Background
Methods
Animals and sample collection
Microarray analysis
Quantitative real-time RT-PCR analysis
Gene (GenBank accession number) | Primer | Sequence | Position |
---|---|---|---|
CHGA
| Forward | 5′-GCCGAAAGAGGTGACAGAAGA-3′ | 538-558 |
(NM_181005) | Reverse | 5′-GTCTCCGTCCGAGTCTTCATC-3′ | 637-617 |
CNGA1
| Forward | 5′-AGCAGAGATCGCCATCAATGT-3′ | 1574-1594 |
(NM_174278) | Reverse | 5′-ACCAACTCCACCAACAGACCA-3′ | 1663-1643 |
CPXM2
| Forward | 5′- ACCAGTGGATTGAAGTGGACG-3′ | 581-601 |
(NM_001206057) | Reverse | 5′- TCACTCAGCCAGAGTGAGTTCCT-3′ | 665-643 |
FAM83D
| Forward | 5′- GGCTCCTACAGTTTTACATGGACAG-3′ | 788-812 |
(NM_001083393) | Reverse | 5′-CAACCACTTGGCCAGACAGAA-3′ | 863-843 |
FMO2
| Forward | 5′- AAGCCAGACATCCTTTCTCTCTTG -3′ | 1459-1482 |
(NM_001163274) | Reverse | 5′- CCCAACCAGGCGATACTGATA-3′ | 1554-1532 |
GSTA3
| Forward | 5′-AGAGCCATCCTCAGCTACCTTG-3′ | 254-275 |
(NM_001077112) | Reverse | 5′-TCGATCCTGACTGTCTCCTTCA-3′ | 327-306 |
IFIH1
| Forward | 5′-GGGACTAACAGCTTCACCAGGT-3′ | 1764-1785 |
(XM_002685338) | Reverse | 5′-GGTAACTGCATCAAGATTGGCA-3′ | 1860-1839 |
IGG1C
| Forward | 5′-ACCAAGGTGGACAAGGCTGTT-3′ | 274-294 |
(S82409) | Reverse | 5′-GGAAGATGAAGACAGAGGGTCCT-3′ | 370-348 |
KCNA2
| Forward | 5′-TGGGTTCCCTATGTGCAATTG-3′ | 1644-1664 |
(NM_001101195) | Reverse | 5′-TCCCGGTGGTAGAAGTAGTTGAA-3′ | 1734-1712 |
KLHL24
| Forward | 5′- TTATTGGCAAGGAGGAGATGGT-3′ | 901-922 |
(NM_001206196) | Reverse | 5′- TCTCAGATCAACAGCGCGAT-3′ | 968-949 |
KRT35
| Forward | 5′- GAGACCGAGGTATCCATGCG-3′ | 587-606 |
(NM_001076073) | Reverse | 5′- TTCTTGAGGCAGAGCAGCTC -3′ | 726-707 |
LPLUNC1
| Forward | 5′- TCGGTGTGTTCAACCCTAAGC-3′ | 1280-1300 |
(NM_174697) | Reverse | 5′- TTCTCGTTTGGCAGCAGGAT -3′ | 1355-1336 |
PIPOX
| Forward | 5′- ACAGCATTAACACCGAGTCGG-3′ | 2140-2160 |
(NM_001014878) | Reverse | 5′- GGCAGTTATGAGCCTGTTTCCT-3′ | 2210-2189 |
PLEKHA5
| Forward | 5′- GATGGATTCAAGAACGGAACG-3′ | 2655-2675 |
(XM_002687754) | Reverse | 5′- TTCCACAGTCATCCTAGGTCGA-3′ | 2739-2718 |
PRF1
| Forward | 5′-CAAGCCAAATGCTAATGTCCGT-3′ | 408-429 |
(NM_001143735) | Reverse | 5′-AAAGCGACACTCCACTAAGTCCAT-3′ | 531-508 |
PRSS2
| Forward | 5′-GTGAGGCTGGGAGAATACAACA-3′ | 211-232 |
(NM_174690) | Reverse | 5′-ATGATCTTGGACGCATCGATGA-3′ | 281-260 |
SLC39A2
| Forward | 5′- TTGGCTGCCTATTTGCCCT-3′ | 355-373 |
(NM_001205648) | Reverse | 5′- CTGGAACCACTTGAAGCAGATG-3′ | 428-407 |
THBS4
| Forward | 5′- CACTCTGAACGAGCTCTACGTGAT 3′ | 331-354 |
(NM_001034728) | Reverse | 5′- GAAGAGTAAAGGCCGAAGATGGT-3′ | 411-389 |
SUZ12
| Forward | 5′-GAACACCTATCACACACATTCTTGT-3′ | 1565-1589 |
(NM_001205587) | Reverse | 5′-TAGAGGCGGTTGTGTCCACT-3′ | 1694-1675 |
