Zum Inhalt

Early peripheral blood gene expression (Cyp4A11 and Cyp2E1) in cases of brain ischemia in addict cases admitted to Benha university hospital

  • Open Access
  • 01.12.2024
  • Research
Erschienen in:

Abstract

Background

Stroke is a major neurological disorder often exacerbated by substance abuse, including tramadol and cannabis. Understanding the molecular mechanisms underlying stroke pathogenesis in drug users can improve diagnosis and treatment. This study explores the roles of CYP4A11, CYP2E1, miR-27b, and miR-214-3p in the pathogenesis of stroke and their potential as diagnostic markers in individuals using tramadol and cannabis.

Results

Our findings indicate that CYP4A11 and CYP2E1 are significantly upregulated in the brain tissues of stroke patients who use tramadol and cannabis. Additionally, miR-27b and miR-214-3p levels were markedly altered, suggesting their involvement in stroke pathogenesis. The combined analysis of these biomarkers provided a robust diagnostic model with high sensitivity and specificity for identifying stroke in the context of drug addiction.

Conclusions

CYP4A11, CYP2E1, miR-27b, and miR-214-3p play critical roles in the pathogenesis of stroke in tramadol and cannabis users. These biomarkers hold promise as diagnostic tools, offering potential for early detection and personalized treatment strategies for stroke in drug-addicted populations. Further research is warranted to validate these findings and explore their therapeutic implications.
The original online version of this article was revised: the original publication mistakenly contained anonymized content.
The actual work was done at the Neurology and Psychiatry Department, Benha University Hospital, and the Medical Biochemistry and Molecular Biology Department, Faculty of Medicine, Benha University.
A correction to this article is available online at https://doi.org/10.1186/s41983-025-00932-1.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
SUD
Substance Use Disorder
CYP4A11
Cytochrome P450 4A11
CYP2E1
Cytochrome P450 2E1
miRNA
MicroRNA
miR-27b
MicroRNA-27b
miR-214-3p
MicroRNA-214-3p
FDCTA
Fund for Drug Control and Treatment of Addiction
20-HETE
20-Hydroxyeicosatetraenoic Acid
TNF
Tumor Necrosis Factor
IL1
Interleukin 1
PTEN
Phosphatase and Tensin Homolog deleted on chromosome 10
AMPK
AMP-activated Protein Kinase
CT
Computed Tomography
MRI
Magnetic Resonance Imaging
MRA
Magnetic Resonance Angiography
DWI
Diffusion Weighted Imaging
MCA
Middle cerebral artery
AST
Aspartate Aminotransferase
ALT
Alanine Aminotransferase
RT–qPCR
Real-Time Quantitative Reverse Transcription–Polymerase Chain Reaction
cDNA
Complementary DNA
SPSS
Statistical Package for the Social Sciences
ROC
Receiver Operating Characteristic
AUC
Area Under the Curve
MCAO
Middle Cerebral Artery Occlusion
SOD
Superoxide Dismutase
Hypo-Exo
Exosomes derived from mesenchymal stem cells cultivated under hypoxic conditions
CAD
Coronary Artery Disease
GAPDH
Glyceraldehyde-3-Phosphate Dehydrogenase
IQR
Interquartile Range
CI
Confidence Interval
ECG
Electrocardiography
ECHO
Echocardiogram
ESUS
Embolic stroke of undetermined source
TEE
Transesophageal ECHO
TCD
Transcranial Doppler
ICA
Internal Carotid Artery

