Background
Esophageal squamous cell carcinoma (ESCC) is the most common esophageal cancer and also the most leading cause of cancer-related death worldwide [
1,
2]. Nowadays, the incidence and mortality rate of ESCC were increased rapidly in China, with three times in men than women [
3,
4]. Although the treatment and therapy of ESCC have been improved by surgical resection and radiochemotherapy, its prognosis remains not satisfying [
5‐
8]. Therefore, fully understanding the exact molecular mechanism in ESCC progression is urgent for researchers to develop diagnostic and therapy strategies for ESCC.
MicroRNA (miRNA) is a class of small, evolutionary conserved RNA molecules that suppresses gene expression at the post-transcriptional level [
9,
10]. Our understanding on the mechanism that negatively regulated gene expression was broadened by the discovery of these small non-coding transcripts, which added an entirely novel field of regulatory mechanism of cellular function. MiRNAs act by base-pairing with their target mRNAs through complementarity at the 3′ untranslated regions (UTRs) of the target mRNAs [
9,
10]. This results in repression or direct cleavage of their translations [
9,
10]. However, in some cases, mRNA translation was enhanced by miRNAs. For example, miR-10a could bind the 5′-UTR of mRNAs of ribosomal protein enhancing their translation [
11,
12]. Moreover, some miRNAs could switch their roles from translation repression to promotion in a cell cycle-dependent manner. It was reported a number of miRNAs play important roles in cell proliferation, apoptosis, and differentiation, so as to involve in normal physiological and pathological conditions [
9,
13]. miRNAs also contributed to oncogenesis by suppressing tumor suppressor genes or by promoting the expression of oncogenes. Thus, some miRNAs were identified as cancer diagnostic and prognosic makers [
9].
MiRNA-21 is one of the miRNAs to be identified as transcribed by RNA polymerase II. MiR-21 has been identified as a major driver of miRNA transcription [
14,
15]. The gene coding for pri-miR-21 is located within the intronic region of the TMEM49 gene. Despite pri-miR-21 and TMEM49 are overlapping genes in the same direction of transcription, pri-miR-21 is independently transcribed by its own promoter regions and terminated with its own poly (A) tail. After transcription, pri-miR-21 is finally processed into mature miR-21 [
16]. It was demonstrated that miR-21 overexpressed in multiple malignancies, including renal carcinoma, breast cancer, ovarian cancer, non-small cell lung cancer, gastric cancer, colon cancer, and esophageal cancer [
17‐
23]. MiR-21 functioned as an oncogene and associated with tumor aggression and carcinogenesis, which in partly mediated by preventing apoptosis [
24,
25]. In the present study, we examined the expression of miR-21 in ESCC and investigated its effects on radiation-sensitivity of ESCC. The results indicated that miR-21 was overexpressed in ESCC, and the downregulation of miR-21 could suppress the radiation-resistance of ESCC.
Materials and methods
Patients and specimens
Sixty-three paired ESCC tissues and adjacent non-tumoral tissues were collected from patients who were diagnosed as ESCC at Sichuan Cancer Hospital & Institute, and Sichuan Cancer Center, School of Medicine, University of Electronic Science and Technology of China. Primary tumor regions and corresponding histologically non-tumoral tissues (within 2 cm far from the tumor) from the same patients were separated by experienced pathologists, and immediately stored in liquid nitrogen (− 193 °C) until use. Before surgical resection preoperative, none subjects have received treatments of ESCC such as chemotherapy or radiotherapy. All patients were signed informed consent forms before sample collection. A comprehensive set of clinicopathological data including age, gender, size of primary tumor, tumor differentiation and TNM stage were recorded, which are summarized in Table
1. The stage of disease was determined according to the clinical TNM classification system. Use of patient samples was approved by the ethics committee of our Institute.
