Effect of CYP1A1 gene polymorphism and psychological distress on seminal analysis parameters

The study was conducted on 80 adult male subjects (age: 27 ± 3.08 years, range: 20–35 years; Duration of infertility:2–8 years). Male partner of infertile couples attending infertility clinic were selected randomly (1–2 cases per day). The subjects who were advised by the treating physician for a semen analysis for the primary infertility problem, were found normal on physical examination and gave written consent for being incorporated in this research work were included in this study. The persons with defect in seminal analysis as defined by WHO [15] were considered as subjects with abnormal sperm characteristics (age: 27 ± 3.02 years, range: 22–34 years; Duration of infertility:2–7 years) and the rests (age: 28 ± 3.19 years, range: 20–35 years; Duration of infertility:2–8 years) were having normal seminal character in this study. The subjects with known infections, any major heart, lungs, liver and kidney diseases, presence of WBCs in the semen, erectile dysfunction, congenital genital abnormality, hydrocele, crypotorchidism and varicocele were excluded from the study. It was a hospital based cross sectional study and was approved by institutional ethical committee (Ref. no. F.11/IEC/MAMC/10/No.42). The work was carried out in the Department of Biochemistry in collaboration with IVF and Reproductive Biology Centre, Department of Gynaecology and Obstetrics, LN Hospital, New Delhi.

Subjects were evaluated for anxiety symptoms and depression for screening psychological distress using the HADS [16]. It is a 14 item screening scale that was originally developed to indicate the possible presence of anxiety and depression states during the past 2 weeks in the setting of a medical non-psychiatric outpatient clinic. The HADS is comprised of two 7 item subscales, one for anxiety (HADS-A) and other for depression (HADS-D). Each item scores on a 4-point likert scale ranging from 0 (not at all) to 3 (nearly every day), giving maximum subscale scores of 21 for depression and anxiety, respectively. Higher scores indicate greater likelihood of depression or anxiety. Recommended cut offs are: Normal: 0–7, mild cases: 8–10, moderate cases: 11–15 and severe cases:16 or above. It is written in English, translated by us in Hindi and Hindi version was validated. But as most of the patients were illiterate and had difficulty in reading and comprehending even the translated version of self-rating HADS questionnaire, so it was administered in the form of a structured interview as done in our previous studies [3]. As the HADS is easy to score and administer, it is used as a screening instrument for psychological distress.

Seminal analysis was performed as per WHO guidelines, 2010 [15]. It was carried out by a trained technician dedicated for this purpose only at IVF centre, Lok Nayak Hospital. In brief, semen obtained by masturbation after 2–6 days of sexual abstinence and ejaculated into a wide-mouthed plastic container was used for analysis. Verbal and written instructions were given to the subjects before semen collection. The volume of semen was measured by weighing the sample and multiplying its weight by the density (1 gm ml^-1) of semen. For calculating sperm concentration, well-mixed liquefied semen was suitably diluted with fixative and mounted in a 100- μm-deep haemocytometer chamber. At least 200 intact spermatozoa per replicate were counted. The total number of spermatozoa per ejaculate was calculated by multiplying sperm concentration with semen volume. Sperm motility was assessed after liquefaction of semen at room temperature within 1 h of ejaculation from a 20-μm-deep wet preparation examined under phage-contrast microscope at 9400 magnification. At least 200 spermatozoa were evaluated in a total of at least five fields in at least two replicates to achieve acceptably low sampling error for motility assay. The motility of each spermatozoon was graded as follows: (i) progressive motility: where the spermatozoa moves actively either linearly or in a large circle, (ii) non progressive motility: where the spermatozoa are motile with an absence of progression and (iii) immotility: where the spermatozoa are not moving. Normal and abnormal morphology were assessed as defined in the WHO manual (2010) that includes Kruger’s criteria. Assessment of leucocytes in semen was carried out by staining cellular peroxidase using ortho-toluidine as described in WHO manual (2010). Semen having 1X10⁶ or more peroxidase-positive cells was excluded from the study. A person was considered to have abnormal sperm characteristics when his sperm characteristics deviated from cut off limit as defined by WHO [15]. Seminal analysis report is considered normal when semen volume was >2 ml/ejaculation and/or liquified completely within 60 min at room temp and/or sperm count is 20million/ml of semen or 40million/ejaculate and/or motility is 50 % or more with forward progression and 25 % or more with rapid progression within 60 min of collection and/or morphology is 15 % or more within normal forms and/or leukocyte count is <1million/ml of semen.

Allele-specific PCR method was used as a mutation detection method. Total genomic DNA was isolated from whole blood using Genomic DNA Minikit (Geneaid, Taiwan). The instructions of manufacturer were followed to extract DNA. The presence of DNA in the extract was confirmed by Agarose gel electrophoresis. PCR was carried out in a total volume of 25 μl (10 μl of mastermix, 0.3 μl of forward primer, 0.3 μl of reverse primer, 12.5 μl of nuclease free water and 2 μl of total genomic DNA) using thermocycler (Bioer, China).

Forward: For CC allele- 5′AAGCGGAAGTGTATCGGTGAGACC 3′

For AA allele- 5′AAGCGGAAGTGTATCGGTGAGAAC 3′

Reverse: 5′CAGGTAGACAGAGTCTAGGCCTCAG 3′

Forward: For AA allele- 5′GGAAGTGTATCGGTGAGACCA 3′

For GG allele- 5′GGAAGTGTATCGGTGAGACCG 3′

Reverse: 5′TCATGTCCACCTTCACGCCCA 3′

Amplified products were electrophoresed on 2 % agarose gel to detect the products of 218 bp for CYP1A1*4 (rs1799814; 2453C > A) polymorphism and 108 bp for CYP1A1*2C (rs 1048943; 2455 A > G) polymorphism.

STATISTICAL ANALYSIS: Odd’s ratio was calculated to estimate the risk of distress and gene polymorphism for development of abnormal sperm characteristics. Significance of odd’s ratio was calculated by using Chi-square/Fisher exact test. For comparison of data, Mann Whitney U test or Kruskal Wallis test was used. Two way ANOVA (univariate analysis of variance) was performed to evaluate the effect of and interactions among independent factors (distress and gene polymorphisms) on sperm characteristics. A P value <0.05 was considered as statistically significant in all statistical analysis.