Background
Osteoarthritis (OA) is the most common degenerative joint disease and is associated with a risk of reduced mobility. The disease occurs worldwide, usually in the elderly, where it results in an especially high economic burden. This disease causes movement to be painful, reducing quality of life and increasing the risk of other diseases such as diabetes and high blood pressure. OA not only affects health, but also creates social and economic problems because patients lose the ability to conduct routine activities and also incur high medical charges [
1].
Loss of homeostasis due to an imbalance between anabolic and catabolic processes is driven by cytokine cascades combination with the inflammatory mediators, the key event occurring in cartilage during pathogenesis. An increase of inflammatory cytokines, mainly interleukin-1β (IL-1β), is found in chondrocytes as well as synoviocytes of OA patients. These in turn decrease proteoglycans production and collagen synthesis while increasing catabolic factors including matrix metalloproteinase (MMP) and other inflammatory mediators such as IL-8, IL-6, prostaglandin E
2 and nitric oxide (NO) synthesis which promote OA [
2]. Current OA therapies aim to manage chronic pain and improve joint function. NSAIDS are used mainly as medication for OA treatment, but they have many adverse effects and the therapeutic mechanism of NSAIDS is not directed to the underlying disease pathogenesis. Systemic slow acting drugs (SYSAD) such as glucosamine sulfate/chondroitin sulfate, hyaluronan and diacerine are also used because of their contribution to delaying disease progression by catabolic process inhibition and favor the anabolic process [
3].
Many phytochemicals with anti-inflammation effects are claimed to be chondroprotective agents and are of interest as an alternative choice for OA treatment. Sesamin, a major lignin found in sesame seeds, has been reported to have health benefits. Reported pharmacological properties of sasamin include anti-inflammation [
4], anti-oxidant [
5], anti-hypertensive, inducing apoptosis in cancer cells [
6], lowering blood cholesterol, improving fatty acid metabolism [
7] and neuroprotective effect against hypoxia [
8]. A recent study described the chondroprotective effect of sesamin on normal human articular chondrocytes (HAC) works by promoting matrix sulfated glycosaminoglycans (GAGs) content and upregulation of the chondroitin sulfate proteoglycan (CSPGs) synthesis genes:
ACAN, XT-1, XT-2, CHSY1 and
ChPF resulting in a protective affect against OA [
9]. In this study we evaluated the effect of sesamin on pathological HAC in pellet culture in which the inflammation process in OA pathogenesis had been induced by IL-1β.
Methods
Materials
Primary human articular chondrocyte (HAC) was isolated from non-osteoarthritic joints taken from normal cartilage of 2 male and 2 female patients aged between 18 and 45 years at Maharaj Nakorn Chiang Mai Hospital. The isolated chondrocytes were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) as standard protocol.
The seeds of
Sesamum indicum Linn. were collected from Lampang province of Thailand and voucher specimen (BKF no. 138181) has been deposited at the National Park, Wildlife and Plant Conservation Department, Ministry of Natural Resources and Environments, Bangkok, Thailand. The sesamin was purified from sesame seeds using the method described by T. Phitak
et al. [
4].
For western blot analysis, a goat anti-human aggrecan G1-IGD-G2 Domains anti-body (Cat no. AF1220) was purchased from R&D system. Mouse anti-MMP13 monoclonal antibody (Cat no. MAB3321) and rabbit anti-ADAMTS-4 antibody (Cat no. ABT178) were purchased from Merck Millipore.
Chondrocyte expansion and 3D culture
Primary chondrocytes were expanded by monolayer culture and grown to confluence in DMEM containing 10% FBS in a humidified incubator with 5% CO2 at 37 °C. The chondrocytes (passage 3) in the monolayer culture were used to create pellets. The 5 × 105 trypsinized cells were centrifuged at 160 g for 5 min and cultured with 500 μl chondrogenic medium (10% FCS/DMEM, Insulin-Transferrin-Selenium (ITS 1×), 25 μg/ml ascorbic acid 2-phosphates and 10−7 M dexamethasone) in 15 ml conical tubes. Pellets were grown in a humidified incubator with 5% CO2 at 37 °C.
Optimization of IL-1β concentration for treated pellets
Pellets were treated with IL-1β 0-10 ng/ml on the day of pellets formed into spherical shape then incubated for 3 days. After that, the pellets were cultured with IL-1β free media for 21 days. Culture mediums and pellets were collected at intervals for measurement of GAGs release and gene expression.
Western blot analysis
Pellet lysates (80 mg protein/lane) were subjected to 12% gel SDS-PAGE and transferred to nitrocellulose membrane. Membranes were blocked with 5% milk in PBS/Tween20, then incubated with specific antibodies. The interested protein bands were developed using Supersignal West Femto Substrate (Thermo Scientific) and photographed using the molecular chemidoc XRS system and Gel-Doc machine (Bio-Rad). Band density was calculated using the Totallab TL120 software.
