Endogenous controls of gene expression in N-methyl-N-nitrosourea-induced T-cell lymphoma in p53-deficient mice

A mouse p53 gene-targeting vector was constructed using a PGK promoter to drive the expression of a neomycin selection cassette (Neo). The targeting vector was introduced into C57BL/6 mouse ES cells by electroporation. After homologous recombination, the targeting vector replaced the p53 gene from exon 2 to 5. Neomycin resistant ES cell colonies were selected, screened by PCR, and injected into 151 wild-type BALB/c blastocysts. ES-cell-injected blastocysts were then transferred to 14 pseudo-pregnant mice and 8 chimeric mice were produced. Tail genomic DNA was isolated using a Tissue Genomic DNA Extraction Kit (Generay, Shanghai, China) and then subjected to PCR to verify deletion of the p53 gene. Genomic DNA of p53 deficient mice and wild-type mice were amplified with primer sets 1 (P53-WT-F, AGTTCTGCCACGTGGTTGGT; P53-WT-R, GTCTCCTGGCTCAGAGGGAG) or 2 (P53-WT-F, AGTTCTGCCACGTGGTTGGT; P53-Neo-R, CAGAGGCCACTTGTGTAGCG), with expected PCR products of 281 bp or 441 bp for wild-type and homozygous mutations, respectively. The male chimera mice were crossed with wild-type C57BL/6 female mice to generate heterozygous p53 gene knockout mice. For the heterozygous mutation, both bands were visible. C57BL/6 and BALB/c mice were produced in our breeding colony in Institute for Laboratory Animal Resources, National Institutes for Food and Drug Control (NIFDC). ES cell line used in this study was established from C57BL/6 mice in our lab. Blastocysts were obtained by standard protocol from BALB/c mice in our lab.

Fifty p53 ^+/−-deficient mice were divided into two groups and administered 37.5 mg/kg MNU or citrate buffer (control). MNU was dissolved in citrate-buffered saline and adjusted to pH 4.5 [ 13] before single intraperitoneal administration on day 1. Five mice from each group were sacrificed immediately and at 4, 8, and 12 weeks after the administration. Thymus and spleen, which were the main tumor target organs, were dissected for histopathological examination and RNA extraction.

Mouse tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, and sectioned to about 5 μm and stained with hematoxylin and eosin (H&E) for histopathological examination.

Formalin-fixed, paraffin-embedded sections of thymus and spleen were processed for immunohistochemistry. Antibodies directed against CD3 (T-lymphocyte marker), CD20 (B-lymphocyte marker), and CD68 (macrophage marker) were used to classify the lineage of neoplastic cells in the thymus. Thymic malignant lymphoma or thymic sections for CD3, CD20, and CD68 staining were pretreated by incubation at 96 °C in Citra buffer (Zhongshan Golden Bridge Biocompany, Beijing, China) at pH 6 in a microwave for 10 min. Sections for CD3 staining were incubated with anti-CD3 antibody (clone LN10; Zhongshan Golden Bridge Biocompany), at 1:150 dilution, overnight at 4 °C after blocking with normal goat serum for 60 min at 37 °C. Sections for CD20 staining were incubated with anti-CD20 antibody (clone EP7; Zhongshan Golden Bridge Biocompany), at 1:200 dilution, overnight at 4 °C after blocking with normal goat serum for 60 min at 37 °C. Sections for CD68 staining were incubated with anti-CD68 antibody (clone PG-M1; Zhongshan Golden Bridge Biocompany), at 1:200 dilution, overnight at 4 °C after blocking with normal goat serum for 60 min at 37 °C. CD3, CD20, and CD68 immunoreactivities were all detected using a biotinylated rabbit anti-rat secondary antibody followed by an avidin-biotin-horseradish peroxidase complex, and visualized with diaminobenzidine. All immunohistochemical sections were counterstained with hematoxylin, dehydrated in graded concentrations of ethanol, and cover-slipped routinely using permanent mounting medium.

Spleen and thymus were dissected from the mice, immersed immediately in RNAlater stabilization reagent (Invitrogen, Carlsbad, CA, USA), and stored at −80 °C. Grinding of the tissues of three independent mice was performed in liquid nitrogen, followed by homogenization in TRIzol (Invitrogen). Total RNA was extracted in accordance with the manufacturer’s instructions. The amount of total RNA was determined by measuring the absorbances at 260 and 280 nm using a NanoDrop Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). All samples had an A ₂₆₀/A ₂₈₀ absorption ratio > 1.8. The RNA samples were reverse-transcribed to cDNA in a Reverse Transcription reaction mix using random hexamer primers, in accordance with the manufacturer’s instructions (Takara Bio Inc., Kusatsu, Japan).

Primers for RT-qPCR assays of Gapdh, Rn18s, Actb, B2M, Hprt, Rplp0, Gusb, and Ctbp1 were designed using Primer Premier 5.0 (Table 1). Real-time PCR was performed using a Roche LightCycler 480 detection system (Roche Diagnostics, Germany). All standards and samples were run in triplicate in 96-well reaction plates. The cycle conditions were as follows: 15 s template denaturation at 95 °C and then 40 cycles of denaturation at 95 °C for 5 s and elongation at 60 °C for 30 s. This was followed by melting curve analysis, and baseline and cycle threshold values (Ct values) were determined automatically for all plates using Roche LightCycler 480 software.

