgcggatccgtATAGATGTTGCCTTTGACGTACAG |
LmjF.36.6760 | 5’ cggggtaccATGTTCCGCCGTCTCTCCGTG | 777 |
5’ cgcggatccgtAACACCGCTCTTGAGCTCCTCG |
Expression and purification of recombinant Leishmania proteins in E. coli BL21 or Rosetta cells
We isolated the recombinant Leishmania proteins from bacteria by following the manufacturer’s protocol (Novagen pET system manual). Some of these recombinant proteins formed Inclusion Bodies after Isopropyl β-D-1-thiogalactopyranoside (IPTG) induction of the culture and were first urea-solubilized before using Ni-NTA Agarose resin (Qiagen) to purify. Depending on the protein, we obtained 2–10 mg of each recombinant protein from 1 L shake cultures for polyclonal antibody production.
Production of rabbit polyclonal antibodies
The rabbit polyclonal antibodies (antisera) against these abundant
Leishmania proteins were produced by Syd Labs, Inc. (Natick, MA, USA). The detailed procedures can be found in the website of Syd Labs, Inc. (
https://www.sydlabs.com). One or two rabbits were immunized for each
Leishmania recombinant protein with Freund’s adjuvant (SIGMA, USA). About 0.5 ml of pre-immune rabbit serum and 40 to 80 ml of antiserum with ELISA titers > 1:20,000 were obtained within 4 months for each antigen. The antisera were kept at 4 °C for current use and in a − 20 °C freezer for longer storage.
Leishmania strains and macrophage infection
The
L. donovani 1S/Cl2D and
Leishmania major Friedlin V9 strains used in this study were routinely cultured at 27 °C in M199 medium (Cat # M0393, SIGMA) supplemented with 10% heat-inactivated fetal bovine serum, 40 mM HEPES (pH 7.4), 0.1 mM adenine, 5 mg l
− 1hemin, 1 mg l
− 1 biotin, 1 mg l
− 1 biopterine, 50 U ml
− 1 penicillin and 50 μg ml
− 1 streptomycin. Cultures were passaged to fresh medium in a 20-fold dilution once a week. Infection of cultured macrophages was performed as described [
28].
Western blot analysis of abundant Leishmania proteins
Whole cell lysates were prepared in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer from
L. major promastigotes,
L. donovani promastigotes,
L. donovani axenic amastigotes, and human H1299 epithelial cells. After boiling in water for 3 min and centrifuging at 15,000 RPM (Revolutions per minute) for 10 min, the cell lysate supernatants were separated in SDS-PAGE gel and subjected to Western blot analysis [
29]. Rabbit antiserum was diluted 1:1000 for Western blot analysis to detect target proteins in
Leishmania cell lysates (4 × 10
7 Leishmania cells per lane).
Isolation of peripheral blood mononuclear cells (PBMCs) from clinical samples
The diagnosis for most of the VL patients at the Rejandra Memorial Research Institute of Medical Sciences (RMRIMS), Patna, Bihar was confirmed by spleen or bone marrow biopsies. PKDL cases at RMRIMS were confirmed by skin smear microscopy for LD bodies (Amastigotes). The healthy controls were all rK39-negative from the out-patient department for regular check-up. Total 14 VL patients, 5 likely VL cases which had typical VL symptoms and were rK39-positive but biopsy-negative, 3 PKDL patients and 12 healthy controls were recruited. The 14 VL cases included 10 males with age range from 3 to 52 years old and 4 females with age range 18 to 35; the 5 likely VL cases were 3 males with age range 14 to 45 and 2 females with age 40 and 45; the 3 PKDL patients included 1 male aged 30, and 2 females aged 18 and 40; the 12 healthy controls were 7 males and 5 females with age range from 24 to 34. Blood (5 ml per patient) drawn from patients before treatment were utilized for preparation of PBMCs with Ficoll-density separation [
30]. PBMC lysates were prepared by lysing cells in 1% NP-40 in PBS with proteinase inhibitors (cOmplete Cocktail Tablets, SIGMA) at the concentration of 1 × 10
7 cells/ml. After incubation on ice for 30 min with occasional mixing, the lysates were centrifuged at 4 °C at high speed (15,000 RPM) for 15 min, and the supernatant was kept and stored at -20 °C until use.
Direct ELISA
L. donovani promastigote lysate was prepared by lysing cells in 1% NP-40 in PBS (Phosphate-buffered saline) with proteinase inhibitors at the concentration of 4 × 108 cells/ml. After centrifugation at 4 °C at high speed for 15 min, the supernatant was stored at -20 °C until use.
