Differences in elongation of very long chain fatty acids and fatty acid metabolism between triple-negative and hormone receptor-positive breast cancer

This study was approved by the ethics committee at Kobe University Graduate School of Medicine (Kobe, Japan) and was conducted between October 2013 and November 2015. Human tissue samples were used in accordance with the guidelines of Kobe University Hospital, and written informed consent was obtained from all subjects. The tissue samples were collected from the patients with diagnosis of invasive breast cancer and with its surgical operation at Kobe University Hospital and Hyogo Cancer Center, and the male patients, the patients under 18 years old, and the patients who had a history of cancer before being diagnosed were excluded. The tissue samples were collected prior to the beginning of adjuvant therapy. After surgery, the breast cancer and normal breast tissue samples were immediately cut into pieces. The normal breast tissue samples were obtained from sites that were a sufficient distance from the cancer tissue sampling sites. Breasts resected by surgery were pathologically diagnosed, and it was confirmed whether the sites of resected tissue samples were cancer or normal breast. We defined EP + H- as follow: ER and PgR was more than 3 (total score of Allred score) or more than 3a (J-score). Regarding HER2, the immunohistochemistry test was 0 and 1+. If the immunohistochemistry test was 2+, fluorescence in the situ hybridization (FISH) test was less than 2.2. Pathologically, all of the primary tumors measured <5 cm in diameter (T1 and T2 which is defined by TNM classification of the Unio Internationalis Contra Cancrum). The tissue samples were transferred to clean tubes containing dry ice and kept in a deep freezer at −80 °C until use. For the experiments, tissue samples were defrosted on ice and cut into pieces of about 5 mg each. The total number of breast cancer tissue samples was 74, and the numbers of EP + H- and TN were 49 and 11, respectively. Regarding the remaining 14 samples, the subtype with ER-, PgR+ and HER2- was 3 samples, and the subtype with ER+, PgR- and HER2- was 8 samples, the subtype with and ER+, PgR+ and HER2+ was 3 samples.

Each 5 mg sample was homogenized using an Automill TK-AM5 (Tokken, Inc., Chiba, Japan) with 0.9 mL of a solvent mixture (MeOH, H ₂O, and CHCl ₃ in a ratio of 2.5:1:1) containing 1 μM 2-bromohypoxanthine and 1 μM 10-camphorsulfonic acid as internal standards, and then low-molecular-weight metabolites were extracted as previously described [ 15]. The extracted solutions were subjected to LC/MS analysis.

For lipid compound analysis, 5 mg of tissue was homogenized with 225 μL of MeOH and 25 μL of 500 μg/L dilauroylphosphatidylcholine (PC 12:0/12:0; Avanti Polar Lipids, AL, USA) dissolved in MeOH as the internal standard. After being left on ice, the solution was centrifuged at 16,000×g for 5 min at 4 °C, and The extracted solutions were subjected to LC/MS analysis.

According to the method previously described [ 15, 28], LC/MS was carried out using a Nexera LC system (Shimadzu Co., Kyoto, Japan) equipped with two LC-30 AD pumps, a DGU-20As degasser, a SIL-30 AC autosampler, a CTO-20 AC column oven and a CBM-20A control module, coupled with an LCMS-8040 triple quadrupole mass spectrometer (Shimadzu Co.).

To identify the hydrophilic cationic and anionic metabolites, the m/z value and retention time of each peak were compared with those of chemical standards that had been analysed using the same methods [ 15, 28]. Peak picking and integration were automatically performed using the LabSolutions software (ver. 5.65; Shimadzu Corp.), and the results were then checked manually. The peak area of each metabolite was normalized to that of the internal standards. Regarding the hydrophobic lipid metabolites, analysis based upon physicochemical properties and/or spectral similarity with public or commercial spectral libraries was performed (putative annotation), because chemical reference standards could not be obtained. Mouse liver extract was used as the quality control sample to ensure consistency in retention time information in the in-house library and detected peak retention time during the experiment. A quality control sample was included in each analyzing batch for the hydrophobic lipid metabolites. A blank sample was also used for each analysis. When samples were prepared for hydrophilic and hydrophobic analysis, we utilized blank samples that did not contain patient samples. A blank sample was included in each analyzing batch. In the analysis of blank samples, we confirmed that there is no peak detection in the blank samples. We also checked that there is no error from the detection value of the internal standards during the measurements. Numbers of targeted metabolites in multiple reaction monitoring (MRM)-based database were 267 of hydrophilic metabolites and 284 of hydrophobic lipid metabolites (Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3). The metabolites with the lower intensity near the detection limit were excluded from the evaluations, because the lower intensity might be accurate data.

