Skip to main content
Erschienen in: Journal of Translational Medicine 1/2011

Open Access 01.12.2011 | Research

Elevated levels of circulating IL-7 and IL-15 in patients with early stage prostate cancer

verfasst von: Chantal Mengus, Clémentine Le Magnen, Emanuele Trella, Kawa Yousef, Lukas Bubendorf, Maurizio Provenzano, Alexander Bachmann, Michael Heberer, Giulio C Spagnoli, Stephen Wyler

Erschienen in: Journal of Translational Medicine | Ausgabe 1/2011

Abstract

Background

Chronic inflammation has been suggested to favour prostate cancer (PCA) development. Interleukins (IL) represent essential inflammation mediators. IL-2, IL-7, IL-15 and IL-21, sharing a common receptor γ chain (c-γ), control T lymphocyte homeostasis and proliferation and play major roles in regulating cancer-immune system interactions. We evaluated local IL-2, IL-7, IL-15 and IL-21 gene expression in prostate tissues from patients with early stage PCA or benign prostatic hyperplasia (BPH). As control, we used IL-6 gene, encoding an IL involved in PCA progression. IL-6, IL-7 and IL-15 titres were also measured in patients' sera.

Methods

Eighty patients with BPH and 79 with early (1 to 2c) stage PCA were enrolled. Gene expression in prostate tissues was analyzed by quantitative real-time PCR (qRT-PCR). Serum IL concentrations and acute phase protein titres were evaluated by ELISA. Mann-Whitney, Wilcoxon and χ2 tests were used to compare IL gene expression and serum titers in the two groups of patients. Receiver operating characteristic (ROC) curves were constructed to evaluate the possibility to distinguish sera from different groups of patients based on IL titers.

Results

IL-2 and IL-21 gene expression was comparably detectable, with low frequency and at low extents, in PCA and BPH tissues. In contrast, IL-6, IL-7 and IL-15 genes were expressed more frequently (p < 0.0001, p = 0.0047 and p = 0.0085, respectively) and to significantly higher extents (p = 0.0051, p = 0.0310 and p = 0.0205, respectively) in early stage PCA than in BPH tissues. Corresponding proteins could be detected to significantly higher amounts in sera from patients with localized PCA, than in those from patients with BPH (p = 0.0153, p = 0.0174 and p = 0.0064, respectively). Analysis of ROC curves indicates that IL-7 (p = 0.0039), but not IL-6 (p = 0.2938) or IL-15 (p = 0.1804) titres were able to distinguish sera from patients with malignancy from those from patients with benign disease. Serum titres of C reactive (CRP), high mobility group B1 (HMGB1) and serum amyloid A (SAA) acute phase proteins were similar in both groups of patients.

Conclusions

Expression IL-7 and IL-15 genes in prostate tissues and corresponding serum titres are significantly increased in patients with early stage PCA as compared with patients with BPH.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1479-5876-9-162) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

All authors read and approved the final manuscript. CM, CLM, ET and KY participated in the design, acquisition and analysis of data. GCS and MP and SW conceived the study; GCS, MH and AB provided funding support and revised the manuscript critically for important intellectual content. LB made substantial contributions to the analysis and interpretation of data.
Abkürzungen
AUC
area under curve
BPH
benign prostatic hyperplasia
CI
confidence interval
CRP
C-reactive protein
c-γ
common receptor γ chain
DAMP
damage associated molecular patterns
EERP
endoscopic extraperitoneal radical prostatectomy
ELISA
enzyme-linked immunosorbent assay
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
HMGB1
high mobility group B1
IL
interleukin
mAb
monoclonal antibody
PCA
prostate cancer
PD-1
programmed death receptor-1
PD-L1 and -L2
programmed death ligand-1 and ligand-2
PSA
prostate specific antigen
qRT-PCR
quantitative real-time polymerase chain reaction
ROC
receiver operating characteristic
SAA
serum amyloid A
TUR-P
transurethral resection.

Background

Prostate cancer (PCA) is the second leading cause of cancer-related death in men with a death rate reaching 26.7% for 2001-2005 in United States[1]. Chronic inflammation has been suggested to play a major role in prostate oncogenesis[2]. Furthermore, local and systemic immunosuppression have also been reported in patients bearing PCA[36]. The clarification of molecular mechanisms underlying these phenomena might provide novel insights into PCA induction and progression, of potentially high clinical relevance.
Cytokines represent key mediators of inflammation and play pivotal roles in the interaction between immune system and cancer. A number of them have been suggested to be associated with advanced stage PCA[7]. IL-4 and, in particular, IL-6 have been shown to exert antiapoptotic effects on PCA cells, whereas proangiogenic effects of IL-8 have been demonstrated[7].
A group of lymphokines including, among others, IL-2, IL-7, IL-15 and IL-21 share a receptor γ-chain[8]. Common receptor γ-chain (c- γ) cytokines regulate lymphocyte development[912] and support CD4+ and CD8+ T cell homeostatic proliferation and functions[13, 14]. IL-2, IL-7, IL-15 and IL-21 are of particular interest in cancer immunotherapy[15]. Importantly, IL-2 is FDA approved for the treatment of melanoma and renal cell carcinoma, whereas IL-7 has been used with promising results in phase I/II trials in clinical oncology[16, 17]. IL-15 has not yet been used in clinical trials. However, experimental models and "in vitro" evidence suggest that it may represent a cancer treatment with high potential clinical relevance[1820]. Finally, IL-21 has been shown in murine models to prevent T lymphocyte exhaustion induced by chronic stimulation[2123]. In phase I/II clinical trials, IL-21 has also shown reproducible antitumor effects[24, 25].
Notably, however, elevated IL-7 serum levels have been detected in Hodgkin disease and in ovarian cancers [2629]. Furthermore, IL-7 has been shown to be produced by breast and colorectal cancer cells[30, 31]. IL-15 has also been shown to be produced by colon cancer cells and specific gene expression has been shown to be associated with distant metastases [32]. Moreover, elevated IL-15 serum levels were detected in multiple myeloma[33].
Little is known about IL-2, IL-7, IL-15 and IL-21 gene expression and protein secretion in patients bearing PCA or BPH. Indeed, IL-2 gene expression and IL-15 protein have been detected in BPH tissues[34, 35]. Furthermore, IL-7 gene has been found to be expressed in PCA tissues[36, 37] and the corresponding protein has been detected in patients' sera. However, no comparative analysis in patients with BPH and PCA has been performed so far and no data are currently available for IL-21 expression in PCA and BPH.
In order to evaluate the potential role of these IL in early phases of prostate oncogenesis, in this study we have evaluated the expression of specific genes in prostatic tissues from patients bearing either localized pT1-2c PCA or BPH and we have measured the titres of circulating proteins in their sera.
Our results indicate that in prostatic tissues from patients bearing early stage PCA, the expression of IL-7 and IL-15 genes is significantly enhanced, as compared to BPH, while no significant differences could be observed in IL-2 or IL-21 gene expression. Accordingly, titres of circulating IL-7 and IL-15 are increased in patients with localized PCA, as compared to patients with BPH. Most interestingly, IL-7 titres might help to discriminate sera from patients with PCA or BPH.

Patients and methods

Patients

We investigated a consecutive series of 159 specimens from men diagnosed for BPH or PCA at the Department of Urology of the University Hospital of Basel (Switzerland) from 2007 to 2010. Patients with BPH underwent conventional transurethral resection (TUR-P), while patients with PCA underwent either palliative TUR-P or endoscopic extraperitoneal radical prostatectomy (EERP). Relevant clinical data were collected by reviewing patients' files.
Written informed consent was obtained from patients in accordance with the requirements of the Ethical Committee of Basel (EKBB, Ref.Nr. EK: 176/07).