Background

Substance abuse has been implicated in the aetiology of both ischemic and haemorrhagic strokes. A multitude of underlying mechanisms have been delineated, including the induction of arrhythmias and cardioembolic events, tissue hypoxia, direct vascular toxicity, inducement of vascular spasm, and disruptions in the thrombotic pathways contributing to the onset of ischemic strokes. Conversely, haemorrhagic strokes have been associated with the emergent presentation of acute hypertension, the development and rupture of aneurysms, and pathological changes reminiscent of angiitis [1].
In the Egyptian context, irrespective of the sequence of consumption, cannabis and tramadol are predominant among the substances utilized, as reported by the Fund for Drug Control and Treatment of Addiction (FDCTA). Ischemic strokes may arise from transient vasospasms attributed to synthetic cannabinoids, as noted by Abdel-Salam and colleagues (2017). Furthermore, there is an associated risk of precipitated aneurysmal rupture linked to tramadol abuse [2].
Correspondingly, drugs abusers have a 6.5 times increased risk of both hemorrhagic and ischemic stroke. In addition, while current treatment for ischemic stroke includes thrombolysis and mechanical thrombectomy, drug users may be at increased risk of complications such as iatrogenic vasospasm and hemorrhagic reperfusion injury following these therapies as a consequence of the damaging physiological changes on blood vessels provoked by substances of abuse [3, 4]. Yet, no difference in stroke management guidelines exists for ischemic stroke in the setting of drug abuse.
CYP4A11, an enzyme within the Cytochrome P450 superfamily, plays a pivotal role in synthesizing 20-hydroxyeicosatetraenoic acid (20-HETE), a compound with significant influence on vascular functionalities and the regulation of arterial tension [5]. The alteration of 20-HETE production causes decreased activation of peroxisome proliferator-activated receptor alpha, increased expression of proinflammatory cytokines such as TNF and IL1, and results in vascular inflammation and endothelial dysfunction [6].
Oxidative stress arises from a dysregulation between the generation of free radicals and the counteracting antioxidant mechanisms, serving as a pivotal pathological process in secondary brain damage subsequent to cerebral ischemia [7]. Elevated expression of CYP2E1 has been associated with hypoxic conditions and inflammatory responses. Research suggests that CYP2E1 plays a crucial role in mediating oxidative stress and inflammation subsequent to ischemic events [8].
MicroRNA-214-3p could be instrumental in neuroprotective mechanisms post-ischemia through its interaction with Phosphatase and Tensin Homolog (PTEN) deleted on chromosome 10. Enhanced expression of PTEN within the central ischemic zone may lead to augmented cellular demise and intensify the severity of ischemic damage [9].
Research indicates that AMP-activated protein kinase (AMPK) functions as a sensor for cellular energy levels and may mitigate cerebral ischemic damage by activating catabolic pathways while concurrently inhibiting ATP-consuming processes [10]. The impact of miR-27b on neurogenesis following ischemic stroke remains incompletely elucidated. While limited research has referenced the direct influence of miR-27b on AMPKα2, this is identified as the principal active AMPK isoform within the ischemic cerebral context [11].
This study explores the roles of CYP4A11, CYP2E1, miR-27b, and miR-214-3p in the pathogenesis of stroke and their potential as diagnostic markers in individuals using tramadol and cannabis.

