Differential expression of lysosome-associated protein transmembrane-4 beta (LAPTM4B) in granulosa cells of ovarian follicles and in other bovine tissues

The regulation of LAPTM4B expression during follicular development and ovulation was studied using in vivo models as previously characterized [23]. Estrous cycles of normal cycling crossbred heifers were synchronized with one injection of PGF_2α (25 mg, im; Lutalyse, Upjohn, Kalamazoo, MI) given in the presence of a corpus luteum, and ovarian follicular development was monitored by daily transrectal ultrasonography. Following estrous synchronization, heifers were randomly assigned to the dominant follicle group (DF, n = 4), or the ovulatory hCG-induced follicle group (OF, n = 4). In the DF group, the ovary bearing the DF on the morning of day 5 of the estrous cycle (day 0 = day of estrus) was obtained by ovariectomy (via colpotomy). The DF was defined as > 8 mm in diameter and growing while subordinate follicles were either static or regressing. The OF were obtained following an injection of 25 mg of PGF_2α (Lutalyse) on day 7 to induce luteolysis, thereby promoting the development of the DF of the first follicular wave into a preovulatory follicle. An ovulatory dose of hCG (3000 IU, iv; APL, Ayerst Lab, Montréal, QC) was injected 36 h after the induction of luteolysis, and the ovary bearing the hCG-induced OF was collected by ovariectomy at 0, 6, 12, 18, and 24 h after hCG injection (n = 2–4 cows/time point). Immediately following ovariectomy, follicles were dissected into preparations of follicular wall (theca interna with attached granulosa cells) [27] or further dissected into separate isolates of granulosa cells [23], and stored at −70°C. Additionally, GC were collected from 2 to 4 mm small follicles (SF) obtained from slaughterhouse ovaries, and a total of three pools of 20 SF was prepared. Concentrations of progesterone (P₄), and estradiol-17β (E₂), and their ratio (P₄/E₂) were validated by radioimmunoassay of follicular fluid as previously described [23]. Corpora lutea (CL) at day 5 of the estrous cycle were obtained by ovariectomy and were dissected from the ovarian stroma, frozen in liquid nitrogen, and then stored at −70°C. The Animal Ethics Committee of the Faculty of Veterinary Medicine of the University of Montreal approved all animal procedures.

The LAPTM4B cDNA was cloned from a bovine cDNA library prepared with polyA⁺ mRNA isolated from GC of dominant follicles at day 5 of the estrous cycle as described above. The cDNA library was constructed in lambda Zap Express vector (Stratagene, La Jolla, CA) by unidirectional cloning of cDNAs as previously described [28]. Following in vivo excision of pBluescript phagemids containing the cloned cDNA insert with the Ex-Assist/XLOLR system (Stratagene), single bacterial colonies were randomly picked and their phagemid content were purified by mini-prep (Qiagen, Mississauga, ON). The LAPTM4B cDNA was entirely characterized by sequencing on an ABI Prism 310 (Applied BioSystem).

The 5′-end of the bovine LAPTM4B was verified by screening a genomic DNA library to eventually yield all the 5′-untranslated region and promoter sequences. The genomic DNA library was prepared in Lambda phages (BD Biosciences Clontech) and 1×10⁷ pfu was screened using the bovine LAPTM4B cDNA (GenBank NM_205802) as a P³²-radiolabelled probe. Hybridized clones were analyzed by PCR using specific probes designed in the 5′-UTR of the LAPTM4B cDNA (forward: GCGAGCTCTTCGCGGGGAGAG; reverse: CAAGTACCAGACGCCGAGCAG). A second round of screening was performed to isolate a positive clone. Recombinant DNA was purified as described [29], cloned into the pDrive vector (Qiagen Cloning kit) following BamH1 digestion, and characterized by sequencing.

RNA was isolated from various bovine tissues obtained from slaughterhouse by extraction in lysis buffer (4 M guanidium isothiocyanate, 0.5% Na-N-laurylsarcosine, 25 mM Na-citrate, pH 7), sedimentation, and centrifugation on a cesium chloride cushion as previously described [28]. The concentration of total RNA was quantified by measurement of optical density at 260 nm, and quality was evaluated by visualizing the 28S and 18S ribosomal bands following electrophoretic separation on 0.66 M formaldehyde denaturing 1% agarose gel with ethidium bromide [29]. Expression of LAPTM4B mRNA in various tissues was compared by Northern analysis. Total RNA (20 μg/tissue) was size-fractionned on a 0.66 M formaldehyde 1% agarose gel, transfered by capillarity onto a nylon membrane (Hybond-N; GE Healthcare Life Sciences), and UV-treated (150 mJ) as previously described [28]. The amount of ribosomal RNA (18S) was estimated after methylene blue staining and the image was digitized (FotoDyne Inc., Hartland, WI) and analyzed using the NIH Image software. The bovine LAPTM4B cDNA was used to generate a radioactive probe incorporating [α³²P]-dCTP (NEN Life Sciences, Boston, MA) that was subsequently used to hybridize Northern blots as described [28]. The film images were digitized and the intensity of bands expressed as ratios of 18S ribosomal RNA.

