Epigenetic mediated zinc finger protein 671 downregulation promotes cell proliferation and tumorigenicity in nasopharyngeal carcinoma by inhibiting cell cycle arrest

Human NPC cell lines (CNE1, CNE2, HNE1, HONE1, SUNE1, 5-8F, 6-10B) were cultured in RPMI-1640 (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% fetal bovine serum (FBS) (Gibco-BRL, Carlsbad, CA, USA). Human immortalized nasopharyngeal epithelial cell line (NP69, N2Tert) were cultured in keratinocyte serum-free medium (Invitrogen) supplemented with bovine pituitary extract (BD influx, Biosciences, USA). 293 T cells were obtained from the ATCC (Manassas, VA, USA) and maintained in DMEM (Invitrogen) supplemented with 10% FBS. Four freshly frozen NPC samples and four normal nasopharyngeal epithelium samples were collected from patients undergoing biopsy at Sun Yat-sen University Cancer Center.

Total RNA was isolated from NPC cell lines using TRIzol Reagent (Invitrogen) following the manufacturer’s instructions, cDNA was synthesized using M-MLV reverse transcriptase (Promega, Madison, WI, USA) and amplified with Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen) using the CFX96 sequence detection system (Bio-Rad, Hercules, CA, USA) with the following primers: ZNF671 forward, 5′- GACTTAGACCTGGTTGTTGG -3′ and reverse, 5′- GTATTTAGCCAGGTGTAAGGT-3′. GAPDH was used as control for normalization.

NPC cell lines were treated with or without 10 μmol/L 5-aza-2′-deoxycytidine (DAC; Sigma-Aldrich, Munich, Germany) for 72 h, with the drug/media replaced every 24 h. DNA was isolated using the EZ1 DNA Tissue Kit (Qiagen, Hilden, Germany), then 1–2 μg DNA was treated with sodium bisulfite using the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instructions. Bisulfite pyrosequencing primers were designed using PyroMark Assay Design Software 2.0 (Qiagen), and were: PCR forward primer: 5′-GAATTTAGGTTAGGGATAGTTTGAT-3′ (F); PCR reverse primer: 5′-CCAAAAAAAAAATATTTCAATACC-3′ (R); sequencing primer: 5′-GG ATAGTTTGA TAGAAATAAAATG-3′(S). The PyroMark Q96 System (Qiagen) was used for the sequencing reactions and to quantify methylation.

The pSin-EF2-puro-ZNF671-HA or pSin-EF2-puro-vector plasmids were obtained from Land. Hua Gene Biosciences (Guangzhou, China); pSin-EF2-puro-Vector plasmid was used as a control. Stably transfected cells were selected using puromycin and confirmed using RT-PCR. SiRNAs targeting ZNF671 were obtained from GenePharma Co., Ltd. (Shanghai, China); siRNA #1 targets ZNF671-Homo-626 cDNA (sense strand: CCUUACACCUGGCUAAAUATT; antisense strand: UAUUUAGCCAGGUGUAAGGTT) and siRNA #2 targets ZNF671-Homo-279 cDNA (sense strand: GGAAGAAUGGGAGCUUCUUTT; antisense strand: AAGAAGCUCCCAUUCUUCCTT).

For the CCK-8 assay, cells (1 × 10³) were seeded into 96-well plates, incubated for 0–4 days, stained with CCK-8 (Dojindo, Tokyo, Japan), and absorbance values were determined at 450 nm using a spectrophotometer. For the colony formation assay, cells (0.3 × 10³) were seeded into 6-well plates, cultured for 2 weeks and the colonies were fixed in methanol, stained with crystal violet and counted.

Cells (2 × 10⁵) were seeded into 6-well plates, cultured for 24 h, serum-starved for 24 h to synchronize cells at the G1/S checkpoint, trypsinized, washed with ice-cold PBS, fixed in 70% ethanol, and stored at −20 °C until analysis. Before staining, cells were gently resuspended in cold PBS and RNase A was added into cell suspension tube incubated at 37 °C for 30 min, followed by incubation with propidium iodide (PI) (Beyotime) for 20 min at room temperature. The fluorescence intensity of the cells was analyzed by flow cytometry (Gallios; Beckman-Coulter, Germany).