Investigation the effect of sesamin on IL-1β treated pellets
Groups of pellets were either pre-treated with 10 ng/ml IL-1β for 3 days or left untreated. Both groups were then cultured with sesamin 0-1 μM for further 21 days. Culture mediums were collected to measure GAGs release and pellets were collected to measure gene expression, GAGs content and DNA concentration.
Sulfated glycosaminoglycans content in culture media and pellet matrix
The GAGs release from the HAC pellets and GAGs accumulation were measured in culture media and papain digested pellets by DMMB assay [
9]. Matrix GAGs accumulation in pellet sections was investigated using safranin O staining.
Analysis of IL-1β concentration in culture media
Culture media or standard IL-1β (0-500 pg/ml) 100 μl were added to mAb against IL-1β in wells pre-coated with human IL-1β, mixed and covered by a plate cover sheet. All were incubated on an orbital shaker (200 rpm) at room temperature. After incubation for 3 h., the plate cover was removed and the culture media was discarded. The wells were washed 6 times; after the final wash, the plate was dried on tissue paper. TMB substrate solution was added to the wells (100 μl/well) and the plate was then incubated in the dark for 10 min. The reaction was stopped by adding 100 μl/well of stop solution. Light absorbance at 450 nm. was measured with a micro plate reader spectrophotometer. The concentration of IL-1β was calculated using the genesis program with reference to the standard curve.
Gene expression quantitation
HAC culture pellets were collected and RNA was extracted using an RNA extraction kit (GE Healthcare) following the manufacturer’s protocol. A total RNA (0.25 μg) was converted to cDNA using a BIOLINE SensiFAST™ cDNA synthesis kit following the mixer and reaction protocol. Real-time PCR was performed to investigate gene expression using a BIOLINE SensiFAST™ SYBR® No-ROX Kit. The primers were purchased from Invitrogen (Table
1). The level of gene expression of the samples was compared with that of
GADPH (the house-keeping gene) calculated using the 2
-ΔΔCT method [
10].
Table 1
Real-Time PCR Primers sequences
ACAN
| Forward: ACTTCCGCTGGTCAGATGGA Reverse: TCTCGTGCCAGATCATCACC |
XT-1
| Forward: GTGGATCCCGTCAATGTCATC Reverse: GTGTGTGAATTCGGCAGTGG |
XT-2
| Forward: CGAATCGCCTACATCATGCTGG Reverse: TAAACGGCCTTGAGGAGACG |
CHSY-I
| Forward: CCCGCCCCAGAAGAAGTC Reverse: TCTCATAAACCATTCATACTTGTCCAA |
ChPF
| Forward: AGATCCAGGAGTTACAGTGGGAGAT Reverse: CCGGGCGGGATGGT |
IL-1β
| Forward: AAACAGATGAAGTGCTCCTTCCAGG Reverse: TGGAGAACACCACTTGTTGCTCCA |
MMP-13
| Forward: TTGAGCTGGACTCATTGTCG Reverse: GAGCCTCTCAGTCATGGAG |
ADAMTs-4
| Forward: CCCCAGACCCCGAAGAGCCA Reverse: CCCGCTGCCAGGCACAGAAG |
DEC
| Forward: CCTGATGACCGCGACTTCGAG Reverse: TTTGGCACTTTGTCCAGACCC |
GADPH
| Forward: GAAGGTGAAGGTCGGAGTC Reverse: GAAGATGGTGATGGGATTTC |
Statistical analysis
Estimated values are given as mean ± standard deviation from triplicate samples of each of three independent experiments. One-way ANOVA and LSD post hoc test were used to compare control with IL-1β treated pellets and to compare IL-1β pre-treated pellets alone with IL-1β pre-treated pellets with sesamin. Values were considered significant at p < 0.05.
Discussion
We established cartilage inflammatory conditions in a 3D chondrocyte culture system. The primary chondrocyte pellets were created to mimic cartilage structure and inflammation was stimulated with IL-1β. The HAC pellet culture model can be used to investigate the effects of biomolecules, synthetic chemicals or pro-inflammatory cytokines on chondrocytes better than monolayer cultures because chondrocyte phenotypic stability is maintained in this 3D environment [
11,
12]. Moreover, long term cultures in this system permit chondrocytes to form and to deposit a well-organized matrix.