Methods

Study design and population This case–control investigation was executed within the Neurology and Psychiatry Department at Benha University Hospital, alongside the Medical Biochemistry and Molecular Biology Departments at the Faculty of Medicine, Benha University. One hundred forty-seven participants were recruited from the Neurology and Psychiatry Department between June 2023 and June 2024, comprising 87 addict patients (with age 47.54 ± 9.36 years) presenting with stroke and 87 controls (with age 44.84 ± 11.27 years), the control group was sub divided into 37 healthy controls to analyze the relative changes in gene expression from real-time quantitative PCR experiments according to [12] and 50 patients presenting with stroke with no history of drug addiction in order to clarify the additive effect of addiction in stroke pathogenesis. The addict patients were diagnosed to have a dependence syndrome of cannabinoids and tramadol according to DSM 5 criteria for dependence syndrome as they use larger amounts over a longer period than was intended. There is a persistent desire and unsuccessful efforts to cut down or control cannabis and tramadol use. Other substances infrequently used by patients include cocaine, amphetamine and clonazepam.
Ethical Considerations The study was conducted in accordance with the guidelines of the Helsinki Declaration. Approval for this study was obtained from the Research Ethics Committee. All participants provided informed consent before blood sample collection, adhering to ethical standards for human research. For patients unable to give consent, written consents were taken from their relatives. The consent included information about the aim of the work, study design, site and time of the study, subjects involved, tools used, and confidentiality.
Participants The study group included 87 patients presenting with stroke, all above 18 years old, with a history of drug addiction (tramadol, cannabis, or other substances). We excluded patients presenting with stroke related to head trauma as cases of brain infarction resulting from cerebral vasospasm complicating traumatic subarachnoid hemorrhage or associated with hypertension, diabetes mellitus (DM), or heart diseases (confirmed by history & investigations as ECG & ECHO).
All patients were subjected to the following Medical history Taken from the patient if conscious, or from the patient's relatives if unconscious. This included the duration of addiction and a history of other stroke risk factors (hypertension, diabetes, heart diseases). General and neurological examination Upon initial evaluation, comprehensive diagnostic imaging was performed for all patients, encompassing both brain computed tomography (by Toshiba Alixon 2013 CT) and magnetic resonance imaging (MRI and MRA by Simens, 1.5 T, Germany MRI). Laboratory investigations included liver function tests (AST, ALT, albumin, bilirubin), kidney function tests (urea, creatinine, uric acid), plasma glucose, drug screening, and genetic analysis. Drug screening test Performed using the Multi-Drug Rapid Test Panel (Urine) according to the manufacturer's instructions (Med Net, GmbH, Germany, Number: 145034113). Patients were classified as tramadol, cannabis, and multi-drug abuse addicts (tramadol, cannabis, cocaine, morphine) based on history and drug screening tests, with the duration of addiction being recorded. Genetic study Included assessment of the expression of CYP4A11, CYP2E1 genes, miR-214-3p, and miR-27b. Two ml venous blood samples were collected in vacutainer tubes and stored at − 80 °C until handling. Total RNA was isolated using the RNeasy Mini Kit (QIAGEN, USA) according to the manufacturer’s instructions. Gene expression levels of CYP4A11, CYP2E1, miR-214-3p, and miR-27b were determined using Real-Time Quantitative Reverse Transcription–Polymerase Chain Reaction (RT–qPCR). The Total RNA purification kit (Cat No. PP-210S, Jena Bioscience, Germany) was used to extract total RNA from blood samples. Reverse transcription (RT) of RNA into complementary DNA (cDNA) was performed on a Veriti™ Thermal Cycler (Applied Biosystems). The qRT-PCR for detecting CYP4A11, CYP2E1, miR-214-3p, and miR-27b was conducted using Maxima SYBR Green qPCR Master Mix (2X) (Thermo Scientific, USA) as per the manufacturer's instructions [13], with the GAPDH gene used as the endogenous reference gene (Table 1).
Table 1
The CYP4A11, CYP2E1 genes, miR-214-3p and miR-27b GAPDH primers
Gene
Forward primer
Reverse primer
CYP4A11
5′-CTCAACACAGCCACGCT TTC-3
5′-ACAAGT CGTGCAATGGGGAT-3′
CYp2E1
5′-GCCATCAAG GATAGGCAAGA-3′
5′-TCCAGAGTTGGCACT ACGACT-3′
miR-214-3p
F: 5′-GCACAGCAGGCACAGACA-3′
5′-CAGAGCAGGGTCAGCGGTA-3′
miR-27b
5′GGCAAGCGCACCGAAGA3′
5′AGTGCAGGGTCCGAGGTATT3′
GAPDH
5′-GCA CCA CAC CTT CTA CAA TG3′
5′- TGC TTG CTG ATC CAC ATC TG3
CYP: Cytochromes P450, miR: microRNA, GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase
The PCR reaction mix, prepared in a total volume of 20 µL per well, included 10 µL Maxima SYBR Green qPCR Master Mix (2X), 1 µL Forward Primer, 1 µL Reverse Primer, 4 µL cDNA, and nuclease-free water up to 20 µL. The amplification process was done using a StepOne Real-Time Cycler developed by Applied Biosystems in Singapore. After an initial holding phase of 3 min at 95 °C, the samples underwent a series of 40 cycles of denaturation for 15 s at 95 °C, annealing at 58 °C, and extension for one minute at 60 °C. The 2−ΔΔCt method was used to calculate the relative expression of CD70 and CXCL10 mRNA [12].
Data Analysis Statistical Package for the Social Sciences (SPSS) version 28 was employed to conduct data analysis. The absolute frequencies of categorical variables were recorded and contrasted using the chi-square test and Fisher's exact test, as appropriate. To verify parametric test assumptions, the Kolmogorov–Smirnov test was implemented. With respect to the nature of the data, quantitative variables were described using their median and interquartile range or their means and standard deviations. Independent sample t-tests (for normally distributed data) and Mann–Whitney tests (for not normally distributed data) were implemented to evaluate quantitative data between two groups. The Spearman rank correlation coefficient was employed to evaluate the magnitude and orientation of the association between two variables. ROC curves facilitated the identification of optimal thresholds for specific quantitative measures in the diagnosis of certain health conditions. Binary logistic regression analysis was utilized to pinpoint independent predictors related to specific health issues. Statistical significance was established at a threshold of P < 0.05, with distinctions deemed highly significant at P ≤ 0.001.