Expression and regulation of LAPTM4B mRNA during follicular development and following hCG injection was analyzed by semi-quantitative RT-PCR. Total RNA was extracted from bovine GC collected from follicles at different developmental stages (SF, DF, OF) and CL, and from follicular wall (granulosa and theca cells) collected at 0, 6, 12, 18, and 24 hours after an injection of hCG. The sample at 0 hour was represented by day 7 dominant follicle (DF). Specific LAPTM4B PCR primers were used and the number of cycles was limited and optimized for analysis of LAPTM4B mRNA expression. PCR reaction products were separated on a 2% TAE-agarose gel with ethidium bromide, visualized by UV light, digitized and analyzed by densitometry using ImageQuant software (GE Healthcare Life Sciences). GAPDH was used as a control gene, and specific signals of LAPTM4B were normalized with corresponding GAPDH signals.

A fragment corresponding to amino acids Lys¹⁶⁹ to Ala²²⁵ (LAPTM4B; Molecular weight = 7.5 kDa) located at the carboxy-terminal end of the bovine LAPTM4B was used to generate a glutathione S-transferase fusion protein (GST Gene Fusion System; GE Healthcare Life Sciences) to produce specific polyclonal antibodies. To increase the molecular weight of LAPTM4B recombinant protein fragment and thus facilitate down-stream purification procedures, a DNA construct that included a tandem repeat of Lys¹⁶⁹ to Ala²²⁵ (LA)₂-LAPTM4B fragments cloned at the carboxy-terminal end of the GST was generated. A set of forward (5′-AAGGGTTACTTGATTAGCTGTGTTTGG-3′) and reverse (5′-GGCAGACACGTACGGGGGC-3′) primers that incorporated BamHI (forward primer) and EcoRI (reverse primer) restriction sites were designed from the LAPTM4B cDNA to generate the first LAPTM4B fragment. The same set of primers that incorporated an EcoRI (forward primer) and SalI (reverse primer) were used to generate the second LAPTM4B fragment. The LAPTM4B fragments were amplified by PCR using the Expand High Fidelity polymerase (Roche Molecular Biochemicals) according to the manufacturer’s protocol. The fragments were isolated after electrophoresis, digested with either BamHI and EcoRI (for the first fragment), or EcoRI and SalI (for the second fragment). The first fragment was subcloned into the pGEX-2 T vector (GE Healthcare Life Sciences) in frame with the GST coding region, as described previously [28]. The second fragment was then subcloned down-stream of the GST-LAPTM4B first fragment, and the resulting plasmid sequenced to confirm its integrity. Protease-deficient E. coli BL-21 (GE Healthcare Life Sciences) were transformed with the (LA)₂-LAPTM4B/pGEX-2 T construct, and expression of recombinant (LA)₂-LAPTM4B/GST fusion protein was induced with 0.1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG) for 6 hours. Proteins from bacterial extracts were obtained after sonication as previously described [28]. The (LA)₂-LAPTM4B/GST-fusion protein was purified by affinity on glutathione-Sepharose beads (GE Healthcare Life Sciences), and digested with thrombin (10units/1 mg of fusion protein) to release the tandem (LA)₂-LAPTM4B fragment. Proteins were resolved by one-dimensional SDS-PAGE, transferred onto nitrocellulose membrane (0.45 μm Hybond C; GE Healthcare Life Sciences), and stained with Ponceau S red. The tandem (LA)₂-LAPTM4B band (MW = 15.3 kDa) was cut and used to immunize a rabbit as previously described [28]. Preceeding immunization, the identity of the purified (LA)₂-LAPTM4B fragment was verified by liquid chromatography-tandem mass spectrometry (Eastern Quebec Proteomics Center, Laval University, Quebec, Canada). Polyclonal antibodies against bovine LAPTM4B were validated by immunoblotting using the GST-affinity purified recombinant (LA)₂-LAPTM4B.