BALB/c-nu mice (4–6 weeks old) were purchased from Charles River Laboratories (Beijing, China), and CNE2-vector or CNE2-ZNF671 cells (1 × 10⁶) were subcutaneously inoculated into the dorsal flank. Tumor size was measured every 3 days and tumor volumes were calculated using the equation: volume = D × d² × π/6, where D and d represent the longest and shortest diameters, respectively. All animal research was conducted in accordance with the detailed rules approved by the Animal Care and Use Ethnic Committee of Sun Yat-sen University Cancer Center and all efforts were made to minimize animal suffering.

The GSEA software tool (version 2.0.13, www.​broadinstitute.​org/​gsea/​) was used to identify KEGG pathways (MSigDB, version 4.0) that show an overrepresentation of up- or downregulated genes between ZNF671 high expression (n = 15) and ZNF671 low expression (n = 16) in GSE12452. Briefly, an enrichment score was calculated for each gene set (i.e., KEGG pathway) by ranking each gene by their expression difference using Kolmogorov-Smirnov statistic, computing a cumulative sum of each ranked in each gene set, and recording the maximum deviation from zero as the enrichment score.

Statistical analyses were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA). All data shown are representative of at least three independent experiments, and values are expressed as the mean ± SD. Differences between two groups were analyzed using the two-tailed unpaired Student’s t-test; p < 0.05 was considered significant. All data from this study has been deposited at Sun Yat-sen University Cancer Center for future reference (number RDDB2017000075).

To confirm our previous methylation data (GSE52068) (Additional file 1: Figure S1A), the promoter methylation level of ZNF671 was detected by bisulfite pyrosequencing analysis in other NPC (n = 8) and normal tissues (n = 8). The CpG islands and region selected for bisulfite pyrosequencing in the ZNF671 promoter region are shown in Fig. 1a. The methylation of ZNF671 (cg11977686) in NPC tissues were significantly increased compared with normal tissues (Fig. 1b and c). Similarly, ZNF671 (cg11977686) methylation levels in the NPC cell lines (CNE1, CNE2, SUNE1, HONE1, HNE1, 5-8F and 6-10B) were also increased compared with human immortalized normal nasopharyngeal epithelial cell line (NP69) (Fig. 1d and Additional file 1: Figure S1B; P < 0.05). These results indicate that ZNF671 promoter is hypermethylated in NPC.

To know the association between ZNF671 expression and its promoter methylation status in NPC, quantitative RT-PCR revealed ZNF671 mRNA was significantly downregulated in all seven NPC cell lines compared to normal nasopharyngeal epithelial NP69 cells (Fig. 2a). Analysis of microarray-based high-throughput NPC datasets (GSE12452) confirmed ZNF671 was downregulated in NPC tissues compared to normal nasopharyngeal tissues (Fig. 2b; P < 0.05). Furthermore, western blotting showed ZNF671 protein expression was downregulated in both the NPC cell lines and freshly frozen NPC tissues (n = 4) compared to normal samples (n = 4) (Fig. 2c and d; P < 0.05). To determine whether the downregulation of ZNF671 results from its promoter hypermethylation, immortalized normal nasopharyngeal epithelial cell line and NPC cell lines were treated with or without the demethylation drug 5-aza-2′-deoxycytidine (Decitabine, DAC). The ZNF671 methylation level were substantially decreased (Fig. 2e and Additional file 2: Figure S2; P < 0.05), while the ZNF671 mRNA were significantly increased (Fig. 2f; P < 0.05) in NPC cell lines compared with immortalized normal nasopharyngeal epithelial cell. The findings suggest that ZNF671 is downregulated in NPC and the downregulation of ZNF671 is associated with the hypermethylation of ZNF671 in NPC.