Immunohistochemistry
Statistical analysis
Results
Gene expression profiles of CAR and ICAR in ipsilateral uterine horns
GenBank accession ID | Gene symbol | Gene description | Fold change |
P-value |
---|---|---|---|---|
Up-regulated genes | ||||
NM_001077112 | GSTA3 | Glutathione S-transferase, alpha 3 | 19.2 | 0.0016 |
NM_001206196 | KLHL24 | Kelch-like 24 (Drosophila) | 3.0 | 0.0273 |
XM_588022 | SPOPL | Speckle-type POZ protein-like | 2.8 | 0.0239 |
NM_001103317 | ERCC2 | Excision repair cross-complementing rodent repair deficiency, complementation group 2 | 2.5 | 0.0437 |
XM_002696037 | CD300LG | CD300 molecule-like family member g | 2.2 | 0.0378 |
NM_001075908 | STK33 | Serine/threonine kinase 33 | 2.1 | 0.0351 |
NM_174607 | SLC5A3 | Solute carrier family 5 (inositol transporters), member 3 | 2.0 | 0.0126 |
NM_001192523 | KCNMB4 | Potassium large conductance calcium-activated channel, subfamily M, beta member 4 | 2.0 | 0.0307 |
NM_001083638 | MEF2A | Myocyte enhancer factor 2A | 2.0 | 0.0290 |
XM_002695445 | ZNF211 | Zinc finger protein 211 | 2.0 | 0.0063 |
Down-regulated genes | ||||
NM_001206057 | CPXM2 | Carboxypeptidase X (M14 family), member 2 | 5.3 | 0.0496 |
NM_001076073 | KRT35 | Keratin 35 | 4.1 | 0.0279 |
NM_001101239 | GRP | Gastrin-releasing peptide | 3.6 | 0.0319 |
NM_001245926 | FGF9 | Fibroblast growth factor 9 | 3.5 | 0.0066 |
NM_174145 | PKP1 | Plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) | 2.9 | 0.0021 |
NM_001076864 | TMEM129 | Transmembrane protein 129 | 2.6 | 0.0087 |
NM_001105478 | SSLP1 | Secreted seminal-vesicle Ly-6 protein 1 | 2.5 | 0.0474 |
NM_001077962 | STAC | SH3 and cysteine rich domain | 2.4 | 0.0157 |
NM_001077945 | PFN3 | Profilin 3 | 2.4 | 0.0106 |
NM_001012685 | FCAR | Fc fragment of IgA, receptor for | 2.3 | 0.0322 |
Term | Count |
P-value |
---|---|---|
Up-regulated genes | ||
GO:0048856 ~ anatomical structure development | 11 | 0.0029 |
GO:0032502 ~ developmental process | 11 | 0.0161 |
GO:0009987 ~ cellular process | 31 | 0.0186 |
GO:0007275 ~ multicellular organismal development | 10 | 0.0230 |
GO:0009888 ~ tissue development | 5 | 0.0246 |
Down-regulated genes | ||
GO:0009987 ~ cellular process | 95 | <0.0001 |
GO:0007010 ~ cytoskeleton organization | 8 | 0.0061 |
GO:0022610 ~ biological adhesion | 11 | 0.0065 |
GO:0007155 ~ cell adhesion | 11 | 0.0065 |
GO:0016043 ~ cellular component organization | 23 | 0.0099 |
GenBank accession ID | Gene symbol | Gene description | Fold change |
P-value |
---|---|---|---|---|
Up-regulated genes | ||||