Granulosa cells and CL were obtained as described above. They were homogenized in M-PER buffer (Pierce, Rockford, IL, USA) supplemented with complete protease inhibitors (Roche Diagnostics, Laval, QC, Canada) as described by the manufacter’s protocol, and centrifuged at 16,000 × g for 10 min at 4°C. The recovered supernatant was stored at −70°C until electrophoretic analyses were performed. Protein concentrations were determined according to Bradford method [30] (Bio-Rad Protein Assay, Bio-Rad Lab, Mississauga, ON, Canada). Immunoblotting was performed as described previously [28]. Samples (50 μg of proteins) were resolved by one-dimensional denaturing Novex Tris-glycine gels (Invitrogen, Burlington, ON, Canada) and electrophoretically transferred to polyvinylidene difluoride membranes (PVDF; GE Healthcare Life Sciences). Membranes were incubated with the polyclonal anti-bovine LAPTM4B antibody (1:2000), and immunoreactive proteins were visualized by incubation with horseradish peroxidase-linked donkey anti-rabbit secondary antibody (1:20 000 dilution) and the enhanced chemiluminescence system, ECL plus (GE Healthcare Life Sciences) according to the manufacturer’s protocol followed by revelation using the ChemiDoc XRS+ system (Bio-Rad).

To confirm the detection of the two forms of LAPTM4B protein with our antibodies, overexpression experiments in mammalian cells were performed. The LAPTM4B open reading frame was amplified by PCR using the Expand High Fidelity polymerase (Roche Molecular Biochemicals) with specific LAPTM4B primers. The PCR fragment was purified and cloned into pQE-TriSystem His-Strep2 (Qiagen). The final construct pQE2-LAPTM4B was used to transfect HEK cells using the CalPhos mammalian transfection kit (Clontech Laboratories, Inc.) according to the manufacturer’s protocol. Seventy-two hours post-transfection, cells were harvested and protein extraction as well as immunoblotting was performed as described above using the anti-LAPTM4B antibody generated from the present study and a commercial anti-LAPTM4B antibody (Abcam Inc.; cat. # ab82810, at a concentration of 1 μg/ml). To verify for ubiquitination of the LAPTM4B protein, immunoblotting was also performed using a monoclonal anti-ubiquitin antibody (Sigma U0508 at 1:2,500 dilution). Immunoreactive proteins were visualized by incubation with horseradish peroxidase-linked sheep anti-mouse secondary antibody (1:20 000 dilution) and the enhanced chemiluminescence system, ECL plus (GE Healthcare Life Sciences) according to the manufacturer’s protocol followed by revelation using the ChemiDoc XRS+ system (Bio-Rad).

Immunohistochemistry was performed on PBS buffered formaline-fixed follicles and CL that were generated as described above, as well as on bovine tissues obtained from slaughterhouse. Paraffin-embedded tissues were cut at 4 μm thickness, mounted on SuperfrostPlus slides (Fischer Scientific, QC), deparaffined and rehydrated. Tissue sections were heat-treated as previously described [28], and were incubated for 14 h at 4°C with our anti-LAPTM4B antibody at a dilution of 1:500 in Tris-buffered saline (TBS; 150 mM NaCl, 0.1 M Tris pH 7.5) containing 1% bovine serum albumin, and 1% fat-free skim milk. Control tissue sections were incubated similarly with preimmune serum. The primary antibody and LAPTM4B antigen complexes were detected by incubation with a monoclonal anti-rabbit IgG conjugated with alkaline phosphatase (Sigma Chemicals) at a dilution of 1:200 for 2 h at room temperature, followed by several washes in TBS, and incubation with the NBT/BCIP alkaline phosphatase substrate (Roche Diagnostics). Sections were mounted in 5% gelatin, 27% glycerol, and 0.1% sodium azide. Photographs were taken under bright field illumination using a Nikon Eclipse E800 microscope equipped with a digital camera (Nikon DXM 1200). Digital images were processed by the Photoshop software (Adobe Systems Inc., San Jose, CA) and assembled by the Illustrator software (Adobe Systems Inc.).

Amounts of LAPTM4B mRNA were normalized with those of the control gene GAPDH. Homogeneity of variance between groups was verified by O’Brien and Brown-Forsythe tests. Corrected values of gene specific mRNA levels were compared between follicular or CL groups by one-way ANOVA. When ANOVA indicated a significant difference (P < 0.05), the Tukey-Kramer test was used for multiple comparison of individual means among SF, DF, OF and CL, whereas the Dunnett test (P < 0.05) was used to compare different time points after hCG with 0 h as control. Data were presented as least-square means ± SEM. Statistical analyses were performed using JMP software (SAS Institute, Inc.).