Results

We recruited 87 cases presented with cerebral infarction as a complication of drug addiction. The mean age was 47.54 ± 9.36 years, ranging from 25 to 65 years. There were 83 males and 4 females. Of the cases, 40 had a history of tramadol addiction (46%), 28 had a history of cannabis addiction (32.1%), and 19 cases (21.8%) had multiple drug addictions. The mean duration of addiction was 9.51 ± 3.36 years. Regarding the size of the infarction, 24.1% of patients had small infarctions, 46% had moderate infarctions, and 29.9% had large infarctions.
Brain imaging showed the following distribution of infarction locations: 23% of cases had isolated temporal lobe infarction, 18.4% had basal ganglia infarction, 11.5% had dual temporal and frontal lobe infarction, 10.3% had dual temporal and parietal lobe infarction, 9.2% had brainstem infarction, 8% had occipital lobe infarction, 8% had thalamic lobe infarction, 6.9% had frontal lobe infarction, 2.3% had occipital lobe infarction, 1.1% had infarction in the frontal, temporal, and parietal lobes, and 1.1% had infarction in the thalamic and basal ganglia regions (Table 2).
Table 2
Comparison between the studied groups regarding baseline data
 
Case group n = 87 (%)
Control group n = 87 (%)
χ2
p
Sex
 Female
4 (4.6%)
6 (6.9%)
  
 Male
83 (95.4%)
81 (93.1%)
Fisher
0.747
Age (year) [mean ± SD]
47.54 ± 9.36
44.84 ± 11.27
t (1.179)
0.087
Substance abuse
 Cannabis
28 (32.1%)
   
 Tramadol
40 (46%)
  
 Multiple substances
19 (21.8%)
   
Duration of addiction [mean ± SD]
9.51 ± 3.36
  
Size of infarct
 Small
21 (24.1%)
   
 Moderate
40 (46%)
  
 Large
26 (29.9%)
   
MRI findings
 Temporal lobe
20 (23%)
   
 Basal ganglia
16 (18.4%)
   
 Frontal lobe
6 (6.9%)
   
 Occipital
2 (2.3%)
   
 Parietal
7 (8%)
   
 Temporal, parietal
9 (10.3%)
  
 Temporal, frontal
10 (11.5%)
   
 Thalamic
7 (8%)
   
 Brainstem
8 (9.2%)
   
 Frontal, temporal, parietal
1 (1.1%)
   
 Thalamic, basal ganglia
1 (1.1%)
   
χ2: Chi square test, t independent sample t test
There was a statistically significant difference between both groups regarding CYP4A11 and miR-214-3p, where both showed downgrading among the case group, and CYP2E1 and miR-27b, which showed upgrading among the case group (Table 3 and Figs. 1, 2, 3, and 4).
Table 3
Comparison between the studied groups regarding CUP4A11, CYP2E1, miR 214 and miR 27b
 
Case group n = 87
Control group n = 87
Z
p
Median (IQR)
Median (IQR)
CYP4A11
0.03 (0.02–0.06)
1.01 (0.51–2.61)
 − 11.414
 < 0.001**
CYP2E1
1.34 (0.78–2.69)
0.38 (0.12–1.52)
 − 5.483
 < 0.001**
miR-214-3p
0.03 (0.02–0.06)
0.76 (0.39–2.07)
 − 11.427
 < 0.001**
miR 27b
91.29 (42–114.75)
0.96 (0.61–1.13)
 − 11.399
 < 0.001**
Z Mann Whitney test, IQR Interquartile range, **p ≤ 0.001 is statistically highly significant
Fig. 1
Boxplot showing comparison between groups regarding CYP4A11
Bild vergrößern
Fig. 2
Boxplot showing comparison between groups regarding CYp2E1
Bild vergrößern
Fig. 3
Boxplot showing comparison between groups regarding hsa-miR-214-3p
Bild vergrößern
Fig. 4
Boxplot showing comparison between groups regarding hsa-miR-27b
Bild vergrößern
There was a statistically non-significant correlation between the size of the infarction and the expression of CYP4A11, CYP2E1, miR-214-3p, or miR-27b. Similarly, there was a statistically non-significant correlation between the duration of addiction and the expression of CYP4A11, CYP2E1, miR-214-3p, or miR-27b (Table 4).
Table 4
Correlation between size of infarction, duration of addiction and gene expression levels
 
Size of infarction
Duration of addiction
r
p
r
p
CYP4A11
 − 0.015
0.89
0.075
0.491
CYp2E1
0.103
0.341
0.069
0.528
hsa-miR-214-3p
0.03
0.786
0.164
0.132
miR-27b
 − 0.048
0.661
0.011
0.919
r Spearman rank correlation coefficient
At a cutoff of ≤ 0.21, CYP4A11 can diagnose stroke with an area under the curve (AUC) of 1, 98.9% sensitivity, and 90.9% specificity. At a cutoff of ≥ 0.455, CYP2E1 can diagnose stroke with an AUC of 0.741, 90.8% sensitivity, and 55.2% specificity. At a cutoff of ≤ 0.215, miR-214-3p can diagnose stroke with an AUC of 1, 97.7% sensitivity, and 100% specificity. At a cutoff of ≥ 7.245, miR-27b can diagnose stroke with an AUC of 1, 100% sensitivity, and 97.7% specificity (Table 5, Figs. 5, 6, 7 and 8).
Table 5
Performance of CYP4A11, CYP2E1, miR 214 and miR-27b in diagnosis of stroke
 