NM_174697 | LPLUNC1 | Von Ebner minor salivary gland protein | 3.7 | 0.0214 |
NM_001075162 | FMO2 | Flavin containing monooxygenase 2 (non-functional) | 3.3 | 0.0348 |
NM_001166616 | C5 | Complement component 5 | 3.2 | 0.0429 |
XM_002692160 | FOXA2 | Forkhead box A2 | 3.0 | 0.0350 |
NM_181027 | AKR1C4 | Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) | 2.9 | 0.0104 |
NM_001045878 | GATM | Glycine amidinotransferase (L-arginine:glycine amidinotransferase) | 2.8 | 0.0472 |
NM_001206196 | KLHL24 | Kelch-like 24 (Drosophila) | 2.6 | 0.0301 |
NM_001034419 | HPGD | Hydroxyprostaglandin dehydrogenase 15-(NAD) | 2.6 | 0.0293 |
XM_001254052 | ZNED1 | DNA-directed RNA polymerase I subunit RPA12-like | 2.4 | 0.0476 |
NM_001038096 | CFI | Complement factor I | 2.4 | 0.0096 |
Down-regulated genes | ||||
NM_001034728 | THBS4 | Thrombospondin 4 | 3.4 | 0.0106 |
NM_001083393 | FAM83D | Protein FAM83D | 2.6 | 0.0011 |
NM_001105411 | GFRA1 | GDNF family receptor alpha 1 | 2.4 | 0.0391 |
NM_001206057 | CPXM2 | Carboxypeptidase X (M14 family), member 2 | 2.3 | 0.0231 |
NM_178572 | CA2 | Carbonic anhydrase II | 2.3 | 0.0474 |
NM_001099381 | GALK1 | Galactokinase 1 | 2.1 | 0.0466 |
NM_001035050 | VTN | Vitronectin | 2.0 | 0.0464 |
NM_174745 | MMP2 | Matrix metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type IV collagenase) | 1.9 | 0.0387 |
NM_001075730 | STRA6 | Stimulated by retinoic acid gene 6 | 1.9 | 0.0405 |
NM_174558 | KCNK17 | Potassium channel, subfamily K, member 17 | 1.9 | 0.0496 |
Term | Count |
P-value |
---|---|---|
Up-regulated genes | ||
GO:0008152 ~ metabolic process | 38 | 0.0033 |
GO:0044237 ~ cellular metabolic process | 29 | 0.0242 |
GO:0044249 ~ cellular biosynthetic process | 15 | 0.0345 |
GO:0048878 ~ chemical homeostasis | 5 | 0.0423 |
Down-regulated genes | ||
GO:0008152 ~ metabolic process | 66 | <0.0001 |
GO:0044237 ~ cellular metabolic process | 8 | <0.0001 |
GO:0009987 ~ cellular process | 11 | 0.0001 |
GO:0044238 ~ primary metabolic process | 11 | 0.0009 |
GO:0019538 ~ protein metabolic process | 23 | 0.0023 |
Gene expression profiles of CAR and ICAR in contralateral uterine horns
GenBank accession ID | Gene symbol | Gene description | Fold change |
P-value |
---|---|---|---|---|
Up-regulated genes | ||||
NM_001077112 | GSTA3 | Glutathione S-transferase, alpha 3 | 12.7 | 0.0080 |
NM_001014878 | PIPOX | Pipecolic acid oxidase | 8.4 | 0.0261 |
NM_001024569 | ELF5 | E74-like factor 5 (ets domain transcription factor) | 4.3 | 0.0173 |
NM_173981 | ACAN | Aggrecan | 3.0 | 0.0420 |
NM_174404 | NRXN1 | Neurexin 1 | 3.0 | 0.0065 |
NM_001079771 | SMOC1 | SPARC related modular calcium binding 1 | 2.7 | 0.0104 |