Table 1
Relationship between miR-21 level and clinicopathologic characteristics in ESCC patients
Age |
≥ 60 | 45 | 11 | 28 | 0.213 |
< 60 | 18 | 9 | 15 |
Gender |
Male | 34 | 12 | 22 | 0.303 |
Female | 29 | 8 | 21 |
Size of primary tumor |
< 5 cm | 29 | 9 | 20 | 0.538 |
≥ 5 cm | 34 | 11 | 23 |
Tumor differentiation |
Highly differentiated | 26 | 7 | 19 | 0.472 |
Moderately differentiated | 26 | 7 | 19 |
Low differentiated | 11 | 6 | 5 |
TNM stages |
I + II | 29 | 16 | 13 | 0.004 |
III + IV | 34 | 4 | 30 |
Cell culture and ionizing radiation
The human ESCC cell lines TE-1, EC1 and KYSE140 were purchased from the Chinese Academy of Sciences, Shanghai, China. Cells were cultured in RPMI 1640 media supplemented with 10% fetal bovine serum (HyClone, USA), 100 U/ml penicillin and 100 µg/ml streptomycin, and maintained at 37 °C in 5% CO2. All experimental cells were in the logarithmic growth phase. Cells were exposed to the indicated dose of irradiation in a JL Shepherd Model 143 137Cesium γ-irradiated at a rate of 2.4 Gy/min.
RNA isolation and quantitative real-time PCR (qRT-PCR)
Total RNAs were isolated from 63 pairs ESCC tumor and adjacent non-tumoral tissues, and ESCC cells with or without irradiation using the Absolutely RNA™ RT-PCR Miniprep Kit (Stratagene, China). For reverse transcription (RT) reactions, 10 ng total RNA was used in each reaction (5 μl) and mixed with RT primer (3 μl). For qRT-PCR, expression of mature miR-21 was detected using TaqMan miRNA assays (ABI PRISM) with the stem-loop method. PCR was conducted by ABI 7500 Real-time PCR system (ABI, USA). The primers used in this study were listed: miR-21-5p: UAGCUUAUCAGACUGAUGUUGA, miR-21-5p RT: CTCAACTGGTGTCGTGGAGTC GGCAATTCAGTTGAGTCAACATC, miR-21-5p F: ACACTCCAGCTGGGTAGCTTATCAG ACTGATG, All R: CTCAACTGGTGTCGTGGA, U6 F: CTCGCTTCGGCAGCACA, U6 R: AACGCTTCACGAATTTGCGT. U6 was used for normalization. Relative expression levels were calculated using the 2−ΔΔCt method.
MiRNA mimics or inhibitors transfection
MiR-21 inhibitors or mimics vector was constructed. A scrambled sequence without significant homology to any rat, mouse or human gene was used as a negative control (NC group). Transfection was performed using Lipofectamine™ 2000 (Invitrogen, USA) according to the manufacturer’s manual. After transfection 48 h, miR-21 expression was assessed by qRT-PCR.
Cell proliferation assay
After transfection 48 h, the effects of miR-21 expression on TE-1 cell proliferation were assessed using the Cell Counting Kit-8 (CCK-8, Beyotime, China). The cells were plated in 96-well plates and irradiated with 6 Gy γ-ray. After 1, 2, 3, and 4 days, CCK-8 (10 μl) was added and incubated at 37 °C for 1.5 h, respectively. Finally, cell viability were measured using a microplate reader at 450 nm.
Cell apoptosis and cell cycle
Cell cycle and apoptosis were detected using flow cytometry. Cells were harvested after irradiation of 6 Gy for 8 h. Briefly, cell monolayers were washed with PBS, trypsinzed and resuspended in ice-cold PBS. Cells were fixed in 70% ethanol and incubated with propidium iodide (PI) staining solution for 30 min in the dark. The fluorescence was measured using a Flow Cytometer (BD, USA) and cell cycle distribution was analyzed. For apoptosis detection, the annexin V-FITC apoptosis detection kit (BD, USA) was used according to the manufacturer’s instructions.
Western blot
The western blot was performed for protein detection. Total proteins were extracted, separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to the PVDF. The blot was incubated with primary antibody against cleaved-PARP and cleaved-caspase 3 (1:1000, Cell Signaling Technology, USA) overnight at 4 °C, and incubated with HRP-conjugated secondary antibody for 1 h. GAPDH antibody was used as control. Finally, ECL was used to visual the blots.