The ELISA plate (Immulon cat#: 62402–972 from VWR) was coated with 50 μl (per well) cell lysate diluted in carbonate/bicarbonate buffer (1.89 g NaHCO3 and 0.954 g Na2CO3 in 500 ml H2O, pH 9.6) and incubated at 4 °C in a moist chamber overnight. The plate was washed 2 times with 200 μl wash buffer (0.05% Tween 20 in PBS) then blocked with 200 μl/well blocking buffer (5% nonfat dry milk in 0.1% PBS/T) for 1 h at 37 °C (covered with an adhesive plastic). The plate was washed 2 times with wash buffer, and 100 μl rabbit antiserum in 1:2000 dilution in blocking buffer was added to each well for 1.5 h at 37 °C or overnight at 4 °C. The plate was washed 3 times with wash buffer and 100 μl of horseradish peroxidase (HRP)-linked anti-rabbit antibody (ECL NA934V 1:5000 in blocking buffer) was added into each well for 1 h at 37 °C. The plate was washed 4 times with wash buffer followed by adding 50 μl/well of the HRP substrate TMB (eBioscience). After 10 min incubation at room temperature, the reactions were stopped with 25 μl of 1 N H2SO4. The color change in wells was read at 450 nm absorbance.
Purification and labelling of rabbit anti-Leishmania protein antibodies
To set up the sandwich ELISA, Immunoglobulin G (IgG) was first purified from the rabbit antisera with the Melon Gel IgG Purification System (Cat # 45206, Thermo Fisher Scientific), which purifies antibodies from serum by removing non-relevant proteins. After dilution with the Melon gel purification buffer (1:10) and passing through the Melon gel purification column, 100 μl of serum generated 1000 μl of purified IgG. One-half of the purified IgGs were biotin labeled using the Thermo Scientific EZ-Link Sulfo-NHS-SS-Biotin (sulfosuccinimidyl-2-[biotinamido]ethyl-1,3-dithiopropionate, Cat # 21331). 7 μl Sulfo-NHS-SS-Biotin (6 mg/ml, freshly prepared) was added into 500 μl purified rabbit IgG and labeled at 4o C overnight. Free Sulfo-NHS-SS-Biotin was removed from the labeling reaction by dialysis in PBS.
Sandwich ELISA
A 96-well ELISA plate was coated with 100 μl/well of capture antibody in carbonate/bicarbonate coating buffer (i.e. 0.5 μl capture ab + 100 μl coating buffer; 1:200 dilution). The plate was sealed and incubated overnight at 4 °C in a moist chamber. Wells were aspirated and washed 5 times with 250 μl/well wash buffer (0.05%Tween 20 in PBS) allowing time for soaking (~ 1 min) during each wash step. Absorbent paper was used to remove any residual buffer. Wells were blocked with 200 μl/well of 2% bovine serum albumin (BSA) in PBS, incubated at 37 °C for 2 h, and aspirated and washed 2 times. A 2-fold serial dilution of the standards (L. donovani promastigote lysate alone or mixed with the healthy control PBMC lysate) was performed with assay buffer (1% BSA in wash buffer) with a final volume of 100 μl per well to generate the standard curve. PBMC lysates of clinical samples (100-250 μl) prepared as above were added into each well. The plate was covered, incubated overnight at 4 °C, aspirated free of buffer, and washed 5 times. Detection antibody (100 μl/well) diluted in assay buffer (i.e., 0.25 μl Detection ab-Biotin + 100 μl Assay buffer; 1:400 dilution) was added per well, and the plate was sealed and incubated at 37 °C for 2 h. Wells were aspirated and washed 5 times, and 100 μl/well of Avidin-HRP (eBioscience) diluted in assay buffer (1:250 dilution) was added and incubated at room temperature for 30 min to 1 h. Wells were aspirated and washed 10 to 14 times with the wells soaking for 2 min for each wash. Substrate solution (TMB; 100 μl/well) was added, and plates incubated at room temperature for 15 min. The reactions were stopped by adding 50 μl/well of Stop Solution (2 N H2SO4), and absorbance was read at 450 nm.
Generation of monoclonal antibodies against peptides of L. donovani 40S ribosomal protein S12
Monoclonal antibodies against L. donovani 40S ribosomal protein S12 peptides were generated by Abmart (Shanghai) Co. Ltd. However, none of these anti-peptide monoclonal antibodies could recognize the native L. donovani 40S ribosomal protein S12 (See discussion). The twelve peptide sequences used to generate the monoclonal antibodies are as follows: NVVVDVAPES,EETVRVEVPA,EVPAVEENVV,VAGEVTKTLK,QKALEANGLV,FGERTKALDY,ESLEDAVRIV,NVEEREKLAQ,TALAKQGNID,VRGLSEVART,QWAGLVRRDV,EDEEYKKLVT.