NM_001034351 | TNNC1 | Troponin C type 1 (slow) | 2.6 | 0.0142 |
NM_173945 | NTS | Neurotensin | 2.6 | 0.0289 |
NM_001206196 | KLHL24 | Kelch-like 24 (Drosophila) | 2.4 | 0.0345 |
NM_001046585 | CCL14 | Chemokine (C-C motif) ligand 14 | 2.4 | 0.0358 |
Down-regulated genes | ||||
NM_001205648 | SLC39A2 | Solute carrier family 39 (zinc transporter), member 2 | 2.7 | 0.0110 |
XM_002687754 | PLEKHA5 | Pleckstrin homology domain containing, family A member 5 | 2.2 | 0.0181 |
NM_001077962 | STAC | SH3 and cysteine rich domain | 2.0 | 0.0456 |
NM_001098061 | SQLE | Squalene epoxidase | 2.0 | 0.0268 |
NM_174145 | PKP1 | Plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) | 1.9 | 0.0304 |
NM_001098938 | CYP39A1 | Cytochrome P450, family 39, subfamily A, polypeptide 1 | 1.9 | 0.0262 |
NM_174489 | VLDLR | Very low density lipoprotein receptor | 1.9 | 0.0063 |
NM_001034660 | SLC5A11 | Solute carrier family 5 (sodium/glucose cotransporter), member 11 | 1.8 | 0.0061 |
NM_001075803 | FH | Fumarate hydratase | 1.8 | 0.0009 |
NM_001099399 | CMTM3 | CKLF-like MARVEL transmembrane domain containing 3 | 1.8 | 0.0434 |
Term | Count |
P-value |
---|---|---|
Up-regulated genes | ||
GO:0048518 ~ positive regulation of biological process | 25 | <0.0001 |
GO:0048522 ~ positive regulation of cellular process | 22 | <0.0001 |
GO:0009887 ~ organ morphogenesis | 12 | <0.0001 |
GO:0009653 ~ anatomical structure morphogenesis | 16 | 0.0001 |
GO:0048856 ~ anatomical structure development | 24 | 0.0002 |
Down-regulated genes | ||
GO:0045859 ~ regulation of protein kinase activity | 5 | 0.0029 |
GO:0043549 ~ regulation of kinase activity | 5 | 0.0035 |
GO:0051338 ~ regulation of transferase activity | 5 | 0.0040 |
GO:0043436 ~ oxoacid metabolic process | 7 | 0.0075 |
GO:0019752 ~ carboxylic acid metabolic process | 7 | 0.0075 |
GenBank accession ID | Gene symbol | Gene description | Fold change |
P-value |
---|---|---|---|---|
Up-regulated genes | ||||
NM_001014878 | PIPOX | Pipecolic acid oxidase | 8.8 | 0.0156 |
NM_174278 | CNGA1 | Cyclic nucleotide gated channel alpha 1 | 6.8 | 0.0390 |
NM_001033608 | GSTA3 | Glutathione S-transferase, alpha 3 | 6.6 | 0.0340 |
NM_001046400 | MIF | Macrophage migration inhibitory factor (glycosylation-inhibiting factor) | 3.1 | 0.0118 |
NM_001046400 | ZNRD1 | Zinc ribbon domain containing 1 | 2.8 | 0.0400 |
NM_001206196 | KLHL24 | Kelch-like 24 (Drosophila) | 2.6 | 0.0212 |
NM_001076517 | LY6D | Lymphocyte antigen 6 complex, locus D | 2.5 | 0.0414 |
NM_001035473 | GK5 | Glycerol kinase 5 | 2.2 | 0.0210 |