RNA was extracted from the human tissue samples using the NucleoSpin RNA® kit (TaKaRa Bio Inc., Tokyo, Japan) according to the manufacturer’s procedure. We performed RNA extraction using 8 TN samples, 8 EP + H- samples, and the corresponding normal breast tissue samples because there were only 8 TN tumors remaining. Then, cDNA was produced from the collected RNA with the RT ² first strand kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s procedure. The quantitative real-time RT-PCR was conducted using the 7500 real time PCR system (Applied Biosystems, Tokyo Japan) and Power SYBR Green PCR master mix (Applied Biosystems). The expression levels of the target mRNA were calculated using the threshold cycle (Ct) value of the relevant PCR product, and were normalized to the mRNA expression level of 18S rRNA. All mRNA expression levels of fatty chain elongases (elongation of very long chain fatty acids [ELOVL]) 1–7 were calculated by using the comparative 2ΔΔCt method. The primer sequences used in this experiment are as follows: ELOVL1_F AGCACATGACAGCCATTCAG and ELOVL1_R AGATGGTGCCATACATCCAG; ELOVL2_F TGCTCTTTCTCTCAGGGGTATC and ELOVL2_R AGTTGTAGCCTCCTTCCCAAG; ELOVL3_F TTCGAGGAGTATTGGGCAAC and ELOVL3_R GAAGATTGCAAGGCAGAAGG; ELOVL4_F TGGTGGAAACGATACCTGAC and ELOVL4_R AATTAGAGCCCAGTGCATCC; ELOVL5_F CATTCCCTCTTGGTTGGTTG and ELOVL5_R TTCAGGTGGTCTTTCCTTCG; ELOVL6_F GGATGCAGGAAAACTGGAAG and ELOVL6_R ATTCATTAGGTGCCGACCAC; ELOVL7_F GCGCAAGAAAAATAGCCAAG and ELOVL7_R GAATGTTCCCAAACCACCTG; 18S rRNA_F AAACGGCTACCACATCCAAG and 18S rRNA_R CCTCCAATGGATCCTCGTTA.

We subjected sections of the TN tumors, EP + H- tumors, and the corresponding normal breast tissue samples to immunohistochemistry. From each group, we stained the 5 tissue sections for ELOVL proteins and the 4 sections for choline kinase. To match characteristics of tumor, we selected these sections. All sections had the similar characteristics pathologically as the primary tumor (histologic grade, tumor size, lymph node involevement and stage). The sections were cut from formalin-fixed and paraffin-embedded tissues. The paraffin sections were heated in an incubator at 65 °C for 30 min and then deparaffinized with xylene and rehydrated in 100% ethanol, 90% ethanol, 70% ethanol and phosphate-buffered saline. The sections were placed in a Decloaking Chamber (Biocare Medical, Concord, CA, USA) with Target Retrieval Solution (Dako, Tokyo, Japan) at 125 °C for 3 min, at 90 °C for 10 s, and then left at room temperature for 20 min. Endogenous peroxidase was inactivated using Peroxidase-Blocking Solution (Dako, Tokyo, Japan). The sections were incubated with a primary antibody against choline kinase at a dilution of 1:20, a primary antibody against ELOVL1 at a dilution of 1:40, primary antibody against ELOVL5 at a dilution of 1:50, and a primary antibody against ELOVL6 at a dilution of 1: 200 in a humidified chamber at 4 °C overnight. The sections were washed by using Tris-buffered saline with Tween 20 and then incubated with EnVision + System- HRP Labelled Polymer Anti-Rabbit (Dako, Tokyo, Japan) as a secondary antibody against rabbit IgG (Dako, Tokyo, Japan) for 30 min at room temperature. Next, the sections were stained with ImmPACT DAB (Vector, Tokyo, Japan) for 2–3 min and then washed with water. Subsequently, nuclei in the sections were counterstained with Mayer’s hematoxylin for 3 min, and then the sections were dehydrated with 70% ethanol, 80% ethanol, 90% ethanol and 100% ethanol, and were finally cleared by xylene.

Sections were cut from formalin-fixed and paraffin-embedded tissues. The paraffin sections were heated in an incubator at 65 °C for 30 min, then deparaffinized by xylene and rehydrated in 100% ethanol, 90% ethanol, 70% ethanol and phosphate buffered saline. Then, the sections were stained with Mayer’s hematoxylin for 10 min (to stain the nuclei) and washed with water, before being stained with eosin for 10 min (to stain the cytoplasm). The stained sections were dehydrated in 70% ethanol, 80% ethanol, 90% ethanol, 100% ethanol and finally cleared by xylene.