Cutoff
AUC
95% CI
Sensitivity (%)
Specificity (%)
p
CYP4A11
 ≤ 0.21
1
1–1
98.9
90.9
 < 0.001**
CYp2E1
 ≥ 0.455
0.741
0.665–0.816
90.8
55.2
 < 0.001**
hsa-miR-214-3p
 ≤ 0.215
1
1–1
97.7
100
 < 0.001**
miR-27b
 ≥ 7.245
1
1–1
100
97.7
 < 0.001**
AUC area under curve, **p ≤ 0.001 is statistically highly significant
Fig. 5
ROC curve showing performance of CYP411A in diagnosis of stroke
Bild vergrößern
Fig. 6
ROC curve showing performance of CYP2E1 in diagnosis of stroke
Bild vergrößern
Fig. 7
ROC curve showing performance of hsa-miR-214-3p in diagnosis of stroke
Bild vergrößern
Fig. 8
ROC curve showing performance of miR-27b in diagnosis of stroke
Bild vergrößern

Discussion

Substance use disorder (SUD), identified as a risk factor for stroke, and poses an escalating global risk particularly among young adults. Prevention strategies are considered primary interventions (Schulte & Hser, 2014). In Egypt, the proliferation of substance abuse constitutes a significant public health challenge, with tramadol noted as one of the substances most frequently misused [14] (Fig. 9).
Fig. 9
MRI and MRA show bilateral parietal lobe infarctions in the distribution of the MCA. Diffusion_weighted axial image: A of the brain MRI showed acute infarcts in both parietal lobes, B MRA showed vasospasm of the right internal carotid artery and complete occlusion of the left internal carotid artery
Bild vergrößern
Numerous genes have been implicated in the pathogenesis of stroke, yet only a select few have been definitively proven to affect susceptibility. Furthermore, considerable research has been directed towards understanding the role of microRNAs (miRNAs) in stroke, given their expression levels are correlated with the prognosis of this ailment [15].
The objective of this study was to clarify the potential significance of genetic factors (CYP4A11 and CYP2E1) in the diagnosis of stroke and to assess the association between miRNA (miR-214-3p and miR-27b) expression and stroke occurrence.
According to our results, tramadol was the most commonly abused drug. This finding was also reported by Rizk and colleagues [16], who mentioned that tramadol addiction was observed in 53.7% of their patients.
The current investigation reveals that lesions may manifest across all cerebral regions, corroborating the observations made by Tsatsakis and colleagues [1], who noted that strokes attributable to drug abuse may arise in any area of the brain. Conversely, Middlekauff and colleagues [17] identified that cannabis-induced multifocal intracranial stenosis predominantly affects the posterior circulation.
There was a statistically significant difference between both groups regarding CYP4A11 and hsa-miR-214-3p expression. CYP4A11 expression was downregulated with a highly significant difference from the control group, showing a diagnostic value with an area under the curve (AUC) of 1, 98.9% sensitivity, and 90.9% specificity. This finding agrees with Solodilova and colleagues [18], who mentioned that CYP4A11 could be a novel genetic marker of susceptibility to coronary artery disease (CAD). Sirotina and colleagues [6] also mentioned that the polymorphism rs9332978 of CYP4A11 could be a novel marker of genetic susceptibility to CAD, at least in Europeans.
MicroRNA-214-3p was downregulated with a highly significant difference from the control group, showing a diagnostic value with an AUC of 1, 97.7% sensitivity, and 100% specificity. This is consistent with Ping and colleagues [19], who mentioned that miR-214 inhibits neuronal apoptosis by negatively regulating Bax, consequently attenuating ischemic injury in MCAO mice. These findings may provide a potential therapeutic target for stroke treatment. Shen and colleagues [20] also showed that the injection of miR-214 agomir promoted the expression of SOD and relieved the apoptosis of brain cells. Wu and colleagues [21] reported analogous findings, indicating that the suppression of miR-214-3p negates the pronounced efficacy of Hypo-Exo’s (exosomes sourced from mesenchymal stem cells cultured in hypoxic conditions) in facilitating the recovery process of the ischemic brain.
CYP2E1 was upregulated with a highly significant difference from the control group, showing a diagnostic value with an AUC of 0.741, 90.8% sensitivity, and 55.2% specificity. Yu and colleagues [22] documented that the inhibition of Cytochrome P450 CYP2E1 mitigates damage from cerebral ischemia–reperfusion.
miR-27b was upregulated with a highly significant difference from the control group, showing a diagnostic value with an AUC of 1, 100% sensitivity, and 97.7% specificity. This finding is consistent with the results of Xu and colleagues [23], who determined that the inhibition of miR-27b could diminish neurological deficits by curtailing neuroinflammation and decreasing cellular mortality. This concurs with the observations by Wang and colleagues [11], who reported that inhibiting miR-27b enhances recuperation following ischemic stroke through modulation of AMPK activity.
Our result reveals that there was statistically non-significant correlation between size of infarction and CYP4A11, CYP2E1, hsa-miR-214-3p or miR-27b. This finding is consistent with the results of Ceren E and colleagues [24], who determined that miRNA-target gene networks based on inflammatory response, blood coagulation, platelet activation resulting in large artery stroke, small artery stroke, stroke due to undetermined cause and cardioembolic stroke.
Finally, our study had some limitations, the study focused on a specific set of molecular markers (CYP4A11, CYP2E1, miR-214-3p, and miR-27b). However, other CYP enzymes and miRNAs might also be involved in stroke pathogenesis in addicted patients. Future research should consider a broader range of molecular markers to provide a more comprehensive understanding. Future studies with larger, more diverse populations are needed to validate these results.
Given their potential as biomarkers, research should aim to validate the clinical utility of CYP4A11, CYP2E1, miR-214-3p, and miR-27b in predicting stroke risk among addicted patients. Large-scale cohort studies and clinical trials are needed to assess their predictive value and reliability. Investigating the possibility of targeting these pathways therapeutically could offer new avenues for stroke prevention and treatment in addicted individuals. Pharmacological modulation of CYP enzymes and miRNAs may reduce stroke incidence and improve outcomes in this high-risk group.