Statistical analyses
The data was presented as mean ± standard deviation (SD). All statistical analyses were performed using SPSS software 15.0 (SPSS, USA) in at least three independent experiments. Two-tailed Student’s t test or One-way ANOVA was used to analysis the differences among the groups. P < 0.05 was considered as statistical significance.
Discussion
Studies have demonstrated that miRNAs levels are related to clinical and biological characteristics of tumors [
14,
16]. The miRNAs have potential diagnostic value. MiRNAs play important roles in cancer progression [
9]. For example, miR-21 is an oncogenic miRNA. Overexpression of miRNA-21 promoted the development and progression of various cancers. MiR-21 level was significantly elevated in both tissue and serum samples of esophageal cancer patients [
27]. It was demonstrated that overexpression of miR-21 was an independent negative prognostic factor for overall survival in ESCC patients [
26,
27]. MiR-21 had higher expression in esophageal cancer tissues with lymph node metastasis and poor differentiation [
26]. Metastasis is the most deadly and least understood aspect of cancer [
28]. In the present study, although we did not detect metastasis, we found that the miR-21 levels were significantly higher in ESCC tumor tissues and existed a significant association with TNM stage, indicating patients with high miR-21 expression level was significantly correlated with advanced TNM stage in ESCC patients. It was suggested that miR-21 might be a useful diagnostic and prognostic marker in ESCC patients.
Although many studies have explored the role of miR-21 in cancer, only few reports studied the relationship between miR-21 expression and radiation-sensitivity of cancer. Yu et al. [
29] detected the plasma miRNAs that associated with carcinogenesis or radiobiology of ESCC. They found miR-21 expression was significantly inhibited in radiotherapy sensitive patients. It was reported that miR-21 was the only one that increased sixfolds in high-low linear energy transfer radiation promoted mouse liver tumors, compared with that in the nonirradiated liver tissues [
30]. MiR-21 was overexpression in human or mouse hepatocytes after exposure to radiation, as well as in liver tissues derived from whole body irradiated mice [
30]. Thus, miR-21 may play a role in the radiation-sensitivity of tumors. In the present study, considering the radiation therapy is one of the most important treatment for ESCC, we examined the effects of miR-21 expression on radiation-sensitivity of ESCC cells. Results showed that miR-21 was significantly increased in ESCC cell lines after irradiation, suggesting miR-21 might contribute in evading cancer therapy. The results showed that under irradiation, downregulation of miR-21 inhibited cell proliferation, promoted cell apoptosis and cell arrest in GO/G1 phase, suggesting downregulation of miR-21 promoted the radiation-sensitivity of TE-1 cells. In contrast, the overexpression of miR-21 had the opposite effects. We did not further explore the potential mechanism. But it had shown miR-21 had the ability to suppress the expression of the tumor suppressor PTEN and PDCD4 [
26,
31]. These mechanisms may also be function in the condition of irradiation. This should be investigated in future. At the molecular level, cleaved-caspase-3 and cleaved-PARP were increased in miR-21 knockdown cells under irradiation. In cultured glioblastoma cells, downregulation of miR-21 triggered activation of caspases leading to increased cell apoptosis [
25]. The findings suggested that dysregulation of miR-21 might associate with development and radiation-resistance of cancer via regulating the cell apoptosis.
Conclusion
In conclusion, our results demonstrated an overexpression of miR-21 in ESCC tumors. Overexpression of miR-21 was strongly associated with advanced TNM stage. In addition, Downregulation of miR-21 inhibited the radiation-resistance. In contrast, overexpression of miR-21 had an opposite effect. Our findings provide a novel role of miR-21 in ESCC, which might suggest a promising novel target for developing the therapy strategies in ESCC.
Authors’ contributions
FL and JHL carried out the molecular biology studies. LL carried out the cell biology studies. JCW, CRL and LS collected the samples. TL designed this study. All authors read and approved the final manuscript.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.