Discussion
An ELISA was developed to detect Leishmania proteins based on the assumption that abundant proteins could be more easily detected than proteins of low abundance in clinical samples. Antibodies raised against the 40S ribosomal protein S12 antigen (1357) outperformed all the other antisera tested and could detect the presence of L. donovani in PBMCs from VL patients. Although all the generated rabbit antisera could bind specifically to the corresponding Leishmania proteins in denatured form by Western blot analysis, antiserum to the 40S ribosomal S12 antigen was far superior to the other generated antibodies at recognizing their corresponding native Leishmania proteins in the ELISA. One explanation for this is that these E. coli expressed recombinant proteins were in a different, possibly denatured form that differs from that of the native Leishmania proteins. Moreover, we have recently found that antisera raised against some additional abundant Leishmania proteins (LdBPK_140910.1; LdBPK_250740.1; LdBPK_363750.1; LdBPK_321910.1 and LdBPK_180690.1) also failed to recognize the native Leishmania proteins despite working in Western blot analysis (data not shown). Therefore, future attempts should consider different methods for production and purification of recombinant proteins for generation of antibodies. Different adjuvants could also be considered to produce antibodies that recognize the native Leishmania proteins. Another relevant observation from this study is that we synthesized twelve peptide sequences (ten amino acid each) of the 40S ribosomal S12 antigen to generate anti-peptide monoclonal antibodies. However, possibly due to the native protein folding which may hide these epitopes, none of these anti-peptide monoclonal antibodies recognized the native 40S ribosomal protein S12 despite binding to the cognate peptides (See these peptides sequences in Methods).
The 40S ribosomal protein S12 antigen (1357) antiserum could be used to develop a sandwich ELISA that could detect as low as 1 pg purified recombinant 40S ribosomal protein S12 and approximately 60 Leishmania donovani parasites. Notably, this ELISA was able to detect the Leishmania 40S ribosomal protein S12 antigen in 68% PBMC samples of VL and PKDL patients including the likely VL cases that were LD-body negative in splenic or bone marrow biopsies, but rK39 positive with clinical symptoms. This ELISA also provided a quantitative estimation of the parasitemia for these positive cases. This suggests that this ELISA could be further developed to detect parasitemia for test of cure and relapse and could also be helpful to confirm VL diagnosis of equivocal cases.
While this project was in progress, three
Leishmania antigen detection tests were reported including a triple
Leishmania protein detection ELISA (DetectoGen Inc., USA), a
Leishmania antigen ELISA (Kalon Biologicals Ltd., UK) and a
Leishmania Antigen Detect™ ELISA (Infectious Disease Research Institute, USA) [
20‐
23]. All these tests detect
Leishmania antigens with slight differences in sensitivity from urine samples of VL patients, and all could potentially be used to monitor treatment progress. The
Leishmania antigen ELISA and
Leishmania Antigen Detect™ ELISA were developed using polyclonal antibodies raised against the whole
Leishmania donovani cell lysate [
23]. The DetectoGen ELISA was developed by raising polyclonal antibodies against three
Leishmania proteins identified in VL patients’ urine samples [
20]. Interestingly, like the 40S ribosomal protein S12 (16 kDa), all these three target proteins used in the DetectoGen Inc., capture ELISA (iron superoxide dismutase, 22 kDa; tryparedoxin, 17 kDa; and nuclear transport factor 2, 14 kDa) are also small and abundant
Leishmania proteins. The 40S ribosomal protein S12 ELISA being reported in our study has similar sensitivity to the triple protein ELISA (DetectoGen), and is approximately two times more sensitive than the whole cell lysate (WCL) antigen ELISAs. The DetectoGen ELISA has a detection limit ranging from 4 to 100 pg/ml of the target antigens [
20‐
22]. The Detect™ ELISA detection limit is 4 ng/ml, equivalent to about 100
Leishmania parasites per well [
23]. We have yet to test whether the 40S ribosomal protein S12 antigen is present in VL patient urine but, if it is, it would be worth determining whether the 40S ribosomal protein S12-IgG complements those in the DetectoGen test, which is also based on anti-recombinant protein antibodies.
Compared with capture ELISAs based on individual antigens, the advantages of WCL capture ELISAs are (1) the ease of preparing the WCL antigens and (2) the greater range of Leishmania proteins (native or denatured) present in various clinical samples that could be recognized by the polyclonal antibodies, potentially resulting in a more sensitive test. In fact, the WCL ELISA may detect predominantly abundant Leishmania proteins that are also present in the urine samples. Based on its genome sequence, Leishmania has approximately 8000 potential proteins, and many of these proteins could significantly increase the likelihood of cross reactions to human proteins, which would increase the background signal. Therefore, it would be useful to compare all the available Leishmania antigen detection ELISAs side-by-side with various clinical samples including urine, blood and PBMCs. With this information, it may be possible to further improve the sensitivity and specificity for Leishmania antigen detection.