Limitations

We acknowledge that there are a number of limitations in this review including.
1.
ESUS work up including Holter ECG, TEE, collagen battery, autoimmune markers and thrombophilia protocol should be done and documented as the mean age of patients according to the study is 47 years.
 
2.
TCD studies should be done for all patients to assess the mean MCA/intracranial ICA diameter to document the vasospasm.
 

Conclusions

Our findings suggest that alterations in the expression levels of CYP4A11, CYP2E1, miR-214-3p, and miR-27b make them candidate biomarkers for stroke risk in addicted patients, providing insights into personalized treatment strategies so prophylactic antiplatelet and anticoagulant therapy can provide protection for these patients. However, the exact mechanisms by which these factors contribute to stroke pathogenesis require further investigation. Understanding these molecular pathways could lead to the development of targeted therapies aimed at mitigating the increased stroke risk in this vulnerable population.

Acknowledgements

Not applicable.

Declarations

The study was approved from the institutional ethical committee, Benha University. After receiving written informed consent from each subject, the study was carried out with their permission after receiving approval from the Institutional Review Board (IRB) of the Benha University Faculty of Medicine (Approval number: RC24-5-2023).
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Download
Titel
Early peripheral blood gene expression (Cyp4A11 and Cyp2E1) in cases of brain ischemia in addict cases admitted to Benha university hospital
Verfasst von
Nashwa E. Ahmed
Amina M. Nagah
Omima R. Mohamed
Ghada Mohamed Mahmoud
Sania K. Elwia
Publikationsdatum
01.12.2024
Verlag
Springer Berlin Heidelberg
DOI
https://doi.org/10.1186/s41983-024-00926-5
1.
Zurück zum Zitat Tsatsakis A, Docea AO, Calina D, Tsarouhas K, Zamfira LM, Mitrut R, et al. A mechanistic and pathophysiological approach for stroke associated with drugs of abuse. J Clin Med. 2019. https://doi.org/10.3390/jcm8091295.CrossRefPubMedPubMedCentral
2.
Zurück zum Zitat Elbassiony A, Khedr EM, Hegazy A, Ragab OA, Al-Shami H, Soliman RK, et al. The frequency and impact of tramadol addiction on acute aneurysmal subarachnoid hemorrhage: cross-sectional multicenter study. Egyptian J Neurol Psychiatry Neurosurg. 2023;59(1):97. https://doi.org/10.1186/s41983-023-00703-w.CrossRef
3.
Zurück zum Zitat Krishnan R, Mays W, Elijovich L. Complications of mechanical thrombectomy in acute ischemic stroke. Neurology. 2021;97:S115–25.CrossRefPubMed
4.
Zurück zum Zitat Pimentel E, Sivalingam K, Doke M, Samikkannu T. Effects of drugs of abuse on the blood-brain barrier: a brief overview. Front Neurosci. 2020;14:513.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Elbekai RH, El-Kadi AO. Cytochrome P450 enzymes: central players in cardiovascular health and disease. Pharmacol Ther. 2006;112(2):564–87. https://doi.org/10.1016/j.pharmthera.2005.05.011.CrossRefPubMed
6.
Zurück zum Zitat Sirotina S, Ponomarenko I, Kharchenko A, Bykanova M, Bocharova A, Vagaytseva K, et al. A novel polymorphism in the promoter of the CYP4A11 gene is associated with susceptibility to coronary artery disease. Dis Markers. 2018;2018:5812802. https://doi.org/10.1155/2018/5812802.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Guldiken B, Demir M, Guldiken S, Turgut N, Turgut B, Tugrul A. Oxidative stress and total antioxidant capacity in diabetic and nondiabetic acute ischemic stroke patients. Clin Appl Thromb Hemost. 2009;15(6):695–700. https://doi.org/10.1177/1076029608323087.CrossRefPubMed
8.
Zurück zum Zitat Patel SA, Bhambra U, Charalambous MP, David RM, Edwards RJ, Lightfoot T, et al. Interleukin-6 mediated upregulation of CYP1B1 and CYP2E1 in colorectal cancer involves DNA methylation, miR27b and STAT3. Br J Cancer. 2014;111(12):2287–96. https://doi.org/10.1038/bjc.2014.540.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Kelly PJ, Kavanagh E, Murphy S. Stroke: new developments and their application in clinical practice. Semin Neurol. 2016;36(4):317–23. https://doi.org/10.1055/s-0036-1586261.CrossRefPubMed
