Background
Renal cell carcinoma (RCC) is annually increasing worldwide, often with the lack of early-warning signs, as only up to 10% of RCC patients present characteristic clinical symptoms [
1]. Kidney cancer is a highly heterogeneous malignancy, and clear cell RCC (ccRCC) is the most common pathologic type, accounting for 75% of all renal malignancies [
2]. The five-year survival rates of RCC patients with stage I, II, III, and IV renal cancer are reported to be 94.7%, 88.9%, 68.8%, and 19.3%, respectively [
3]. Thus, earlier detection of RCC places a greater emphasis on the preservation of kidney function and treatment of RCC. With the understanding of the molecular mechanisms underlying RCCs, targeted therapies with small molecules, such as sorafenib and sunitinib, have been effective in treating RCCs [
4]. Therefore, further understanding of the underlying mechanisms of RCC development and search for new therapeutic targets dependent on these mechanisms are needed.
The metastasis-associated gene 1 (MTA1) is a crucial gene involved in cancer metastasis and is overexpressed in many cancers, including gastric, ovarian, prostate, and breast cancer [
5‐
9]. MTA1 has been reported as a key component of the nuclear remodeling and deacetylation complex, which regulates metastasis-associated gene expression, including cell migration and invasion [
10]. Moreover, MTA1 could mediate the migration and invasion of cancers by regulating the phosphorylation of various intracellular proteins involved in signaling pathways, such as AKT, hypoxia, and hedgehog signaling [
7,
8,
11]. MTA1 has been reported to promote cancer cell invasion by depressing the E-cadherin expression [
12,
13]. Recently, MTA1 has been recognized as a prognostic biomarker in lung cancer and is associated with poor prognosis in these patients [
5]. However, the role of MTA1 in kidney cancer and its molecular mechanisms are currently unknown.
This study aimed to examine the relationship between MTA1 and RCC as well as the MTA1 expression and prognosis of RCC patients. Based on the clinical results, we further performed in vitro experiments to investigate the effects of MTA1 expression on the metastasis of RCC cell line and its molecular mechanisms.
Methods
Patients and tissue samples
The 109 matched ccRCC and adjacent normal tissue specimens were obtained from the Haikou Municipal Hospital (Haikou, China).This study was approved by the Ethics Committee of Haikou Municipal Hospital and by Hubei Polytechnic University. Written informed consent was obtained from all patients.
Cell culture and reagents
The human kidney cancer cell line A498 was purchased from the China Center for Type Culture Collection (Wuhan, China). Cells were cultured in DMEM (Hyclone) with 10% FBS (GIBCO) and incubated in a cell incubator at 37 °C and 5% CO2.
A498 cells were transfected with Flag-MTA1, specific interfering RNA (siRNA), and their respective controls pcDNA3.1-Flag and siNC using Lipo2000 (Invitrogen). MTA1 siRNA (si-MTA1) and siNC were purchased from Ribobio (Guangzhou, China). The NF-κB inhibitor, pyrrolidine dithiocarbamate (PDTC), was purchased from MedChemEepress.
Immunohistochemistry
The ccRCC and adjacent tissues were treated following our previous report [
14]. Briefly, tissues were fixed with formalin (Beijing Suolebao Biotechnology), sectioned, deparaffinized, and hydrated following endogenous peroxidase inactivation and antigen recovery. Sections ware incubated with MTA1 antibody (14682–1-AP, Proteintech) at 4 °C overnight, followed by the secondary antibody (GB23303; Servicebio) at 37 °C for 30 min. After washing, the sections were then treated with diaminobenzidine reagent (DAB horseradish peroxidase color development kit; Beyotime) and visualized at 200× and 400× magnification with a light microscope (Olympus) in a double-blind analysis by two pathologists. For each specimen, the number of positive cells was randomly counted and was scored based on the average percentage of positive cells in five high-power fields (≤ 5%, 0 points; 6–25%, 1 point; 26–50%, 2 points; 51–75%, 3 points; and > 75%, 4 points). In addition, the specimens were scored according to the intensity of staining: no staining, 0 points; light yellow, 1 point; brown, 2 points; light brown, 3 points; and dark brown, 4 points. Finally, the two scores were added and categorized as follows: 0–2, negative; 3–5, weak positive; and 6–8, strong positive. To facilitate statistical analysis, a score of ≥ 3, points was classified as positive.
Quantitative real time polymerase chain reaction
Total RNA was isolated using the TRIzol kit (Takara) as previously described [
15]. A total of 2 µg RNA was used to transcribe cDNA using reverse transcription kit (Promega). Quantitative real time polymerase chain reaction (qRT-PCR) was performed using ABI QuantStudio version 5 (Applied Biosystems; Thermo Fisher Scientific, Inc.). The results were analyzed using the 2
−ΔΔCt method and GAPDH as an internal reference.