Quantification of gene expression in prostatic tissues by quantitative Real-Time PCR

Prostatic tissues were screened for the presence of tumors by an experienced pathologist (L. Bubendorf). Total RNA was extracted by using RNeasy® MiniKit (Qiagen, Basel, Switzerland), deoxyribonuclease I (Invitrogen, Carlsbad, California) treated and reverse transcribed by using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, California). Quantitative RT-PCR was performed using the TaqMan® Universal PCR Master Mix (Applied Biosystems, Forster City, CA), and the following primers and probes:
GAPDH[38]
Fwd ATGGGGAAGGTGAAGGTCG
Rev TAAAAGCAGCCCTGGTGACC
Probe FAM-CGCCCAATACGACCAAATCCGTTGAC-TAMRA
IL-2[39]
Fwd AACTCACCAGGATGCTCACATTTA
Rev TCCCTGGGTCTTAAGTGAAAGTTT
Probe FAM-TTTTACATGCCCAAGAAGGCCACAGAACT-TAMRA
IL-6[40]
Fwd CAGCCCTGAGAAAGGAGACATG
Rev GGTTCAGGTTGTTTTCTGCCA
Probe FAM-AGTAACATGTGTGAAAGCAGCAAAGAGGCAC-TAMRA
IL-21, IL-7 and IL-15 primers and probes were provided by Assays-on-Demand, Gene Expression Products (Applied Biosystems, Forster City, CA).
Specific gene expression was quantified by using the 2-ΔΔCT method[41]. Normalization of gene expression was performed using GAPDH as reference gene.

ELISA assays

Commercial ELISA kits for IL-6, IL-7 and IL-15 were obtained from Pharmingen (San Diego, CA). Detection limit was 1pg/ml for all assays. HMGB1 ELISA kit was obtained from Shino-Test Corporation (Kanagawa, Japan). SAA and CRP ELISA kits were obtained from USB (Swampscott, MA) and Roche Diagnostics Cobas® (Mannheim, Germany), respectively. Detection limits were 1 ng/ml, 0.6 ng/ml, and 0.6 μg/ml, for HMGB1, SAA and CRP, respectively. All assays were performed in accordance to the instructions from the producers.

Statistical Analysis

Mann-Whitney tests were used to compare mean expression of cytokine genes and cytokine serum titers for independent samples while Wilcoxon test was used for paired samples. When n ≥ 30, Student's T-Tests were used to compare means. Frequencies of specific gene expression in two groups were assessed by χ2 tests. Differences with p < 0.05 were considered significant. Receiver operating characteristic (ROC) curves were created to verify whether cytokine titers could be used to distinguish patients with PCA from patients with BPH [27].

Results

Clinico-pathological profiles of the patients

A group including 79 patients (average age ± SEM = 64.3 ± 0.8) undergoing surgical treatment for localized stage 1-2 PCA and a group of 80 patients (average age ± SEM = 68.1 ± 0.9) undergoing surgical treatment for BPH were enrolled in the study. Of the 79 PCA patients, 2 (2.6%) were diagnosed with stage pT1, 2 (2.6%) with stage pT1a, 1 (1.3%) with stage pT1b, 3 (3.8%) with stage pT2, 13 (16.4%) with stage pT2a, 4 (5%) with stage pT2b, 54 (68.3%) with stage pT2c.
Average serum Prostate Specific Antigen (PSA) ± SEM in PCA patients was 8.26 ± 1.46 ng/ml (n = 74) and average Gleason score ± SEM was 6.63 ± 0.10 (n = 78). Average serum PSA value ± SEM in BPH patients was 5.49 ± 0.87 ng/ml (n = 63).

Expression of c-γ cytokines genes in prostatic tissues

In the initial phase of our study, we quantitatively analyzed IL-2, IL-7, IL-15 and IL-21 gene expression in a series of tissue samples from localized PCA and BPH. As shown in figure 1, IL-2 gene expression was detectable in 20/32 (62.5%) and in 37/49 (75.5%) BPH and PCA specimens, respectively (p = 0.2099). Under a quantitative view point, comparably low levels of expression could be observed in BPH and PCA tissues (p = 0.1721).
In contrast, IL-7 gene expression was significantly more frequently observed in PCA than in BPH specimens [29/34 (85.3%) and 51/51 (100%) BPH and PCA, respectively (p = 0.0047)]. IL-15 gene was also expressed more frequently in PCA than in BPH samples [16/31 (51.6%) and 39/49 (79.6%) BPH and PCA specimens, respectively (p = 0.0085)]. Notably, under a quantitative point of view, IL-7 and IL-15 gene expression was also significantly increased in tissues from patients bearing early stage PCA as compared to those from patients with BPH (p = 0.0310 and p = 0.0205, respectively, figure 1).
IL-21 gene expression was relatively rarely detectable in prostatic tissues from patients bearing BPH or stage pT1-2c PCA [3/26 (11.5%) and 4/47 (8.5%) BPH and PCA tissues, respectively (p = 0.6739)]. Furthermore, the average level of expression did not significantly differ in the two groups (p = 0.6040, figure 1).
IL-6 is known to be a mediator of PCA morbidity, and may act as a cell growth factor and protect cancer cells from death[42]. Therefore, we used the expression of this gene as control of the integrity of our assays. Indeed, IL-6 gene expression was detected in 29/60 (48.3%) and in 46/54 (85.2%) BPH and early stage PCA specimens, respectively (p < 0.0001). Under a quantitative point of view, IL-6 gene expression was also significantly increased in tissues from patients bearing PCA as compared to BPH (p = 0.0051), thus confirming our previous findings[43].
Taken together these data indicate that although genes encoding the c-γ cytokines under investigation may be expressed in BPH tissues, IL-7 and IL-15 genes are expressed to a significantly higher extent in localized PCA.
IL-6 gene was previously found to be expressed by prostate cancer cells[44]. To address the issue of the nature of the cell types possibly expressing other cytokine genes in PCA tissues, we evaluated IL-2, IL-7, IL-15 and IL-21 gene expression in PC3, DU145 and LNCaP established PCA cell lines. Interestingly, we found that all cell lines expressed IL-15 gene, whereas IL-6 and IL-7 genes were only expressed in PC3 and DU145 cells (figure 2). In contrast, IL-2 and IL-21 genes were not expressed by any of the cell lines under investigation.

Detection of c-γ cytokines in sera from patients with early stage PCA

High IL-6 serum titres have been observed in advanced PCA [42]. Furthermore, increased IL-7 serum titres have been reported in PCA[37], as compared to non age matched healthy donors, but no comparison with sera from patients with BPH was attempted, nor were patients with early stage PCA specifically studied. In order to verify, at the systemic level our findings from BPH and localized PCA tissues, we comparatively evaluated circulating titres of IL-6, IL-7 and IL-15 in pre-operative sera from patients with prostatic diseases.
IL-6 was highly significantly increased even in sera from patients with pT1-2c stage PCA, as compared to sera from patients with BPH (average IL-6 concentration ± SEM = 57.34 ± 12.12 vs. 27.46 ± 2.62 pg/ml, p = 0.0153, figure 3A.1.). Most interestingly, serum levels of IL-7 and IL-15 were also significantly higher in patients with localized PCA as compared to patients with BPH (average IL-7 concentration ± SEM = 32.69 ± 9.73 vs. 5.87 ± 1.17 pg/ml, p = 0.0174 and average IL-15 concentration ± SEM 208.07 ± 48.50 vs. 50.51 ± 14.34 pg/ml, p = 0.0064, figure 3A.1.). Remarkably, a highly significant correlation was observed between IL-7 and IL-15 levels in sera from patients with either early stage PCA (p < 0.0001, R = 0.6631, n = 50) or BPH (p < 0.0001, R = 0.6019, n = 40) (Figure 3, panels A.2. and A.3.).
Notably, cytokine serum titres did not significantly correlate with the specific expression of the corresponding gene in autologous prostate tissues.

IL-7 serum titres distinguish patients with BPH or PCA

ROC curves were constructed to verify whether serum IL titres could help distinguishing patients with localized PCA from patients with BPH (Figure 3B). Interestingly, although specific serum titres were significantly higher in patients with PCA, as compared with patients with BPH, areas under curve (AUC) were small for IL-6 (AUC: 0.5547, 95%CI: 0.4515-0.6579) and IL-15 (AUC: 0.5825, 95%CI: 0.4647-0.7003). Therefore, these cytokine titres were not helpful in identifying patients with early stage malignancies (p = 0.2938 and p = 0.1804, respectively). In contrast, analysis of the ROC curve for IL-7 (AUC: 0.6775, 95%CI: 0.5676-0.7874 p = 0.0039) indicated that specific IL titres were effectively distinguishing patients with early stage PCA from patients with BPH.