10.
Zurück zum Zitat Gadalla AE, Pearson T, Currie AJ, Dale N, Hawley SA, Sheehan M, et al. AICA riboside both activates AMP-activated protein kinase and competes with adenosine for the nucleoside transporter in the CA1 region of the rat hippocampus. J Neurochem. 2004;88(5):1272–82. https://doi.org/10.1046/j.1471-4159.2003.02253.x.CrossRefPubMed
11.
Zurück zum Zitat Wang Z, Yuan Y, Zhang Z, Ding K. Inhibition of miRNA-27b enhances neurogenesis via AMPK activation in a mouse ischemic stroke model. FEBS Open Bio. 2019;9(5):859–69. https://doi.org/10.1002/2211-5463.12614.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. https://doi.org/10.1006/meth.2001.1262.CrossRefPubMed
13.
Zurück zum Zitat Longo MC, Berninger MS, Hartley JL. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene. 1990;93(1):125–8. https://doi.org/10.1016/0378-1119(90)90145-h.CrossRefPubMed
14.
Zurück zum Zitat Ahmed GK, Abdalla AA, Mohamed AM, Mohamed LA, Shamaa HA. Relationship between time spent playing internet gaming apps and behavioral problems, sleep problems, alexithymia, and emotion dysregulations in children: a multicentre study. Child Adolesc Psychiatry Ment Health. 2022;16(1):67. https://doi.org/10.1186/s13034-022-00502-w.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Powers CJ, Dickerson R, Zhang SW, Rink C, Roy S, Sen CK. Human cerebrospinal fluid microRNA: temporal changes following subarachnoid hemorrhage. Physiol Genomics. 2016;48(5):361–6. https://doi.org/10.1152/physiolgenomics.00052.2015.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Rizk H, Magdy R, Emam K, Mohammed M, Aboulfotooh A. Substance use disorder in young adults with stroke: clinical characteristics and outcome. Acta Neurol Belg. 2023. https://doi.org/10.1007/s13760-023-02317-8.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Middlekauff HR, Cooper ZD, Strauss SB. Drugs of misuse: focus on vascular dysfunction. Can J Cardiol. 2022;38(9):1364–77. https://doi.org/10.1016/j.cjca.2022.04.011.CrossRefPubMed
18.
Zurück zum Zitat Solodilova M, Ponomarenko I, Bykanova M, Vagaytseva K, Stepanov V, Polonikov A. AB027. Promoter polymorphism rs9332978 in the CYP4A11 gene is a novel susceptibility marker for coronary heart disease. Ann Transl Med. 2017;5(Suppl 2):AB027. https://doi.org/10.21037/atm.2017.s027.CrossRefPubMedCentral
19.
Zurück zum Zitat Gao P, Zhang X, Zhang P. miRNA-214 ameliorates neuronal apoptosis in an experimental rat stroke model by targeting Bax. Int J Clin Exp Med. 2017;10(4):6293–302.
20.
Zurück zum Zitat Shen S, Ma L, Shao F, Jin L, Bian Z. Long Non-Coding RNA (lncRNA) NEAT1 Aggravates Cerebral Ischemia-Reperfusion Injury by Suppressing the Inhibitory Effect of miR-214 on PTEN. Med Sci Monit. 2020;26:e924781. https://doi.org/10.12659/msm.924781.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Wu Q, Wu JH, Ye ZY, She W, Peng WJ, Zhang HX, et al. Exosomes from hypoxia-treated mesenchymal stem cells: promoting neuroprotection in ischemic stroke through miR-214-3p/PTEN mechanism. Mol Neurobiol. 2024. https://doi.org/10.1007/s12035-024-04056-0.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Yu J, Zhu H, Kindy MS, Taheri S. Cytochrome P450 CYP2E1 suppression ameliorates cerebral ischemia reperfusion injury. Antioxidants (Basel). 2021. https://doi.org/10.3390/antiox10010052.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Xu W, Gao L, Zheng J, Li T, Shao A, Reis C, et al. The Roles of MicroRNAs in Stroke: possible therapeutic targets. Cell Transplant. 2018;27(12):1778–88. https://doi.org/10.1177/0963689718773361.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Ceren E, Zofia W, Salvatore DR, Dagmara MG, Aleksandra S, Ciro I, Iwona JK, Anna C, Marek P. MicroRNAs as diagnostic and prognostic biomarkers in ischemic stroke—a comprehensive review and bioinformatic analysis. Cells. 2018;7(12):249. https://doi.org/10.3390/cells7120249.CrossRef