NM_001075890 | KLK10 | Kallikrein-related peptidase 10 | 2.1 | 0.0445 |
NM_001083791 | SH3BGRL2 | SH3 domain binding glutamic acid-rich protein like 2 | 1.9 | 0.0030 |
Down-regulated genes | ||||
XM_002685338 | IFIH1 | Interferon induced with helicase C domain 1 | 4.0 | 0.0485 |
NM_001101195 | KCNA2 | Potassium voltage-gated channel, shaker-related subfamily, member 2 | 3.5 | 0.0204 |
NM_180998 | LTF | Lactotransferrin | 2.9 | 0.0286 |
NM_001076843 | SLC30A3 | Solute carrier family 30 (zinc transporter), member 3 | 2.6 | 0.0289 |
NM_001076494 | C8H8orf13 | Chromosome 8 open reading frame 13 ortholog | 2.5 | 0.0406 |
NM_001105411 | GFRA1 | GDNF family receptor alpha 1 | 2.5 | 0.0383 |
NM_174018 | CFTR | Cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) | 2.5 | 0.0316 |
NM_001077941 | MARCH3 | Membrane-associated ring finger (C3HC4) 3 | 2.5 | 0.0158 |
NM_173959 | SCD | Stearoyl-CoA desaturase (delta-9-desaturase) | 2.0 | 0.0096 |
NM_174602 | SLC2A1 | Solute carrier family 2 (facilitated glucose transporter), member 1 | 1.9 | 0.0057 |
Term | Count |
P-value |
---|---|---|
Up-regulated genes | ||
GO:0010467 ~ gene expression | 17 | 0.0004 |
GO:0080090 ~ regulation of primary metabolic process | 19 | 0.0013 |
GO:0060255 ~ regulation of macromolecule metabolic process | 19 | 0.0015 |
GO:0008152 ~ metabolic process | 38 | 0.0033 |
GO:0019222 ~ regulation of metabolic process | 19 | 0.0040 |
Down-regulated genes | ||
GO:0044238 ~ primary metabolic process | 34 | 0.0023 |
GO:0006810 ~ transport | 17 | 0.0025 |
GO:0051234 ~ establishment of localization | 17 | 0.0026 |
GO:0051179 ~ localization | 18 | 0.0027 |
GO:0008152 ~ metabolic process | 35 | 0.0028 |
Gene expression profiles of whole uterus
GenBank accession ID | Gene symbol | Gene description | Fold change |
P-value |
---|---|---|---|---|
Up-regulated genes | ||||
NM_174690 | PRSS2 | Protease, serine, 2 (trypsin 2) | 12.3 | 0.0018 |
NM_001077112 | GSTA3 | Glutathione S-transferase, alpha 3 | 6.7 | 0.0002 |
NM_001014878 | PIPOX | Pipecolic acid oxidase | 6.4 | <0.0001 |
NM_174278 | CNGA1 | Cyclic nucleotide gated channel alpha 1 | 4.3 | 0.0024 |
S82409 | IGG1C | IgG1 heavy chain constant region | 3.7 | 0.0081 |
BC112657 | Vl1a | Immunoglobulin lambda light chain variable region | 3.7 | 0.0076 |
S82407 | IgCgamma | IgG2a heavy chain constant region | 3.4 | 0.0347 |
NM_001025346 | DAPL1 | death associated protein-like 1 | 3.4 | 0.0075 |
NM_001080353 | PI3 | Peptidase inhibitor 3, skin-derived (SKALP) | 3.2 | 0.0022 |
NM_001166616 | C5 | Complement component 5 | 2.8 | 0.0044 |
NM_001024569 | ELF5 | E74-like factor 5 (ets domain transcription factor) | 2.8 | 0.0047 |