Detection of acute phase proteins in sera from patients with early stage PCA

Serum biomarkers of systemic inflammation C reactive protein (CRP) and serum amyloid A (SAA), have been found to be associated with PCA [4547]. Furthermore, HMGB1 gene has been suggested to be overexpressed in prostate PCA [48]. The corresponding gene product is a prominent member of a group of mediators released by damaged cells, collectively known as damage associated molecular patterns (DAMP)[49]. These factors might be responsible for the activation of the innate immune system, potentially resulting in cytokine gene expression and secretion[50].
We did not observe significant differences between sera from patients with early stage PCA and those from patients with BPH regarding CRP, SAA or HMGB1 levels (Table 1: average CRP concentration ± SEM 7.47 ± 1.92 μg/ml vs. 5.70 ± 1.16 μg/ml, p = 0.4370; average SAA concentration ± SEM 2.81 ± 0.31 vs. 2.71 ± 0.29 μg/ml, p = 0.7728; average HMGB1 concentration ± SEM 52.77 ± 12.48 vs. 49.11 ± 15.13 ng/ml, p = 0.7497). Notably, no significant correlation could be observed between IL-6, IL-7 or IL-15 serum levels and acute phase protein titres. Similarly, no correlation with PSA levels or Gleason score was detectable.
Table 1
Acute phase protein concentrations in sera from patients with early stage PCA and BPH
  
CRP
(μg/ml)
SAA
(μg/ml)
HMGB1
(ng/ml)
Early stage PCA
Average
7.47
2.81
52.77
 
SEM
1.92
0.31
12.48
 
n
66
18
18
BPH
Average
5.70
2.71
49.11
 
SEM
1.16
0.29
15.13
 
n
66
19
19
p
 
0.4370
0.7728
0.7497

Discussion

A large body of literature based on histopathological, epidemiological and molecular pathology data suggests that chronic inflammation might play an important role in prostate oncogenesis [2]. IL represent essential mediators of inflammation and titres of a number of them have been shown to be increased in patients bearing PCA[7]. Most of these studies, however, have addressed IL detection in patients with advanced stage cancers. In these conditions, high tumor burdens and mechanisms inherent with metastatic spread, e,g, osteolysis, might be involved in the induction of IL production. Furthermore, sterile inflammation primed by intratumoral ischemia and associated necrosis could also promote IL release [51]. Therefore, data from patients with advanced tumors are unlikely to provide useful information on the role eventually played by inflammation or immunosuppression in prostate oncogenesis. In order to gain insights into events occurring in early stages of prostate cancerogenesis, in this study we evaluated IL gene expression and protein production at local and systemic levels, respectively, in localized PCA, as compared with BPH.
Our data clearly indicate that the expression of a number of genes encoding pro-inflammatory and homeostatic IL, including IL-6, IL-7 and IL-15 is detectable more frequently and to a higher extent, in early stage PCA as compared to BPH tissues. Notably, the genes encoding these IL were also found to be expressed to different levels by established PCA cell lines.
To investigate the possibly systemic nature of the pro-inflammatory state detectable in PCA[37, 52], we measured IL titres in sera from patients with BPH or early stage PCA. We report here for the first time that IL-7 and IL-15 serum levels are significantly higher in patients with localized PCA than in patients with BPH. IL-6 titres were also significantly higher in patients with PCA than in patients with BPH despite the early stage of their disease [53].
IL-6 is known to be produced by multiple cell types, including activated macrophages, smooth muscle cells and PCA cells [53]. Instead, IL-7 is produced by multiple stromal cell types and epithelial cells from different districts including thymus and gut[10]. Most recently IL-7 production has been detected in normal, but not in transformed prostate epithelial cells[36]. IL-15 is typically produced by activated antigen presenting cells of the myeloid lineage, including monocytes, macrophages and dendritic cells. However, IL-15 gene has also been found to be expressed by a multiplicity of other cell types, including stromal and epithelial cells[9]. Importantly, epithelial BPH cells have been shown to express IL-15[34]. In our patients, IL serum titres were not significantly correlated with specific gene expression in the autologous prostate tissues, thereby suggesting that cells other than tumor cells might be at least in part responsible for IL production. Thus, while we here show that IL-6, IL-7 and IL-15 genes are expressed in established PCA cell lines, future studies are warranted to clarify the cellular sources of these IL within the prostate and systemically.
The nature of the mechanisms promoting IL-6, IL-7 and IL-15 gene expression and protein production in PCA is also unclear. Different microorganisms, including virus and bacteria[54, 55] have been suspected to contribute to oncogenesis in the prostate. Indeed, their presence could result in chronic inflammation. Alternatively, it has been suggested that direct damage of epithelial cells might be caused by toxic compounds contained in urines or by dietary factors[2]. Cell death might, in turn, result in the activation of the innate immune system by DAMPs [49]. Soluble factors produced by DAMP-triggered innate immune system cells, including IL-6, have repeatedly been suggested to promote prostate cancerogenesis[2]. However, here we show that at least circulating levels of HMGB1, SAA and CRP acute phase proteins are similar in patients with BPH or localized, early stage PCA.
Analysis of ROC curves indicates that IL-7, but neither IL-6 nor IL-15 titres do distinguish sera from patients with PCA from sera from patients with BPH. These findings might set the stage for larger studies also addressing the clinical relevance of IL-7 serum titres in the monitoring of PCA response to treatment and recurrences.
On the other hand, our data raise the issue of potential functional consequences of c- γ cytokine gene expression and secretion in PCA. Preliminary experiments indicate that none of the IL under investigation enhances the proliferation of cells from established PCA cell lines (data not shown). However, studies performed in breast cancer[56] indicate that IL-7 promotes the production of pro-angiogenic factors by tumor cells and proliferation of endothelial cells. IL-15 has also been shown to stimulate angiogenesis "in vivo"[57]. Furthermore, although IL-7 and IL-15 are known to promote survival and functional maturation of T cells, they have also been demonstrated to induce the expression of PD-1 "exhaustion" marker in these cells[58]. Indeed, PCA tissues have been shown to be infiltrated by T cells largely expressing PD-1, and, less frequently, PD-L1 and PD-L2[59, 60]. These data are consistent with previous reports on the phenotypic characteristics of circulating and tissue infiltrating lymphocytes in chronic viral infections[6164]. In this context, it is remarkable that we found that the expression of the IL-21 gene, that is of the gene encoding the cytokine preventing PD-1 mediated T cell exhaustion[2123] is rarely detectable in PCA.

Conclusions

Our work indicates that even in early stages of PCA development, genes encoding IL of pro-inflammatory significance are over-expressed in malignant tissues, as compared to BPH specimens, Importantly, corresponding proteins are detectable to higher levels in sera from patients with localized PCA as compared to patients with BPH, and, in particular, IL-7 titres might represent an additional marker of potential clinical relevance.

Acknowledgements and Funding

This work was partially supported by unrestricted grants from Astra Zeneca, the Freiwillige Akademische Gesellschaft Basel, the Lichtenstein Stiftung Basel, Novartis Research Foundation (formerly Ciba-Geigy Jubilee Foundation), Swiss National Fund for Scientific Research and the Department of Surgery of the University Hospital Basel.
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

All authors read and approved the final manuscript. CM, CLM, ET and KY participated in the design, acquisition and analysis of data. GCS and MP and SW conceived the study; GCS, MH and AB provided funding support and revised the manuscript critically for important intellectual content. LB made substantial contributions to the analysis and interpretation of data.
Anhänge