We optimized the concentration of IL-1β to stimulate a pathological condition on the chondrocytes by treating the HAC pellets with various concentrations of IL-1β (2.5-10 ng/ml) for 3 days, sufficient to induce a pellet to inflammatory condition. The medium containing IL-1β was then discharged. The IL-1β pre-treated pellets were cultured in IL-1β-free medium for a further 21 days. Culture media was changed and collected every 2-3 days for secretary GAGs analysis and pellets were collected at days 1, 7, 14 and 21 to measure anabolic gene expression (ACAN) and catabolic gene expression (MMP-13 and ADAMTs4). One dose of IL-1β pre-treatment effectively induced a pathological condition on the HAC pellets throughout the 21 day culture period. The highest concentration (10 ng/ml) of IL-1β significantly decreased ACAN and increased MMP-13 and ADAMTs-4 gene expression when compared to the control.
The protein level analysis of IL-1β treated pellet lysates, we found that aggrecan increased in concentration dependent on day1. This reflects both of the intact and degraded forms, which generated by the proteolytic enzymes in HAC pellet. The western blotting analysis showed slightly induction of MMP-13 and ADAMTS-4 when compared to mRNA level as a result of the modulation of translation, secretion and degradation process during the tissue remodeling in the HAC pellet.
Interestingly, IL-1β reduced GAGs production in HAC pellets as indicated by decreased secretary GAGs. Both results indicate the success of IL-1β in promoting the pathological condition in the HAC pellets.
To demonstrate that IL-1β pre-treatment was sufficient to stimulate the inflammation process in the HAC pellet culture system, the protein and mRNA levels of IL-1β pre-treated HAC pellets were analyzed. We found that retention of IL-1β in the cultured medium after pre-treatment was caused by exogenous IL-1β induced endogenous IL-1β synthesis. After changing the media, IL-1β was detectable in the pellet culture medium for entile 21 days the culture period. The level of IL-1β released in the culture medium was significantly higher than the control. This result is in accord with the upregulation of IL-1β gene expression of the IL-1β pre-treated pellets. We have shown that exogenous IL-1β pre-treatment enhances the expression of endogenous IL-1β of HAC pellets both at the gene and the protein level [
13].
The expression of IL-1β down-stream target genes (
ACAN [
14],
MMP13 [
15] and
ADAMTs-4
16) responded to the level of IL-1β in the condition media. At day 21 in the IL-1β pre-treated HAC pellets, the expression of
ACAN was not suppressed when compared to days 1, 7 and 14 due to the low levels of IL-1β in the condition media, analogous to the low expression of the
MMP13 gene detected by the presence of low levels of IL-1β in the condition media. The aggrecanase gene (
ADAMTs-4) when treated with IL-1β increased suddenly at day 14 after declining on day 7 then returning to a slightly higher level on day 21, possibly due to IL-1β autocrine stimulation.
HAC pellets which were pre-stimulated with IL-1β before being cultured in conditional IL-1β free medium still maintained the pathological condition as a result of autocrine stimulation throughout the 21 day culture period. The single dose of exogenous IL-1β may initiate other downstream IL-1β cytokine cascades such as IL-6, IL-8, nitric oxide (NO) and prostaglandin E2, exacerbating the inflammation condition and maintaining their effect for the entire 21 days.
There are some limitations of this study. First, we quantified only the amount of IL-1β and thus could not exclude the possible involvement of other cytokines and proteases in the observed IL-1β-mediated matrix reduction. Second, the culture medium consisted of dexamethasone, which is commonly used in cartilage tissue engineering for maintaining the chondrogenic phenotype [
17]. The effects of this synthetic glucocorticoid on cartilage matrix turnover are still unclear. It would be interesting to investigate the effects of this compound on the association of IL-1β expression. In addition, in the presence of IL-1β, decreases in the the levels of GAGs secretion in the media were correlated with
ACAN gene expression. By the Farndale assay, IL-1β decreases GAGs release in a dose and time dependent manner. One of the cartilage-specific biomolecules which contains GAGs is aggrecan. Aggrecan is chondroitin sulfate proteoglycan (CSPG) which is synthesized by chondrocytes [
18]. In chondrocyte monolayer cultures and cartilage explants cultures, IL-1β enhances the release of GAGs in culture media when compared to the normal condition [
4]. In contrast, in a pellet culture system, the aggrecan core protein expression is suppressed in the presence of IL-1β which reduces the supply of core protein for glycosaminogycans side chain attachment, subsequently affecting CSPGs production. The glycosaminoglycan chains found naturally in matrix are covalently bound to the core protein of proteoglycans, thus the GAGs level reflects proteoglycan production. This finding is consistent with previous reports. IL-1β induces downregulation of aggrecan and xylosyltransferase-1 expression while it upregulates MMP-13 and ADAMTs expression [
14‐
16,
19,
20]. The most likely explanations for this circumstance are, first, that pellet cultures have a higher ratio of cells in extracellular matrix than monolayer and explants cultures, providing sufficient cells to produce matrix-degrading enzymes and to decrease synthesis metabolism [
21]. Second, the low media volume relative to the number of cells may result in secreted enzymes being more concentrated in the extracellular matrix [
22]. Third, changing the media every 2 to 3 days instead of daily could concentrate the proteolytic enzymes and thus degrade the matrix [
20]. A previous model of the anti-inflammatory effect of sesamin on IL-1β-induced porcine cartilage explants have shown that proteoglycan degradation was reduced when sesamin was co-cultured with IL-1β [
4]. In that study, sesamin reversed the effects of IL-1β by decreasing degraded GAGs release in explants culture media and the abrogation of uronic acid loss from cartilage tissue. Our study found that sesamin suppresses the autocrine signaling of IL-1β by decreasing IL-1β-induced chondrocyte endogenous IL-1β production. The expression of IL-1β was downregulated both at the mRNA and the protein levels in the presence of sesamin when compared to IL-1β pre-treatment alone.