We analyzed the metabolites in the 74 breast cancer tissue samples and the corresponding normal breast tissue samples using LC/MS. The subjects’ characteristics are shown in Table 1. In this study, we performed the MRM-based targeted analysis. The number of targeted metabolites included in the MRM database was 267 of hydrophilic metabolites and 284 of hydrophobic lipid metabolites (Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3), and we identified 142 of hydrophilic metabolites and 278 of hydrophobic lipid metabolites in breast cancer tissue samples and the corresponding normal breast tissue samples. Levels of the cationic metabolites (such as nucleobases and derivatives, nucleosides, amino acids and derivatives, quaternary ammonium salts and folic acids), anionic metabolites (such as organic acids, fatty acids, benzoic acids, sugar phosphates, coenzyme A and nucleosides) and lipid metabolites (such as lyso-glycerophosphocholines [LPC], glycerophosphocholines [PC], lyso-glycerophosphoethanolamines [PE], glycerophosphoethanolamines [LPE], free fatty acids and cholic acids) are shown in Additional file 4: Table S4 and Additional file 5: Table S5.

Next, we confirmed the association between the identified metabolites and metabolite pathways by using the Kyoto Encyclopedia of Genes and Genomes (KEGG) Database, and evaluations based on the glycolytic pathway, tricarboxylic acid (TCA) cycle, glutamine pathway, choline pathway, urea cycle, tryptophan cycle, glutathione cycle, purine pathway, pyrimidine pathway, and amino acid metabolism were carried out (Table 2A). In the analysis of the levels of metabolites related to the glycolytic pathway, the level of lactic acid was significantly increased between breast cancer tissue samples and the corresponding normal tissue samples, but no significant differences in other metabolites were detected. In the TCA cycle, the levels of cis-aconitic acid and isocitric acid were significantly higher, and those of 2-ketoglutaric acid and succinic acid were significantly lower in the breast cancer tissues than in normal tissue. Regarding the levels of metabolites related to the glutamine pathway, the breast cancer tissue samples displayed higher levels of glutamine and glutamic acid than the normal breast tissue samples. In the analysis of the metabolites related to the choline pathway, the breast cancer tissue samples demonstrated significantly higher levels of choline and phosphocholine than the normal breast tissue samples, and the ratio of phosphocholine to choline was higher in the breast cancer tissue samples. Figure 1 shows the levels of metabolites related to the choline pathway and the phosphocholine to choline ratio in the breast cancer tissue samples and the corresponding normal breast tissue samples. During immunostaining, it was demonstrated that the expression of choline kinase, which is an enzyme that catalyzes the conversion of choline to phosphocholine, was upregulated in the breast cancer tissue samples compared with the normal breast tissue samples (Fig. 2). In the analysis of the metabolites related to the urea cycle, the levels of aspartate, arginine and citrulline were significantly higher in breast cancer tissue samples. Regarding the metabolites related to the purine pathway, the levels of guanosine and hypoxanthine were higher in the breast cancer tissue samples. Most amino acids exhibited significantly higher levels in the breast cancer tissue samples. As for saturated fatty acids, the breast cancer tissue samples exhibited lower levels of C16:0 than the normal breast tissue samples, and the levels of C20:0, C22:0, and C24:0 were higher in the breast cancer tissue samples. Furthermore, the levels of C26:0 and C28:0 were lower in the breast cancer tissue samples, although C26:0 and C28:0 showed no significant changes in FDR-adjusted p-value. Concerning unsaturated fatty acids, the levels of ω3 family C18:3 and C18:4 were lower and of C20:5 higher in the breast cancer tissues. The level of the ω6 family C18:2 was lower, and the levels of C20:3, C20:4 and C22:4 were significantly higher in the breast cancer tissues. The levels of the ω7 family C16:1 and C18:1 were significantly lower in the cancer tissues, although C16:1 showed no significant changes in FDR-adjusted p-value. In the ω9 family, C18:1 was lower, but the levels of C20:1, C22:1 and C24:1 were significantly higher (Fig. 3a). The levels of most LPC, LPE, PC, and PE were higher in the breast cancer tissue samples than in the normal breast tissue samples, and a summary of our findings regarding glycerophospholipids is shown in Table 3.

We classified breast cancer tissue samples into TN and EP + H-. The number of TN was 11 and EP + H- was 49. We evaluated the differences in the metabolite profiles of EP + H- and TN, as shown in Table 2B. Most of the metabolites derived from the glycolytic pathway exhibited higher levels in the TN tumors than in the EP + H- tumors. On the other hand, there were no characteristic differences in the levels of metabolites related to the TCA cycle or glutamine cycle between the TN and EP + H- tumors. Regarding the metabolites related to the choline pathway, the levels of choline and phosphocholine in the TN tumors were higher than in the EP + H- tumors, although phosphocholine was only slightly higher. During the immunostaining of choline kinase, we did not observe any prominent differences between the TN and EP + H- tumors (Fig. 2). As for saturated fatty acids, the levels of C16:0 to C28:0 were higher in the TN tumors than in the EP + H- tumors. Regarding unsaturated fatty acids, the levels of the ω3 family C18:3, C18:4 and C20:5 were lower in the TN tumors. The levels of the ω6 family C18:2, C20:3 and C20:4 were lower in TN compared with EP + H- tumors, but the level of C22:4 did not differ. The levels of the ω7 family C16:1 and C18:1 were lower in the TN tumors. The levels of the ω9 family C18:1 and C20:1 were lower in the TN tumors, but the levels of C22:1 and C24:1 were higher (Fig. 3b).