Authors’ original submitted files for images

Literatur
1.
Zurück zum Zitat Jemal A, Thun MJ, Ries LA, Howe HL, Weir HK, Center MM, Ward E, Wu XC, Eheman C, Anderson R: Annual report to the nation on the status of cancer, 1975-2005, featuring trends in lung cancer, tobacco use, and tobacco control. J Natl Cancer Inst. 2008, 100: 1672-1694. 10.1093/jnci/djn389.PubMedCentralCrossRefPubMed Jemal A, Thun MJ, Ries LA, Howe HL, Weir HK, Center MM, Ward E, Wu XC, Eheman C, Anderson R: Annual report to the nation on the status of cancer, 1975-2005, featuring trends in lung cancer, tobacco use, and tobacco control. J Natl Cancer Inst. 2008, 100: 1672-1694. 10.1093/jnci/djn389.PubMedCentralCrossRefPubMed
2.
Zurück zum Zitat De Marzo AM, Platz EA, Sutcliffe S, Xu J, Gronberg H, Drake CG, Nakai Y, Isaacs WB, Nelson WG: Inflammation in prostate carcinogenesis. Nat Rev Cancer. 2007, 7: 256-269. 10.1038/nrc2090.PubMedCentralCrossRefPubMed De Marzo AM, Platz EA, Sutcliffe S, Xu J, Gronberg H, Drake CG, Nakai Y, Isaacs WB, Nelson WG: Inflammation in prostate carcinogenesis. Nat Rev Cancer. 2007, 7: 256-269. 10.1038/nrc2090.PubMedCentralCrossRefPubMed
3.
Zurück zum Zitat Ebelt K, Babaryka G, Figel AM, Pohla H, Buchner A, Stief CG, Eisenmenger W, Kirchner T, Schendel DJ, Noessner E: Dominance of CD4+ lymphocytic infiltrates with disturbed effector cell characteristics in the tumor microenvironment of prostate carcinoma. Prostate. 2008, 68: 1-10. 10.1002/pros.20661.CrossRefPubMed Ebelt K, Babaryka G, Figel AM, Pohla H, Buchner A, Stief CG, Eisenmenger W, Kirchner T, Schendel DJ, Noessner E: Dominance of CD4+ lymphocytic infiltrates with disturbed effector cell characteristics in the tumor microenvironment of prostate carcinoma. Prostate. 2008, 68: 1-10. 10.1002/pros.20661.CrossRefPubMed
4.
Zurück zum Zitat Miller AM, Lundberg K, Ozenci V, Banham AH, Hellstrom M, Egevad L, Pisa P: CD4+CD25high T cells are enriched in the tumor and peripheral blood of prostate cancer patients. J Immunol. 2006, 177: 7398-7405.CrossRefPubMed Miller AM, Lundberg K, Ozenci V, Banham AH, Hellstrom M, Egevad L, Pisa P: CD4+CD25high T cells are enriched in the tumor and peripheral blood of prostate cancer patients. J Immunol. 2006, 177: 7398-7405.CrossRefPubMed
5.
Zurück zum Zitat Miller AM, Pisa P: Tumor escape mechanisms in prostate cancer. Cancer Immunol Immunother. 2007, 56: 81-87.CrossRefPubMed Miller AM, Pisa P: Tumor escape mechanisms in prostate cancer. Cancer Immunol Immunother. 2007, 56: 81-87.CrossRefPubMed
6.
Zurück zum Zitat Yokokawa J, Cereda V, Remondo C, Gulley JL, Arlen PM, Schlom J, Tsang KY: Enhanced functionality of CD4+CD25(high)FoxP3+ regulatory T cells in the peripheral blood of patients with prostate cancer. Clin Cancer Res. 2008, 14: 1032-1040. 10.1158/1078-0432.CCR-07-2056.CrossRefPubMed Yokokawa J, Cereda V, Remondo C, Gulley JL, Arlen PM, Schlom J, Tsang KY: Enhanced functionality of CD4+CD25(high)FoxP3+ regulatory T cells in the peripheral blood of patients with prostate cancer. Clin Cancer Res. 2008, 14: 1032-1040. 10.1158/1078-0432.CCR-07-2056.CrossRefPubMed
7.
Zurück zum Zitat Culig Z: Cytokine disbalance in common human cancers. Biochim Biophys Acta. 2011, 1813: 308-314. 10.1016/j.bbamcr.2010.12.010.CrossRefPubMed Culig Z: Cytokine disbalance in common human cancers. Biochim Biophys Acta. 2011, 1813: 308-314. 10.1016/j.bbamcr.2010.12.010.CrossRefPubMed
8.
Zurück zum Zitat He YW, Malek TR: The structure and function of gamma c-dependent cytokines and receptors: regulation of T lymphocyte development and homeostasis. Crit Rev Immunol. 1998, 18: 503-524.CrossRefPubMed He YW, Malek TR: The structure and function of gamma c-dependent cytokines and receptors: regulation of T lymphocyte development and homeostasis. Crit Rev Immunol. 1998, 18: 503-524.CrossRefPubMed
9.
Zurück zum Zitat Fehniger TA, Caligiuri MA: Interleukin 15: biology and relevance to human disease. Blood. 2001, 97: 14-32. 10.1182/blood.V97.1.14.CrossRefPubMed Fehniger TA, Caligiuri MA: Interleukin 15: biology and relevance to human disease. Blood. 2001, 97: 14-32. 10.1182/blood.V97.1.14.CrossRefPubMed
10.
Zurück zum Zitat Fry TJ, Mackall CL: Interleukin-7: from bench to clinic. Blood. 2002, 99: 3892-3904. 10.1182/blood.V99.11.3892.CrossRefPubMed Fry TJ, Mackall CL: Interleukin-7: from bench to clinic. Blood. 2002, 99: 3892-3904. 10.1182/blood.V99.11.3892.CrossRefPubMed
11.
Zurück zum Zitat Leonard WJ, Spolski R: Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol. 2005, 5: 688-698. 10.1038/nri1688.CrossRefPubMed Leonard WJ, Spolski R: Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol. 2005, 5: 688-698. 10.1038/nri1688.CrossRefPubMed
12.
Zurück zum Zitat Schluns KS, Lefrancois L: Cytokine control of memory T-cell development and survival. Nat Rev Immunol. 2003, 3: 269-279. 10.1038/nri1052.CrossRefPubMed Schluns KS, Lefrancois L: Cytokine control of memory T-cell development and survival. Nat Rev Immunol. 2003, 3: 269-279. 10.1038/nri1052.CrossRefPubMed
13.
Zurück zum Zitat Moroz A, Eppolito C, Li Q, Tao J, Clegg CH, Shrikant PA: IL-21 enhances and sustains CD8+ T cell responses to achieve durable tumor immunity: comparative evaluation of IL-2, IL-15, and IL-21. J Immunol. 2004, 173: 900-909.CrossRefPubMed Moroz A, Eppolito C, Li Q, Tao J, Clegg CH, Shrikant PA: IL-21 enhances and sustains CD8+ T cell responses to achieve durable tumor immunity: comparative evaluation of IL-2, IL-15, and IL-21. J Immunol. 2004, 173: 900-909.CrossRefPubMed
14.
Zurück zum Zitat von Holzen U, Adamina M, Bolli M, Weber WP, Zajac P, Groeper C, Reschner A, Feder C, Schumacher R, Marti W: Selective responsiveness to common gamma chain cytokines in peripheral blood-derived cytotoxic T lymphocytes induced by Melan-A/MART-1(27-35)targeted active specific immunotherapy. Int J Cancer. 2005, 115: 248-255. 10.1002/ijc.20858.CrossRefPubMed von Holzen U, Adamina M, Bolli M, Weber WP, Zajac P, Groeper C, Reschner A, Feder C, Schumacher R, Marti W: Selective responsiveness to common gamma chain cytokines in peripheral blood-derived cytotoxic T lymphocytes induced by Melan-A/MART-1(27-35)targeted active specific immunotherapy. Int J Cancer. 2005, 115: 248-255. 10.1002/ijc.20858.CrossRefPubMed
15.
Zurück zum Zitat Fewkes NM, Mackall CL: Novel gamma-chain cytokines as candidate immune modulators in immune therapies for cancer. Cancer J. 2010, 16: 392-398. 10.1097/PPO.0b013e3181eacbc4.CrossRefPubMed Fewkes NM, Mackall CL: Novel gamma-chain cytokines as candidate immune modulators in immune therapies for cancer. Cancer J. 2010, 16: 392-398. 10.1097/PPO.0b013e3181eacbc4.CrossRefPubMed