The mRNA expression stability of each candidate gene was analyzed using the freely available Microsoft Excel-based software packages geNorm ( https://​genorm.​cmgg.​be/) and Norm-Finder (moma.dk/normfinder-software). Raw Ct values were transformed into relative quantities using the formula 2 ^−∆ct. The obtained data were further analyzed using geNorm and NormFinder.

MNU is a widely used genotoxic carcinogen [ 13, 14] used to induce T-cell lymphoma in various mouse models, including in the current study (Fig. 1). MNU-treated and control mice were observed twice a week and clinical signs were recorded until sacrifice. Moribund mice were necropsied at the earliest opportunity, and all surviving animals were sacrificed and necropsied at the end of 26 weeks. The thymus and spleen were dissected from the remaining mice for histopathological determination of lymphoma diagnosis and tumor frequency statistics. A total of 65% of MNU-treated mice developed lymphomas, compared with none of the control mice (Fig. 2a). No tumors other than malignant lymphoma were observed. The incidences of lymphomas in the two major target organs were 65% in the thymus and 50% in the spleen (Fig. 2b). Thymus and spleen sections from MNU-treated mice were subjected to hematoxylin and eosin staining (Fig. 2c, d), which showed effacement of thymic corticomedullary architecture by diffuse sheets of lymphoblasts with large euchromatic nuclei, as well as moderate to high numbers of and infiltration of lymphoblasts through the thymic capsule. Besides, immunostaining showed that all neoplastic cells in malignant lymphoma sections were positive for CD3 (Fig. 2e, f) and negative for CD20 (Fig. 2g, h) and CD68 (Fig. 2i, j), indicating that the malignant lymphomas were of T-lymphocyte origin.

We evaluated the expression stabilities of eight commonly used reference genes ( Gapdh, Rn18s, Actb, B2M, Hprt1, Rplp0, Gusb, and Ctbp1) (Table 1) from different functional classes, to reduce the chance of coregulation of gene expression.

The primer sequences and sizes of the amplification fragments are shown in Table 2. Expression stability was assessed by RT-qPCR. The theoretical correlation coefficient (R ²) for quality assays is 1, but is usually set as >0.980, representing the fit of tested samples to the regression line generated by the standard curve. All primer pairs showed an R ² of 0.992–0.999, indicating exponential template duplication. The amplification efficiencies for the eight reference genes ranged from 95 to 105% (Table 2), within the acceptable range of 90%–110% [ 1], indicating the suitability of the selected primers. Ct values are represented by box-and-whisker plots in Fig. 3. All reference genes displayed similar expression patterns in thymus and spleen, with wide variations in expression levels among different genes. The Rn 18S gene exhibited the lowest mean Ct values in thymus and spleen (10.7 and 11.7, respectively) and Gapdh exhibited the highest values (26.2 and 25.0, respectively).

We analyzed the data using geNorm and NormFinder to determine the stability of the genes and to identify the most suitable endogenous controls. geNorm and NormFinder are both examples of Microsoft Excel-based software [ 15]. geNorm analyzes each potential housekeeping gene by comparing its variation with that of all other evaluated reference genes. In contrast, NormFinder separately analyzes sample subgroups and takes into account intra- and intergroup variation for normalization factor calculations. Both algorithms calculate relative expression stability values for each reference gene, and the gene with the lowest stability value is considered the most stable gene. We collected tissues from MNU-treated and control mice at 0, 4, 8, and 12 weeks (Fig. 1) and analyzed expression levels by RT-qPCR at the various time points. Stability values were averaged among the four time points. NormFinder analysis revealed stability values of 0.104–0.918 in the thymus (Fig. 4a). The most stable reference gene in the thymus was Ctbp1, followed by Gusb and B2M, while Actb was determined as the least stable gene. geNorm analysis confirmed that Ctbp1 was the most stable reference gene and Actb was the least stable, consistent with the results of NormFinder (Fig. 4b). The stability values in the spleen analyzed by NormFinder were 0.287–1.181 (Fig. 4c). The most stable reference gene in the spleen was Rplp0, while Rn 18S was the least stable. The geNorm results were consistent with those of NormFinder (Fig. 4d). Owing to the different algorithms adopted by geNorm and NormFinder, the stability values produced by them could not be compared directly, so the candidate reference genes were ranked according to their stability values evaluated by geNorm and NormFinder (Table 3).

The stabilities of genes during lymphomagenesis were also determined using NormFinder and geNorm. RT-qPCR data at each time point were grouped together and gene stability was analyzed across the time course. NormFinder analysis revealed stabilities of 0.169–0.873 in the thymus (Fig. 5a). The most stable reference gene was Ctbp1, followed by Gusb and Hprt, while Rn18s was the least stable. geNorm also identified Ctbp1 as the most stable reference gene and Actb as the least stable (Fig. 5b). Stability values in the spleen according to NormFinder ranged from 0.336 to 1.083 (Fig. 5c). The most stable reference gene in the spleen was Rplp0, while Rn18s was the least stable. The geNorm results were consistent with those of NormFinder (Fig. 5d).

To rule out the possibility that the result was dependent on the specific primer used, two additional primers were designed for each reference gene. Sequence and amplification efficiencies are shown in Additional file 1: Table S1. RT-qPCR was then performed for thymus RNA using the additional primers, and mean Ct values of the primers at each time point are presented in Additional file 1: Figure S1. Raw Ct values were transformed into relative quantities using the formula 2 ^−∆ct. The obtained data were further analyzed using geNorm and NormFinder. Consistent with our previous result, Ctbp1 was found to be the most stable gene both after MNU treatment (Additional file 1: Figure S2) and during lymphomagenesis (Additional file 1: Figure S3).