To assess the effects of ZNF671 on proliferation and metastasis in NPC, we subjected CNE2 and 5-8F cells stably overexpressing ZNF671 or the control vector to the CCK8, colony formation and Transwell migration and invasion assays. As shown in Fig. 3a and b, qPCR and western blotting validated that ZNF671 mRNA and protein level was obviously elevated after stably overexpressing ZNF671 in NPC cells. The CCK8 assay demonstrated that the cell viability of CNE2 and 5-8F cells stably overexpressing ZNF671 remarkably was much slower than that of cells expressing vector plasmid (Fig. 3c and d). Overexpressing ZNF671 reduced the colony formation ability of CNE2 and 5-8F cells (Fig. 3e), but did not significantly affect cell migratory or invasive ability (Additional file 3: Figure S3). These findings indicate that ZNF671 inhibits the proliferation abilities of NPC cells in vitro.

To further investigate whether silencing of ZNF671 affects the proliferation abilities of NPC cells, we transiently transfected NP69 and N2Tert cells with siZNF671 or control siRNA, and performed the CCK8 and colony formation assays. As shown in Fig. 4a and b, qPCR and western blotting confirmed that the ZNF671 mRNA and protein level was remarkably decreased after silencing of ZNF671 in NPC cells. The CCK8 assay that cells transfected with siZNF671 grew faster than cells transfected with control siRNA (Fig. 4c and d). Knocking down ZNF671 promoted NPC cell colony formation capability as determined by the colony formation ability (Fig. 4e). Collectively, these results indicate that silencing ZNF671 promotes cell proliferation in NPC.

Next, the effect of ZNF671 on the tumorigenicity of human NPC cells was examined in vivo. As shown in Fig. 5a and b, the tumors in the group injected with cells stably overexpressing ZNF671 grew at a slower rate and had smaller volumes than the vector control tumors. When the mice were sacrificed on day 30, the tumors formed by ZNF671-overexpressing cells were significantly lighter than vector control tumors (0.69 ± 0.18 g vs. 0.27 ± 0.14 g; *P < 0.05, **P < 0.01; Fig. 5c and d). Taken together, these results indicate that downregulation of ZNF671 enhances the tumorigenicity of NPC cells in vivo.

To further investigate the mechanism by which ZNF671 inhibits cell proliferation in NPC, we performed gene set enrichment analysis (GSEA) in the GEO database to identify pathways potentially linked to ZNF671. As shown in Fig. 6a, pathways related to hallmarks of the mitotic spindle and G2/M checkpoint genes were enriched in GSE12452 database. Indeed, we observed enrichment of gene sets associated with cancer, including the mitotic spindle and G2/M checkpoint pathways, in ZNF671-high expressing tumors; conversely, these pathways were not enriched in ZNF671-low expressing tumors.

Flow cytometry confirmed that overexpression of ZNF671 significantly decreased the percentage of cells in the G2/M phase (20.67% ± 0.34% vs. 6.40% ± 0.22% in CNE2 cells, 8.47% ± 1.20% vs. 4.04% ± 0.56% in 5-8F cells; P < 0.05) and increased the proportion of cells in the S phase (30.88% ± 0.12% vs. 41.12% ± 0.28% in CNE2 cells, 36.64% ± 0.92% vs. 51.94% ± 0.23% in 5-8F cells; P < 0.05; Fig. 6b). Conversely, silencing ZNF671 decreased the percentage of cells in the S phase (from 27.92% ± 4.3% to 14.05% ± 0.73% and 20.29% ± 1.6% in NP69-Si#1 and NP69-Si#2 cells, and from 25.21% ± 0.10% to 17.69% ± 4.32% and 16.18% ± 1.38% in N2Tert-Si#1 and N2tert-Si#2 cells; Fig. 6c; P < 0.05). Furthermore, bioinformatics analysis indicated that ZNF671 is involved in regulation of the cycle-related proteins cyclin D1 and p21. Overexpression of ZNF671 decreased the protein levels of cyclin D1 and c-myc, and increased p21 (Fig. 6d). Additionally, silencing ZNF671 increased the expression of cyclin D1 and c-myc and decreased the expression of p21 (Fig. 6e and f). Taken together, these data indicate that downregulation of ZNF671 in NPC promotes cell proliferation by preventing S phase cell cycle arrest.