16.
Zurück zum Zitat Rosenberg SA, Sportes C, Ahmadzadeh M, Fry TJ, Ngo LT, Schwarz SL, Stetler-Stevenson M, Morton KE, Mavroukakis SA, Morre M: IL-7 administration to humans leads to expansion of CD8+ and CD4+ cells but a relative decrease of CD4+ T-regulatory cells. J Immunother. 2006, 29: 313-319. 10.1097/01.cji.0000210386.55951.c2.PubMedCentralCrossRefPubMed Rosenberg SA, Sportes C, Ahmadzadeh M, Fry TJ, Ngo LT, Schwarz SL, Stetler-Stevenson M, Morton KE, Mavroukakis SA, Morre M: IL-7 administration to humans leads to expansion of CD8+ and CD4+ cells but a relative decrease of CD4+ T-regulatory cells. J Immunother. 2006, 29: 313-319. 10.1097/01.cji.0000210386.55951.c2.PubMedCentralCrossRefPubMed
17.
Zurück zum Zitat Sportes C, Babb RR, Krumlauf MC, Hakim FT, Steinberg SM, Chow CK, Brown MR, Fleisher TA, Noel P, Maric I: Phase I study of recombinant human interleukin-7 administration in subjects with refractory malignancy. Clin Cancer Res. 2010, 16: 727-735. 10.1158/1078-0432.CCR-09-1303.PubMedCentralCrossRefPubMed Sportes C, Babb RR, Krumlauf MC, Hakim FT, Steinberg SM, Chow CK, Brown MR, Fleisher TA, Noel P, Maric I: Phase I study of recombinant human interleukin-7 administration in subjects with refractory malignancy. Clin Cancer Res. 2010, 16: 727-735. 10.1158/1078-0432.CCR-09-1303.PubMedCentralCrossRefPubMed
18.
Zurück zum Zitat Melchionda F, Fry TJ, Milliron MJ, McKirdy MA, Tagaya Y, Mackall CL: Adjuvant IL-7 or IL-15 overcomes immunodominance and improves survival of the CD8+ memory cell pool. J Clin Invest. 2005, 115: 1177-1187.PubMedCentralCrossRefPubMed Melchionda F, Fry TJ, Milliron MJ, McKirdy MA, Tagaya Y, Mackall CL: Adjuvant IL-7 or IL-15 overcomes immunodominance and improves survival of the CD8+ memory cell pool. J Clin Invest. 2005, 115: 1177-1187.PubMedCentralCrossRefPubMed
19.
Zurück zum Zitat Oh S, Berzofsky JA, Burke DS, Waldmann TA, Perera LP: Coadministration of HIV vaccine vectors with vaccinia viruses expressing IL-15 but not IL-2 induces long-lasting cellular immunity. Proc Natl Acad Sci USA. 2003, 100: 3392-3397. 10.1073/pnas.0630592100.PubMedCentralCrossRefPubMed Oh S, Berzofsky JA, Burke DS, Waldmann TA, Perera LP: Coadministration of HIV vaccine vectors with vaccinia viruses expressing IL-15 but not IL-2 induces long-lasting cellular immunity. Proc Natl Acad Sci USA. 2003, 100: 3392-3397. 10.1073/pnas.0630592100.PubMedCentralCrossRefPubMed
20.
Zurück zum Zitat Rosenthal R, Groeper C, Bracci L, Adamina M, Feder-Mengus C, Zajac P, Iezzi G, Bolli M, Weber WP, Frey DM: Differential responsiveness to IL-2, IL-7, and IL-15 common receptor gamma chain cytokines by antigen-specific peripheral blood naive or memory cytotoxic CD8+ T cells from healthy donors and melanoma patients. J Immunother. 2009, 32: 252-261. 10.1097/CJI.0b013e3181998e03.CrossRefPubMed Rosenthal R, Groeper C, Bracci L, Adamina M, Feder-Mengus C, Zajac P, Iezzi G, Bolli M, Weber WP, Frey DM: Differential responsiveness to IL-2, IL-7, and IL-15 common receptor gamma chain cytokines by antigen-specific peripheral blood naive or memory cytotoxic CD8+ T cells from healthy donors and melanoma patients. J Immunother. 2009, 32: 252-261. 10.1097/CJI.0b013e3181998e03.CrossRefPubMed
21.
22.
Zurück zum Zitat Frohlich A, Kisielow J, Schmitz I, Freigang S, Shamshiev AT, Weber J, Marsland BJ, Oxenius A, Kopf M: IL-21R on T cells is critical for sustained functionality and control of chronic viral infection. Science. 2009, 324: 1576-1580. 10.1126/science.1172815.CrossRefPubMed Frohlich A, Kisielow J, Schmitz I, Freigang S, Shamshiev AT, Weber J, Marsland BJ, Oxenius A, Kopf M: IL-21R on T cells is critical for sustained functionality and control of chronic viral infection. Science. 2009, 324: 1576-1580. 10.1126/science.1172815.CrossRefPubMed
23.
Zurück zum Zitat Yi JS, Du M, Zajac AJ: A vital role for interleukin-21 in the control of a chronic viral infection. Science. 2009, 324: 1572-1576. 10.1126/science.1175194.PubMedCentralCrossRefPubMed Yi JS, Du M, Zajac AJ: A vital role for interleukin-21 in the control of a chronic viral infection. Science. 2009, 324: 1572-1576. 10.1126/science.1175194.PubMedCentralCrossRefPubMed
24.
Zurück zum Zitat Davis ID, Brady B, Kefford RF, Millward M, Cebon J, Skrumsager BK, Mouritzen U, Hansen LT, Skak K, Lundsgaard D: Clinical and biological efficacy of recombinant human interleukin-21 in patients with stage IV malignant melanoma without prior treatment: a phase IIa trial. Clin Cancer Res. 2009, 15: 2123-2129. 10.1158/1078-0432.CCR-08-2663.CrossRefPubMed Davis ID, Brady B, Kefford RF, Millward M, Cebon J, Skrumsager BK, Mouritzen U, Hansen LT, Skak K, Lundsgaard D: Clinical and biological efficacy of recombinant human interleukin-21 in patients with stage IV malignant melanoma without prior treatment: a phase IIa trial. Clin Cancer Res. 2009, 15: 2123-2129. 10.1158/1078-0432.CCR-08-2663.CrossRefPubMed
25.
Zurück zum Zitat Thompson JA, Curti BD, Redman BG, Bhatia S, Weber JS, Agarwala SS, Sievers EL, Hughes SD, DeVries TA, Hausman DF: Phase I study of recombinant interleukin-21 in patients with metastatic melanoma and renal cell carcinoma. J Clin Oncol. 2008, 26: 2034-2039. 10.1200/JCO.2007.14.5193.CrossRefPubMed Thompson JA, Curti BD, Redman BG, Bhatia S, Weber JS, Agarwala SS, Sievers EL, Hughes SD, DeVries TA, Hausman DF: Phase I study of recombinant interleukin-21 in patients with metastatic melanoma and renal cell carcinoma. J Clin Oncol. 2008, 26: 2034-2039. 10.1200/JCO.2007.14.5193.CrossRefPubMed
26.
Zurück zum Zitat Chopra V, Dinh TV, Hannigan EV: Angiogenin, interleukins, and growth-factor levels in serum of patients with ovarian cancer: correlation with angiogenesis. Cancer J Sci Am. 1996, 2: 279-285.PubMed Chopra V, Dinh TV, Hannigan EV: Angiogenin, interleukins, and growth-factor levels in serum of patients with ovarian cancer: correlation with angiogenesis. Cancer J Sci Am. 1996, 2: 279-285.PubMed
27.
Zurück zum Zitat Lambeck AJ, Crijns AP, Leffers N, Sluiter WJ, ten Hoor KA, Braid M, van der Zee AG, Daemen T, Nijman HW, Kast WM: Serum cytokine profiling as a diagnostic and prognostic tool in ovarian cancer: a potential role for interleukin 7. Clin Cancer Res. 2007, 13: 2385-2391. 10.1158/1078-0432.CCR-06-1828.CrossRefPubMed Lambeck AJ, Crijns AP, Leffers N, Sluiter WJ, ten Hoor KA, Braid M, van der Zee AG, Daemen T, Nijman HW, Kast WM: Serum cytokine profiling as a diagnostic and prognostic tool in ovarian cancer: a potential role for interleukin 7. Clin Cancer Res. 2007, 13: 2385-2391. 10.1158/1078-0432.CCR-06-1828.CrossRefPubMed