The highest CSPGs gene expression in normal HAC was on day 14, while in IL-1β induced HAC, the highest expression of
CHSY1 and
ChPF was on day 7, while for
ACAN, XT-1 and
XT-2 it was on day 14 which differs from a previous study [
9]. The difference of CSPGs expression pattern in IL-1β-induced HAC may have been due to chondrocyte compensatory mechanisms which counter IL-1β action [
23]. In addition, sesamin might upregulate CSPGs synthesis gene expression by abrogation of endogenous IL-1β and/or by directly upregulating CSPGs synthesis genes. This effect has been found with other phytochemical extracts such as edible bird’s nest [
24] and Herbal-Leucine mix [
25] that both inhibit IL-1β expression and increase aggrecan synthesis.
To determine whether sesamin specifically effects only aggrecan biosynthesis, the effect of sesamin on another CSPGs gene named decorin was also investigated. Decorin is a smaller matrix biomolecule associated with collagen fibrils in ECM of cartilage. It is a small leucine-rich proteoglycans that consists of a core protein with a dermatan sulfate chain and/or chondroitin sulfate chain attachment. It also modulates cell adhesion to fibronectin and thrombospondin, but not to type I collagen [
26]. In this study, no IL-1β transient suppression of the expression of decorin core protein mRNA or alteration of effects of sesamin on decorin core protein were observed. The differences in the response and expression patterns of aggrecan and decorin with IL-1β stimulation may be due to the responsive element on their promoter regions. The aggrecan promoter (choromosome 15q26.1) [
27] is spanned by three overlapping SP-1/AP-2 binding sites [
28]; in contrast, the decorin promoter region (chromosome 12q23) [
29] contains HSF2 and SP-1 sites and has a CRE-like sequence [
30].
All the CSPGs biosynthesis results were confirmed by histological analysis. The cytotoxicity and cell morphology of chondrocytes was performed by H&E staining which showed no difference in cell morphology and matrix appearance between IL-1β, IL-1β in combination with sesamin treated pellet sections and the control pellet section. Thus, IL-1β and sesamin treatment had no pathological effect on chondrocyte cells. Analysis of GAGs accumulation in pellet matrix was performed by Safranin-O staining. The results clearly illustrated the lower intensity of Safranin-O staining in the IL-1β pre-treatment alone group compared to the control group. The high Safranin-O intensity was clearly shown in the combination IL-1β and sesamin group compared to the IL-1β pre-treatment alone group in a dose dependent manner. The effect of IL-1β on GAGs accumulation in pellet matrix has been reported in previous studies, where IL-1β exposure to HAC pellets caused an extensive loss of cartilaginous matrix as evidenced histologically by the absence of stained S-GAG and Type II collagen and biochemically by a reduction of GAGs to undetectable levels [
23].
In a previous study, sesamin treatment alone increased GAGs accumulation in pellet matrix compared to control conditions and in OA pathological conditions by papain-induced OA rats, showing that sesamin resulted in recovery and increase in the synthesis of cartilage matrix molecules (GAGs and type-II collagen) [
4].
This study indicates that sesamin may affect both recovery from inflammatory effects and directly by increasing GAGs synthesis in HAC pellets. Sesamin has previously demonstrated regulation of the chondrocyte catabolic process via suppression of expression of MMPs through the inhibition of IL-1β signaling cascades [
4]. It has also shown induction on CSPGs proteoglycan synthesis via enhancement of chondrocyte CSPGs synthetic genes [
9].
Acknowledgements
We thank the subjects who gave the cartilage for our study. We also thank Dr. Robert G. Larma for his manuscript proofreading.