Kompaktes Leitlinien-Wissen Neurologie (Link öffnet in neuem Fenster)

Mit medbee Pocketcards schnell und sicher entscheiden.
Leitlinien-Wissen kostenlos und immer griffbereit auf ihrem Desktop, Handy oder Tablet.

Neu im Fachgebiet Neurologie

Schützt Optimismus vor Demenz?

  • 14.04.2026
  • Demenz
  • Nachrichten

Wer insgesamt zuversichtlicher aufs Leben blickt, trägt ein geringeres Risiko, später einmal an Demenz zu erkranken als pessimistischere Zeitgenossen. Dafür sprechen zumindest Ergebnisse einer Längsschnittdatenanalyse aus den USA. Ob mehr Optimismus allerdings tatsächlich einer Demenz vorbeugt, bleibt unklar.   

Verzögert eine hochdosierte Influenza-Vakzine eine Demenz?

  • 10.04.2026
  • Demenz
  • Nachrichten

Eine hochdosierte Influenza-Vakzine geht mit einer verzögerten Demenzdiagnose einher. Darauf deutet eine Auswertung von US-Gesundheitsdaten hin. Besonders auffällig sind die Effekte in den ersten Monaten nach der Impfung.

Intensive Drucksenkung zeigt U-förmigen Nutzen nach Hirnblutung

Intensive Senkung eines erhöhten Blutdrucks kann nach einer intrazerebralen Blutung die funktionelle Erholung verbessern – mutmaßlich über eine Reduktion der Hämatomausdehnung. Offenbar hängt das aber vom Ausgangsvolumen ab, wie eine Analyse ergeben hat.

Steaks gegen Alzheimer

  • 02.04.2026
  • Demenz
  • Nachrichten

Da schmeckt das Rinderfilet gleich doppelt so gut: Fleisch beugt einer aktuellen Studie zufolge einer Demenz vor. Allerdings gilt das nur für ApoE4-Träger. Diese haben sich im Laufe der Evolution offenbar an einen hohen Fleischkonsum angepasst – und brauchen ihre Steak-Rationen.

Update Neurologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Bildnachweise
Die Leitlinien für Ärztinnen und Ärzte, Alter Mann entspannt sich im Grünen/© koldunova_anna / stock.adobe.com (Symbolbild mit Fotomodell), Hirn-MRT zeigt bilaterale subdurale Blutung (blaue Pfeile)/© Salvatore Perrone et al doi.org/10.1007/s00277-023-05392-2 unter CC-BY 4.0