28.
Zurück zum Zitat Trumper L, Jung W, Dahl G, Diehl V, Gause A, Pfreundschuh M: Interleukin-7, interleukin-8, soluble TNF receptor, and p53 protein levels are elevated in the serum of patients with Hodgkin's disease. Ann Oncol. 1994, 5 (Suppl 1): 93-96.CrossRefPubMed Trumper L, Jung W, Dahl G, Diehl V, Gause A, Pfreundschuh M: Interleukin-7, interleukin-8, soluble TNF receptor, and p53 protein levels are elevated in the serum of patients with Hodgkin's disease. Ann Oncol. 1994, 5 (Suppl 1): 93-96.CrossRefPubMed
29.
Zurück zum Zitat Xie X, Ye D, Chen H, Lu W, Cheng B, Zhong H: Interleukin-7 and suppression of local peritoneal immunity in ovarian carcinoma. Int J Gynaecol Obstet. 2004, 85: 151-158. 10.1016/j.ijgo.2003.08.015.CrossRefPubMed Xie X, Ye D, Chen H, Lu W, Cheng B, Zhong H: Interleukin-7 and suppression of local peritoneal immunity in ovarian carcinoma. Int J Gynaecol Obstet. 2004, 85: 151-158. 10.1016/j.ijgo.2003.08.015.CrossRefPubMed
30.
Zurück zum Zitat Al-Rawi MA, Rmali K, Watkins G, Mansel RE, Jiang WG: Aberrant expression of interleukin-7 (IL-7) and its signalling complex in human breast cancer. Eur J Cancer. 2004, 40: 494-502. 10.1016/j.ejca.2003.10.016.CrossRefPubMed Al-Rawi MA, Rmali K, Watkins G, Mansel RE, Jiang WG: Aberrant expression of interleukin-7 (IL-7) and its signalling complex in human breast cancer. Eur J Cancer. 2004, 40: 494-502. 10.1016/j.ejca.2003.10.016.CrossRefPubMed
31.
Zurück zum Zitat Maeurer MJ, Walter W, Martin D, Zitvogel L, Elder E, Storkus W, Lotze MT: Interleukin-7 (IL-7) in colorectal cancer: IL-7 is produced by tissues from colorectal cancer and promotes preferential expansion of tumour infiltrating lymphocytes. Scand J Immunol. 1997, 45: 182-192. 10.1046/j.1365-3083.1997.d01-384.x.CrossRefPubMed Maeurer MJ, Walter W, Martin D, Zitvogel L, Elder E, Storkus W, Lotze MT: Interleukin-7 (IL-7) in colorectal cancer: IL-7 is produced by tissues from colorectal cancer and promotes preferential expansion of tumour infiltrating lymphocytes. Scand J Immunol. 1997, 45: 182-192. 10.1046/j.1365-3083.1997.d01-384.x.CrossRefPubMed
32.
Zurück zum Zitat Kuniyasu H, Ohmori H, Sasaki T, Sasahira T, Yoshida K, Kitadai Y, Fidler IJ: Production of interleukin 15 by human colon cancer cells is associated with induction of mucosal hyperplasia, angiogenesis, and metastasis. Clin Cancer Res. 2003, 9: 4802-4810.PubMed Kuniyasu H, Ohmori H, Sasaki T, Sasahira T, Yoshida K, Kitadai Y, Fidler IJ: Production of interleukin 15 by human colon cancer cells is associated with induction of mucosal hyperplasia, angiogenesis, and metastasis. Clin Cancer Res. 2003, 9: 4802-4810.PubMed
33.
Zurück zum Zitat Pappa C, Miyakis S, Tsirakis G, Sfiridaki A, Alegakis A, Kafousi M, Stathopoulos EN, Alexandrakis MG: Serum levels of interleukin-15 and interleukin-10 and their correlation with proliferating cell nuclear antigen in multiple myeloma. Cytokine. 2007, 37: 171-175. 10.1016/j.cyto.2007.02.022.CrossRefPubMed Pappa C, Miyakis S, Tsirakis G, Sfiridaki A, Alegakis A, Kafousi M, Stathopoulos EN, Alexandrakis MG: Serum levels of interleukin-15 and interleukin-10 and their correlation with proliferating cell nuclear antigen in multiple myeloma. Cytokine. 2007, 37: 171-175. 10.1016/j.cyto.2007.02.022.CrossRefPubMed
34.
Zurück zum Zitat Handisurya A, Steiner GE, Stix U, Ecker RC, Pfaffeneder-Mantai S, Langer D, Kramer G, Memaran-Dadgar N, Marberger M: Differential expression of interleukin-15, a pro-inflammatory cytokine and T-cell growth factor, and its receptor in human prostate. Prostate. 2001, 49: 251-262. 10.1002/pros.10020.CrossRefPubMed Handisurya A, Steiner GE, Stix U, Ecker RC, Pfaffeneder-Mantai S, Langer D, Kramer G, Memaran-Dadgar N, Marberger M: Differential expression of interleukin-15, a pro-inflammatory cytokine and T-cell growth factor, and its receptor in human prostate. Prostate. 2001, 49: 251-262. 10.1002/pros.10020.CrossRefPubMed
35.
Zurück zum Zitat Kramer G, Steiner GE, Handisurya A, Stix U, Haitel A, Knerer B, Gessl A, Lee C, Marberger M: Increased expression of lymphocyte-derived cytokines in benign hyperplastic prostate tissue, identification of the producing cell types, and effect of differentially expressed cytokines on stromal cell proliferation. Prostate. 2002, 52: 43-58. 10.1002/pros.10084.CrossRefPubMed Kramer G, Steiner GE, Handisurya A, Stix U, Haitel A, Knerer B, Gessl A, Lee C, Marberger M: Increased expression of lymphocyte-derived cytokines in benign hyperplastic prostate tissue, identification of the producing cell types, and effect of differentially expressed cytokines on stromal cell proliferation. Prostate. 2002, 52: 43-58. 10.1002/pros.10084.CrossRefPubMed
36.
Zurück zum Zitat Di CE, D'Antuono T, Pompa P, Giuliani R, Rosini S, Stuppia L, Musiani P, Sorrentino C: The lack of epithelial interleukin-7 and BAFF/BLyS gene expression in prostate cancer as a possible mechanism of tumor escape from immunosurveillance. Clin Cancer Res. 2009, 15: 2979-2987. 10.1158/1078-0432.CCR-08-1951.CrossRef Di CE, D'Antuono T, Pompa P, Giuliani R, Rosini S, Stuppia L, Musiani P, Sorrentino C: The lack of epithelial interleukin-7 and BAFF/BLyS gene expression in prostate cancer as a possible mechanism of tumor escape from immunosurveillance. Clin Cancer Res. 2009, 15: 2979-2987. 10.1158/1078-0432.CCR-08-1951.CrossRef
37.
Zurück zum Zitat Roato I, D'Amelio P, Gorassini E, Grimaldi A, Bonello L, Fiori C, Delsedime L, Tizzani A, De LA, Isaia G: Osteoclasts are active in bone forming metastases of prostate cancer patients. PLoS ONE. 2008, 3: e3627-10.1371/journal.pone.0003627.PubMedCentralCrossRefPubMed Roato I, D'Amelio P, Gorassini E, Grimaldi A, Bonello L, Fiori C, Delsedime L, Tizzani A, De LA, Isaia G: Osteoclasts are active in bone forming metastases of prostate cancer patients. PLoS ONE. 2008, 3: e3627-10.1371/journal.pone.0003627.PubMedCentralCrossRefPubMed
38.