NM_001075910 | CCDC113 | Coiled-coil domain containing 113 | 2.7 | 0.0432 |
NM_173945 | NTS | Neurotensin | 2.6 | <0.0001 |
NM_001034351 | TNNC1 | Troponin C type 1 (slow) | 2.5 | 0.0004 |
NM_001206196 | KLHL24 | Kelch-like 24 (Drosophila) | 2.5 | <0.0001 |
NM_001046400 | ZNRD1 | zinc ribbon domain containing 1 | 2.3 | <0.0001 |
NM_001193109 | SDCCAG8 | Serologically defined colon cancer antigen 8 | 2.2 | 0.0001 |
NM_174010 | CD36 | CD36 molecule (thrombospondin receptor) | 2.2 | 0.0073 |
XM_588022 | SPOPL | Speckle-type POZ protein-like | 2.2 | <0.0001 |
NM_173880 | H4 | Histone H4 | 2.1 | 0.0033 |
NM_001098155 | ZNF322A | Zinc finger protein 322A | 2.1 | 0.0005 |
NM_001035380 | GC | Group-specific component (vitamin D binding protein) | 2.0 | 0.0269 |
NM_001035473 | GK5 | Glycerol kinase 5 | 2.0 | 0.0003 |
Down-regulated genes | ||||
NM_181005 | CHGA | Chromogranin A (parathyroid secretory protein 1) | 3.9 | 0.0005 |
NM_001076073 | KRT35 | Keratin 35 | 3.3 | 0.0011 |
NM_001034728 | THBS4 | Thrombospondin 4 | 3.2 | <0.0001 |
NM_001206057 | CPXM2 | Carboxypeptidase X (M14 family), member 2 | 3.1 | <0.0001 |
NM_001143735 | PRF1 | Perforin 1 (pore forming protein) | 3.0 | 0.0090 |
NM_001002763 | CDH1 | Cadherin 1, type 1, E-cadherin (epithelial) | 2.9 | 0.0097 |
NM_176851 | FUT5 | Fucosyltransferase 5 (alpha (1,3) fucosyltransferase) | 2.7 | 0.0038 |
XM_002685338 | IFIH1 | Interferon induced with helicase C domain 1 | 2.5 | 0.0040 |
NM_001081734 | MOCS3 | Molybdenum cofactor synthesis 3 | 2.5 | 0.0465 |
NM_174039 | DPP4 | Dipeptidyl-peptidase 4 | 2.4 | 0.0158 |
NM_001102080 | CSNK1D | Casein kinase 1, delta | 2.3 | 0.0144 |
NM_001102060 | TBC1D10C | TBC1 domain family, member 10C | 2.3 | 0.0391 |
NM_001081539 | C11H2orf49 | Chromosome 11 open reading frame, human C2orf49 | 2.3 | 0.0354 |
AF068848 | VpreB | Surrogate light chain | 2.3 | 0.0204 |
NM_001127317 | MIC1 | Major histocompatibility class I related protein | 2.2 | 0.0135 |
NM_205801 | CLDN3 | Claudin 3 | 2.2 | 0.0196 |
NM_001077887 | CLASRP | CLK4-associating serine/arginine rich protein | 2.2 | 0.0245 |
NM_174513 | ADAP1 | ArfGAP with dual PH domains 1 | 2.1 | 0.0169 |
NM_001105478 | SSLP1 | Secreted seminal-vesicle Ly-6 protein 1 | 2.1 | 0.0004 |
NM_001077962 | STAC | SH3 and cysteine rich domain | 2.1 | <0.0001 |
XM_002687754 | PLEKHA5 | Pleckstrin homology domain containing, family A member 5 | 2.1 | 0.0003 |
NM_001101239 | GRP | Gastrin-releasing peptide | 2.1 | 0.0059 |
NM_001205648 | SLC39A2 | Solute carrier family 39 (zinc transporter), member 2 | 2.0 | 0.0001 |