The primers used in the study were as follows:
GAPDH-R | AGGGATGATGTTCTGGAGAGC |
MMP2-F | CCCACTGCGGTTTTCTCGAAT |
MMP2-R | CAAAGGGGTATCCATCGCCAT |
MMP9-F | AGACCTGGGCAGATTCCAAAC |
MMP9-R | CGGCAAGTCTTCCGAGTAGT |
E-cadherin-F | CGAGAGCTACACGTTCACGG |
E-cadherin-R | GGGTGTCGAGGGAAAAATAGG |
Western blot assay
Western blot assay was performed as previously described [
16]. In brief, the treated A498 cells were lysed with RIPA lysis buffer containing proteinase inhibitors and phosphatase inhibitors (Roche). Then, the obtained cell lysates were used for western blot analysis. The MTA1 (BA2749) was from BOSTER, and β-actin (10230-1-AP) antibodie was purchased from Proteintech, and p65 (AF5006) and p-p65 (AF2006) antibodies were obtained from Affinity Biosciences.
Cell migration assay: wound healing
Cultured A498 cells (at 80% confluence) were transfected with Flag-MTA1, si-MTA1, and their relative control vectors pcDNA3.1-Flag and siNC using Lipo2000 (Invitrogen). After 12 h, a wound (scratch) was artificially created using the tip of a 10 µl pipette in the center of middle well containing the adherent cells. The width of the scratch was regularly measured under 100 × magnification to measure the gap closure rate as an indicator of cell migration data on wound healing (Olympus microscope).
Cell invasion assay
A498 cells were transfected with Flag-MTA1, pcDNA3.1-Flag, si-MTA1, and siNC as described above. After 24 h, cells from each condition were transferred in to the upper part of matrigel-coated (rehydrated with medium, 1:8) transwell chambers with 200 µL serum-free DMEM, while the lower part of the chamber contained 500 µL DMEM with 10% FBS. After culturing for 12 h in the incubator, the invaded cells on the outer surface of the filter screen were fixed with methyl alcohol for 10 min and were stained by 0.1% crystal violet for 10 min; then, they were photographed using an Olympus light microscope using a 40 × objective and counted using Image J.
Statistical analysis
All statistical analyses were performed using SPSS version 17.1. The correlations between the MTA1 expression and the clinical-pathological characteristics were determined using the χ2 test. Data are expressed as the mean ± standard deviation. Statistical significance was analyzed using the Student’s t-test between the two groups and ANOVA for multiple groups. A p value < 0.05 was considered significant.
Discussion
MTA1 reportedly up-regulated and promoted the progression of tumor growth in many cancers, including lung, liver, breast, ovarian, gastric, and prostate cancers [
7‐
9,
21,
22]. Nonetheless, the role of MTA1 in RCCs is still unclear. In renal cancers, ccRCC comprises nearly 80% of all RCCs. In this study, we selected 109 pairs of ccRCCs and adjacent normal tissues and demonstrated that the expression level of MTA1 was significantly up-regulated in ccRCC tissues, compared to the surrounding tissue (Fig.
1 and Table
1). Moreover, MTA1 was highly expressed in A498 and 768-O RCC cell lines (Fig.
1).
We found that the overexpression of MTA1 markedly promoted A498 cell migration and invasion in vitro (Figs.
2,
3), which strongly suggests that MTA1 was the key factor regulating the metastasis of RCCs. However, the clinical-pathological analysis revealed that positive MTA1 expression in RCCs was associated with the age of patients and T stage and grade but not with the lymph node metastasis (Table
2). This apparent contradiction could likely be attributed to the small number of cases with lymph node metastasis enrolled in this study, which did not lead to a statistically significant difference. Furthermore, Table
2 reports that 19 MTA1-positive cases were present, while only 4 MTA1-positive cases presenting lymph node metastasis were present. A similar result was shown in the no lymph node metastasis group, that is, MTA1-postive cases were more common than cases with negative MTA1. This trend is consistent with the results in our in vitro experiments. In addition, the enrolled cases were nearly early-stage; thus, over half of the patients in early-stage disease showed MTA1 positivity. Due to the limitation of the metastasis group sample size, future studies with a larger number of cases are needed to further examine the relationship between MTA1 and lymph node metastasis or distant metastasis.
Mechanistically, we showed that MTA1 was able to regulate the metastasis of RCCs by mediating the expression of E-cadherin, MPP2, and MPP9 (Fig.
4). Moreover, we used PDTC to inhibit the NF-κB signaling pathway, which limited the effects of MTA1 (Fig.
4). Further, the in vitro migration and invasion assays in the presence of PDTC treatment showed that NF-κB played a vital role in the MTA1-mediated migration and invasion (Fig.
5). Considering all the above evidence, we concluded that MTA1 mediated the migration and invasion of RCCs by targeting E-cadherin, MPP2, and MPP9 via the NF-κB pathway. Similar to our findings relative to the MTA1-mediated migration and invasion of RCCs by targeting E-cadherin, MPP2, and MPP9, Yao et al. reported that MTA1 promoted cell proliferation and invasion by regulating MMP2 and MMP9 in gastric cancers [
13]. MTA1 could have an effect on some signaling pathways, including hedgehog, PI3K, HIF, and AKT [
8,
12]. Bui-Nguyen et al. showed that MTA1 was a target gene of NF-κB [
18]. In this study, we revealed that the NF-κB signaling pathway was a new downstream target for MTA1, although the mechanism of how MTA1 affects the NF-κB signaling pathway requires further study.
Conclusions
In summary, our study found that MTA1 is overexpressed in RCC cells and tissues. MTA1 mediated the tumor cell migration and invasion in cultured cells through the regulation of E-cadherin, MPP2, and MPP9 via the NF-κB pathway. These results suggested that MTA1 might play a vital role in the progression of RCC.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.