Zurück zum Zitat Martin I, Jakob M, Schafer D, Dick W, Spagnoli G, Heberer M: Quantitative analysis of gene expression in human articular cartilage from normal and osteoarthritic joints. Osteoarthritis Cartilage. 2001, 9: 112-118. 10.1053/joca.2000.0366.CrossRefPubMed Martin I, Jakob M, Schafer D, Dick W, Spagnoli G, Heberer M: Quantitative analysis of gene expression in human articular cartilage from normal and osteoarthritic joints. Osteoarthritis Cartilage. 2001, 9: 112-118. 10.1053/joca.2000.0366.CrossRefPubMed
39.
Zurück zum Zitat Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C: An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods. 2001, 25: 386-401. 10.1006/meth.2001.1261.CrossRefPubMed Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C: An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods. 2001, 25: 386-401. 10.1006/meth.2001.1261.CrossRefPubMed
40.
Zurück zum Zitat Hartwig D, Hartel C, Hennig H, Muller-Steinhardt M, Schlenke P, Kluter H: Evidence for de novo synthesis of cytokines and chemokines in platelet concentrates. Vox Sang. 2002, 82: 182-190. 10.1046/j.1423-0410.2002.00172.x.CrossRefPubMed Hartwig D, Hartel C, Hennig H, Muller-Steinhardt M, Schlenke P, Kluter H: Evidence for de novo synthesis of cytokines and chemokines in platelet concentrates. Vox Sang. 2002, 82: 182-190. 10.1046/j.1423-0410.2002.00172.x.CrossRefPubMed
41.
Zurück zum Zitat Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25: 402-408. 10.1006/meth.2001.1262.CrossRefPubMed Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25: 402-408. 10.1006/meth.2001.1262.CrossRefPubMed
42.
Zurück zum Zitat Twillie DA, Eisenberger MA, Carducci MA, Hseih WS, Kim WY, Simons JW: Interleukin-6: a candidate mediator of human prostate cancer morbidity. Urology. 1995, 45: 542-549. 10.1016/S0090-4295(99)80034-X.CrossRefPubMed Twillie DA, Eisenberger MA, Carducci MA, Hseih WS, Kim WY, Simons JW: Interleukin-6: a candidate mediator of human prostate cancer morbidity. Urology. 1995, 45: 542-549. 10.1016/S0090-4295(99)80034-X.CrossRefPubMed
43.
Zurück zum Zitat Feder-Mengus C, Wyler S, Hudolin T, Ruszat R, Bubendorf L, Chiarugi A, Pittelli M, Weber WP, Bachmann A, Gasser TC: High expression of indoleamine 2,3-dioxygenase gene in prostate cancer. Eur J Cancer. 2008, 44: 2266-2275. 10.1016/j.ejca.2008.05.023.CrossRefPubMed Feder-Mengus C, Wyler S, Hudolin T, Ruszat R, Bubendorf L, Chiarugi A, Pittelli M, Weber WP, Bachmann A, Gasser TC: High expression of indoleamine 2,3-dioxygenase gene in prostate cancer. Eur J Cancer. 2008, 44: 2266-2275. 10.1016/j.ejca.2008.05.023.CrossRefPubMed
44.
Zurück zum Zitat Chung TD, Yu JJ, Spiotto MT, Bartkowski M, Simons JW: Characterization of the role of IL-6 in the progression of prostate cancer. Prostate. 1999, 38: 199-207. 10.1002/(SICI)1097-0045(19990215)38:3<199::AID-PROS4>3.0.CO;2-H.CrossRefPubMed Chung TD, Yu JJ, Spiotto MT, Bartkowski M, Simons JW: Characterization of the role of IL-6 in the progression of prostate cancer. Prostate. 1999, 38: 199-207. 10.1002/(SICI)1097-0045(19990215)38:3<199::AID-PROS4>3.0.CO;2-H.CrossRefPubMed
45.
Zurück zum Zitat Kaneti J, Winikoff Y, Zimlichman S, Shainkin-Kestenbaum R: Importance of serum amyloid A (SAA) level in monitoring disease activity and response to therapy in patients with prostate cancer. Urol Res. 1984, 12: 239-241.CrossRefPubMed Kaneti J, Winikoff Y, Zimlichman S, Shainkin-Kestenbaum R: Importance of serum amyloid A (SAA) level in monitoring disease activity and response to therapy in patients with prostate cancer. Urol Res. 1984, 12: 239-241.CrossRefPubMed
46.
Zurück zum Zitat Pierce BL, Biggs ML, DeCambre M, Reiner AP, Li C, Fitzpatrick A, Carlson CS, Stanford JL, Austin MA: C-reactive protein, interleukin-6, and prostate cancer risk in men aged 65 years and older. Cancer Causes Control. 2009, 20: 1193-1203. 10.1007/s10552-009-9320-4.PubMedCentralCrossRefPubMed Pierce BL, Biggs ML, DeCambre M, Reiner AP, Li C, Fitzpatrick A, Carlson CS, Stanford JL, Austin MA: C-reactive protein, interleukin-6, and prostate cancer risk in men aged 65 years and older. Cancer Causes Control. 2009, 20: 1193-1203. 10.1007/s10552-009-9320-4.PubMedCentralCrossRefPubMed
47.
Zurück zum Zitat Prins RC, Rademacher BL, Mongoue-Tchokote S, Alumkal JJ, Graff JN, Eilers KM, Beer TM: C-reactive protein as an adverse prognostic marker for men with castration-resistant prostate cancer (CRPC): Confirmatory results. Urol Oncol. 2010 Prins RC, Rademacher BL, Mongoue-Tchokote S, Alumkal JJ, Graff JN, Eilers KM, Beer TM: C-reactive protein as an adverse prognostic marker for men with castration-resistant prostate cancer (CRPC): Confirmatory results. Urol Oncol. 2010
48.
Zurück zum Zitat Ishiguro H, Nakaigawa N, Miyoshi Y, Fujinami K, Kubota Y, Uemura H: Receptor for advanced glycation end products (RAGE) and its ligand, amphoterin are overexpressed and associated with prostate cancer development. Prostate. 2005, 64: 92-100. 10.1002/pros.20219.CrossRefPubMed Ishiguro H, Nakaigawa N, Miyoshi Y, Fujinami K, Kubota Y, Uemura H: Receptor for advanced glycation end products (RAGE) and its ligand, amphoterin are overexpressed and associated with prostate cancer development. Prostate. 2005, 64: 92-100. 10.1002/pros.20219.CrossRefPubMed
51.
Zurück zum Zitat Zitvogel L, Casares N, Pequignot MO, Chaput N, Albert ML, Kroemer G: Immune response against dying tumor cells. Adv Immunol. 2004, 84: 131-179.CrossRefPubMed Zitvogel L, Casares N, Pequignot MO, Chaput N, Albert ML, Kroemer G: Immune response against dying tumor cells. Adv Immunol. 2004, 84: 131-179.CrossRefPubMed
52.
Zurück zum Zitat Schenk JM, Kristal AR, Neuhouser ML, Tangen CM, White E, Lin DW, Kratz M, Thompson IM: Biomarkers of systemic inflammation and risk of incident, symptomatic benign prostatic hyperplasia: results from the prostate cancer prevention trial. Am J Epidemiol. 2010, 171: 571-582. 10.1093/aje/kwp406.PubMedCentralCrossRefPubMed Schenk JM, Kristal AR, Neuhouser ML, Tangen CM, White E, Lin DW, Kratz M, Thompson IM: Biomarkers of systemic inflammation and risk of incident, symptomatic benign prostatic hyperplasia: results from the prostate cancer prevention trial. Am J Epidemiol. 2010, 171: 571-582. 10.1093/aje/kwp406.PubMedCentralCrossRefPubMed
53.
Zurück zum Zitat Culig Z, Steiner H, Bartsch G, Hobisch A: Interleukin-6 regulation of prostate cancer cell growth. J Cell Biochem. 2005, 95: 497-505. 10.1002/jcb.20477.CrossRefPubMed Culig Z, Steiner H, Bartsch G, Hobisch A: Interleukin-6 regulation of prostate cancer cell growth. J Cell Biochem. 2005, 95: 497-505. 10.1002/jcb.20477.CrossRefPubMed
54.
