Development of selective medium for IMP-type carbapenemase-producing Enterobacteriaceae in stool specimens

Four selective culture media (vide infra) were examined with bacterial isolates as well as clinical faecal specimens. Fifteen CPE isolates of Enterobacteriaceae and five non-CPE isolates were used (Table 1). The MICs of meropenem and imipenem for each isolate were determined using Etest strips (bioMérieux Clinical Diagnostics, Marcy l’Etoile, France), and the genotypic characteristics of each isolate with respect to carbapenemase and extended-spectrum beta-lactamase (ESBL) genes were determined via PCR as previously described [13].

Faecal samples were collected from 30 hospitals in northern Osaka in December 2015 through the regional surveillance project performed by Osaka University, four regional public health centres, and Osaka Prefectural Institute of Public Health. Ethical approval was obtained from the Ethical Review Boards of each institution.

Bacteria in the stool of colonised patients are typically present at low abundances [3, 4], although the inoculum size used to determine CLSI susceptibility breakpoints and MICs ranged from 10⁴ cells per spot (agar dilution) to 5 × 10⁵ cells per millilitre (broth microdilution) [14]. Therefore, to simulate experiments using stool samples, we inoculated each plate with approximately 10² CFU and compared the CFU counts in selective agar media as previously described [8]. Overnight cultures of each isolate in brain-heart infusion broth (BD Diagnostic Systems, Detroit, MI, USA) were serially diluted and inoculated in triplicate plates. CFU counts were compared among Mueller-Hinton agar (MHA) (BD Diagnostic Systems) as well as two commercial and two in-house prepared agar media: (1) chromID CARBA (bioMérieux, Paris, France), (2) CHROMagar KPC (CHROMagar Microbiology, Paris, France), (3) MC-ECC medium (CHROMagar ECC [CHROMagar Microbiology] supplemented with 0.25 μg/mL meropenem, 250 μg/mL cloxacillin, and 70 μg/mL ZnSO₄), and (4) M-ECC medium (CHROMagar ECC supplemented with 0.25 μg/mL meropenem and 70 μg/mL ZnSO₄). Each plate was incubated at 37 °C for 24 h, and the percent recovery was calculated as the average colony count of a given isolate divided by that in MHA. The difference in the CFU count between MHA and each selective medium was assessed using a two-tailed Student’s t test with GraphPad Prism software (GraphPad Software, La Jolla, CA, USA).

Clinical faecal specimens from the patients were collected with Seed Swab No. 1 (Eiken Chemical Co., Ltd., Tokyo, Japan) and stored at 4 °C until examination. The samples were inoculated directly from the swab into chromID CARBA medium and M-ECC medium without pre-incubation. Positive colonies were selected as defined by the manufacturer’s instructions and examined for specification of bacterial isolates and antimicrobial susceptibility using a MicroScan WalkAway Plus system (Beckman Coulter, Brea, CA, USA). The results were interpreted according to the 2012 guidelines (M100-S22) of the Clinical Laboratory Standards Institute (Wayne, PA, USA). When the isolates showed intermediate or resistance to meropenem or imipenem, their carbapenemase genotypes were analysed by PCR as previously described [13]. An isolate positive for the bla _IMP gene was further analysed to identify the bla _IMP-1 or bla _IMP-6 type by sequencing the acquired amplified products using a primer set targeting bla _IMP (IMP-1_469F: TTTATATTTTTGTTTTGCAGCATTGC; IMP-1_1277R: CGCGTTGTGGAATACTTTGC). Sensitivity and specificity of media for bla _IMP-type CPE identification were calculated using GraphPad Prism software.