In the levels of glycolytic pathway-related metabolites, the levels of lactic acid and phosphoenol-pyruvate (PEP) were significantly increased between TN and the corresponding normal breast tissue samples, although PEP showed no significant changes in FDR-adjusted p-value. Regarding other metabolites, there were no significant differences, and we did not detect any characteristic findings concerning TCA cycle-related metabolites. As for glutamine pathway-related metabolites, the ratio of glutamate to glutamine was higher in the TN tumor samples than in the normal breast tissue samples. Concerning choline pathway-related metabolites, the level of phosphocholine was higher than choline. The levels of arginine and citrulline were significantly higher in the TN tumors, as were glycine, guanosine and hypoxanthine. Most amino acid levels in the TN tumors were also significantly higher. Regarding saturated fatty acids, the level of C16:0 was lower, but the concentrations of C18:0 to C28:0 were higher in the TN tumors than in the normal breast tissue samples. As for unsaturated fatty acids, the levels of ω3 family C18:3 and C18:4 were lower and the level of C20:5 were higher in the normal breast tissue samples. The levels of C18:2 and C18:3 were lower in the TN tumors, but the levels of C20:3, C20:4, and C22:4 were higher. The levels of ω7 family C16:1 and C18:1 were lower in the TN tumors, while that of the ω9 family C18:1 was lower. The levels of C20:1, C22:1 and C24:1 were higher (Fig. 3c).

In the levels of glycolytic pathway-related metabolites, the level of lactic acid was significantly increased between the EP + H- tumor and the corresponding normal breast tissue samples, but no significant differences in other metabolites were detected. No significant differences in the levels of metabolites related to the glycolytic pathway, TCA cycle, other cycles, or amino acid metabolism were detected between the EP + H- tumors and the normal breast tissue samples. However, the analysis of glutamine pathway-related metabolites showed that the levels of both glutamate and glutamine were upregulated in the EP + H- tumors, with the alteration in the level of glutamine being particularly prominent. Regarding saturated fatty acids, the level of C16:0 was lower and those of C18:0 to C24:0 higher in the EP + H- tumors. The levels of C26:0 and C28:0 were lower. As for unsaturated fatty acids, the levels of ω3 family C18:3 and C18:4 were lower and that of C20:5 was higher in normal breast tissue samples. The level of ω6 family C18:2 was lower in the EP + H- tumors, but C20:3, C20:4, and C22:4 were higher. The levels of the ω7 family C16:1 and C18:1 were significantly lower. The level of the ω9 family C18:1 was lower, but the levels of C20:1, C22:1 and C24:1 were significantly higher (Fig. 3d).

As described above, differences in the metabolic pathways associated with saturated and unsaturated fatty acids were observed between each breast cancer subtype (Fig. 3b-d). It is known that the elongases involved in the initial condensation reaction are the rate-limiting enzymes of fatty acid elongation, and 7 types of elongase (ELOVL 1, 2, 3, 4, 5, 6, and 7) are considered to be involved in the ELOVL [ 29]. To identify the differences in the expression of these ELOVL between the TN tumors and the corresponding normal breast tissue samples, and between the EP + H- tumors and the corresponding normal breast tissue samples, we performed quantitative real-time RT-PCR analyses of ELOVL1–7. As a result, we detected significant changes in the mRNA expression levels of ELOVL1, 5, and 6. The mRNA expression levels of ELOVL1, 5 and 6 were significantly higher by 8.5-, 4.6- and 7.0-fold, respectively, in the TN tumors compared with the corresponding normal breast tissue samples ( p < 0.05) (Fig. 4). In the EP + H- tumors, the mRNA expression levels of ELOVL1, 5, and 6 were significantly higher by 4.9-, 3.4-, and 2.1-fold, respectively, compared with their levels in the corresponding normal breast tissue samples ( P < 0.05). In addition, the mRNA expression level of ELOVL6 was a significant 2.6-fold higher in the TN tumors than in the EP + H- tumors ( P < 0.05). Next, we performed immunostaining studies of ELOVL1, 5, and 6 expression. As a result, ELOVL1 and 6 were more strongly positive in the TN and EP + H- tumors compared with the corresponding normal breast tissue samples (Fig. 5a,b). Furthermore, stronger staining of ELOVL1 and 6 was observed in the TN tumors compared with the EP + H- tumors, although no such phenomenon was seen for ELOVL5.