Zurück zum Zitat Das D, Wojno K, Imperiale MJ: BK virus as a cofactor in the etiology of prostate cancer in its early stages. J Virol. 2008, 82: 2705-2714. 10.1128/JVI.02461-07.PubMedCentralCrossRefPubMed Das D, Wojno K, Imperiale MJ: BK virus as a cofactor in the etiology of prostate cancer in its early stages. J Virol. 2008, 82: 2705-2714. 10.1128/JVI.02461-07.PubMedCentralCrossRefPubMed
55.
Zurück zum Zitat Namiki K, Goodison S, Porvasnik S, Allan RW, Iczkowski KA, Urbanek C, Reyes L, Sakamoto N, Rosser CJ: Persistent exposure to Mycoplasma induces malignant transformation of human prostate cells. PLoS ONE. 2009, 4: e6872-10.1371/journal.pone.0006872.PubMedCentralCrossRefPubMed Namiki K, Goodison S, Porvasnik S, Allan RW, Iczkowski KA, Urbanek C, Reyes L, Sakamoto N, Rosser CJ: Persistent exposure to Mycoplasma induces malignant transformation of human prostate cells. PLoS ONE. 2009, 4: e6872-10.1371/journal.pone.0006872.PubMedCentralCrossRefPubMed
56.
Zurück zum Zitat Al-Rawi MA, Watkins G, Mansel RE, Jiang WG: Interleukin 7 upregulates vascular endothelial growth factor D in breast cancer cells and induces lymphangiogenesis in vivo. Br J Surg. 2005, 92: 305-310. 10.1002/bjs.4832.CrossRefPubMed Al-Rawi MA, Watkins G, Mansel RE, Jiang WG: Interleukin 7 upregulates vascular endothelial growth factor D in breast cancer cells and induces lymphangiogenesis in vivo. Br J Surg. 2005, 92: 305-310. 10.1002/bjs.4832.CrossRefPubMed
57.
Zurück zum Zitat Angiolillo AL, Kanegane H, Sgadari C, Reaman GH, Tosato G: Interleukin-15 promotes angiogenesis in vivo. Biochem Biophys Res Commun. 1997, 233: 231-237. 10.1006/bbrc.1997.6435.CrossRefPubMed Angiolillo AL, Kanegane H, Sgadari C, Reaman GH, Tosato G: Interleukin-15 promotes angiogenesis in vivo. Biochem Biophys Res Commun. 1997, 233: 231-237. 10.1006/bbrc.1997.6435.CrossRefPubMed
58.
Zurück zum Zitat Kinter AL, Godbout EJ, McNally JP, Sereti I, Roby GA, O'Shea MA, Fauci AS: The common gamma-chain cytokines IL-2, IL-7, IL-15, and IL-21 induce the expression of programmed death-1 and its ligands. J Immunol. 2008, 181: 6738-6746.CrossRefPubMed Kinter AL, Godbout EJ, McNally JP, Sereti I, Roby GA, O'Shea MA, Fauci AS: The common gamma-chain cytokines IL-2, IL-7, IL-15, and IL-21 induce the expression of programmed death-1 and its ligands. J Immunol. 2008, 181: 6738-6746.CrossRefPubMed
59.
Zurück zum Zitat Ebelt K, Babaryka G, Frankenberger B, Stief CG, Eisenmenger W, Kirchner T, Schendel DJ, Noessner E: Prostate cancer lesions are surrounded by FOXP3+, PD-1+ and B7-H1+ lymphocyte clusters. Eur J Cancer. 2009, 45: 1664-1672. 10.1016/j.ejca.2009.02.015.CrossRefPubMed Ebelt K, Babaryka G, Frankenberger B, Stief CG, Eisenmenger W, Kirchner T, Schendel DJ, Noessner E: Prostate cancer lesions are surrounded by FOXP3+, PD-1+ and B7-H1+ lymphocyte clusters. Eur J Cancer. 2009, 45: 1664-1672. 10.1016/j.ejca.2009.02.015.CrossRefPubMed
60.
Zurück zum Zitat Sfanos KS, Bruno TC, Meeker AK, De Marzo AM, Isaacs WB, Drake CG: Human prostate-infiltrating CD8+ T lymphocytes are oligoclonal and PD-1+. Prostate. 2009, 69: 1694-1703. 10.1002/pros.21020.PubMedCentralCrossRefPubMed Sfanos KS, Bruno TC, Meeker AK, De Marzo AM, Isaacs WB, Drake CG: Human prostate-infiltrating CD8+ T lymphocytes are oligoclonal and PD-1+. Prostate. 2009, 69: 1694-1703. 10.1002/pros.21020.PubMedCentralCrossRefPubMed
61.
Zurück zum Zitat Day CL, Kaufmann DE, Kiepiela P, Brown JA, Moodley ES, Reddy S, Mackey EW, Miller JD, Leslie AJ, DePierres C: PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression. Nature. 2006, 443: 350-354. 10.1038/nature05115.CrossRefPubMed Day CL, Kaufmann DE, Kiepiela P, Brown JA, Moodley ES, Reddy S, Mackey EW, Miller JD, Leslie AJ, DePierres C: PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression. Nature. 2006, 443: 350-354. 10.1038/nature05115.CrossRefPubMed
62.
Zurück zum Zitat Franceschini D, Paroli M, Francavilla V, Videtta M, Morrone S, Labbadia G, Cerino A, Mondelli MU, Barnaba V: PD-L1 negatively regulates CD4+CD25+Foxp3+ Tregs by limiting STAT-5 phosphorylation in patients chronically infected with HCV. J Clin Invest. 2009, 119: 551-564. 10.1172/JCI36604.PubMedCentralCrossRefPubMed Franceschini D, Paroli M, Francavilla V, Videtta M, Morrone S, Labbadia G, Cerino A, Mondelli MU, Barnaba V: PD-L1 negatively regulates CD4+CD25+Foxp3+ Tregs by limiting STAT-5 phosphorylation in patients chronically infected with HCV. J Clin Invest. 2009, 119: 551-564. 10.1172/JCI36604.PubMedCentralCrossRefPubMed
63.
Zurück zum Zitat Golden-Mason L, Palmer B, Klarquist J, Mengshol JA, Castelblanco N, Rosen HR: Upregulation of PD-1 expression on circulating and intrahepatic hepatitis C virus-specific CD8+ T cells associated with reversible immune dysfunction. J Virol. 2007, 81: 9249-9258. 10.1128/JVI.00409-07.PubMedCentralCrossRefPubMed Golden-Mason L, Palmer B, Klarquist J, Mengshol JA, Castelblanco N, Rosen HR: Upregulation of PD-1 expression on circulating and intrahepatic hepatitis C virus-specific CD8+ T cells associated with reversible immune dysfunction. J Virol. 2007, 81: 9249-9258. 10.1128/JVI.00409-07.PubMedCentralCrossRefPubMed
64.
Zurück zum Zitat Radziewicz H, Ibegbu CC, Fernandez ML, Workowski KA, Obideen K, Wehbi M, Hanson HL, Steinberg JP, Masopust D, Wherry EJ: Liver-infiltrating lymphocytes in chronic human hepatitis C virus infection display an exhausted phenotype with high levels of PD-1 and low levels of CD127 expression. J Virol. 2007, 81: 2545-2553. 10.1128/JVI.02021-06.PubMedCentralCrossRefPubMed Radziewicz H, Ibegbu CC, Fernandez ML, Workowski KA, Obideen K, Wehbi M, Hanson HL, Steinberg JP, Masopust D, Wherry EJ: Liver-infiltrating lymphocytes in chronic human hepatitis C virus infection display an exhausted phenotype with high levels of PD-1 and low levels of CD127 expression. J Virol. 2007, 81: 2545-2553. 10.1128/JVI.02021-06.PubMedCentralCrossRefPubMed
Metadaten
Titel
Elevated levels of circulating IL-7 and IL-15 in patients with early stage prostate cancer
verfasst von
Chantal Mengus
Clémentine Le Magnen
Emanuele Trella
Kawa Yousef
Lukas Bubendorf
Maurizio Provenzano
Alexander Bachmann
Michael Heberer
Giulio C Spagnoli
Stephen Wyler
Publikationsdatum
01.12.2011
Verlag
BioMed Central
Erschienen in
Journal of Translational Medicine / Ausgabe 1/2011
Elektronische ISSN: 1479-5876
DOI
https://doi.org/10.1186/1479-5876-9-162

Weitere Artikel der Ausgabe 1/2011

Journal of Translational Medicine 1/2011 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.