Epigenetic upregulation of TET2 is an independent poor prognostic factor for intrahepatic cholangiocarcinoma

The present study was approved by the Ethics Committees at our institutes. Fifty-two consecutive patients with iCCA who underwent surgical resection at Kobe University Hospital between 2000 and 2016 were identified in the pathology archives. None had received neoadjuvant chemotherapy prior to surgery. Formalin-fixed paraffin-embedded (FFPE) tissue was used for RNA/DNA extraction and immunohistochemistry (IHC).

Histology slides of surgically resected specimens were reviewed, and cases of iCCA were classified into the small- and large-duct types according to previously described criteria and the WHO classification [1, 19]. Clinicopathological findings were obtained from electronically stored clinical records and histopathology reports. The findings of sequencing of KRAS and IDH1/2 and IHC for BAP1, p53 and SMAD4 in a previous study were used in the present study [1]. Mutations in KRAS (exons 2 and 3), IDH1 (codon 132) and IDH2 (codon 172) were analysed by Sanger sequencing using DNA extracted from FFPE tissue and following primers: forward 5′–AGGCCTGCTGAAAATGACTG–3′ and reverse 5′–GGTCCTGCACCAGTAATATGCA–3′ for exon 2 of KRAS; forward 5′–CCAGACTGTGTTTCTCCCTTCTC–3′ and reverse 5′–AGAAAGCCCTCCCCAGTCCTCA–3′ for exon 3 of KRAS; forward 5′–AAACAAATGTGGAAATCACC–3′ and reverse 5′–TGCCAACATGACTTACTTGA–3′ for IDH1 codon 132; forward 5′–AGAAGATGTGGAAAAGTCCC–3′ and reverse 5′–CAGAGACAAGAGGATGGCTAGG–3′ for IDH2 codon 172. Post-PCR-amplified products were separated by capillary electrophoresis on an ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Sequencing results were analysed using Sequencing Analysis 5.2 and SeqScape software (Applied Biosystems). IHC for BAP1, p53 and SMAD4 was conducted on one representative whole section in each case. Antibodies used were as follows: BAP1 (clone C–4; dilution 1:100, Santa Cruz Biotechnology), p53 (clone DO–7; dilution 1:300, Leica Microsystems, Wetzlar, Germany) and SMAD4 (clone B–8; dilution 1:100, Santa Cruz Biotechnology, Santa Cruz, CA). The completely negative nuclear staining of BAP1 was defined as a loss of expression, suggesting a BAP1 mutation. Diffuse nuclear staining of p53 was regarded as a positive result, indicating a p53 mutation. Cases with no detectable cytoplasmic or nuclear SMAD4 protein were scored as negative for SMAD4.

Tissue microarrays (TMAs) were constructed using 3 tissue cores (2 mm in diameter) obtained from one representative FFPE block of each case. Tissue cores were randomly obtained from tumour masses.

IHC for TET2 was performed using a Bond Max autostainer (Leica Microsystems) according to the manufacturer’s protocol. Deparaffinised sections were subjected to a heat pretreatment in citrate buffer for 20 min, followed by an incubation with a primary antibody against human TET2 (clone N2-2; dilution 1/100; GeneTex, Irvine, CA, USA). TET2 expression was observed in the cytoplasm and nuclei. Given that TET2 is a nuclear protein, only nuclear staining was assessed. Nuclear expression levels in TMA were semiquantitatively evaluated based on the percentage of positive cancer cells (score 0 = 0%; score 1 = 1–33%; score 2 = 34–66%; score 3 = 67–100%) and the intensity of expression (score 0 = negative; score 1 = weak; score 2 = moderate; score 3 = strong). Weak intensity of the expression (score 1) was defined as faint staining requiring examination at a high-power magnification (× 40 objective lens), while strong intensity of the expression was defined as brisk staining with clear contrast to the background. Moderate intensity (score 2) was defined as staining between scores 1 and 3. IHC scores in individual cases were assessed by multiplying percentage and intensity scores (range 0–9). In cases, in which TET2 was negative in TMA, additional staining on whole sections was performed.

Areas consisting predominantly of tumour cells were selected for RNA extraction under a microscope. The background liver parenchyma and large bile ducts (5 cases each) were used as a control group. Total RNA was extracted from FFPE sections using the AllPrep DNA/RNA FFPE Kit (Qiagen, Hilden, Germany). One microgram of RNA was treated with DNAse I Amplification Grade (AMPD1-1KT; Sigma-Aldrich, St. Louise, MO, USA) and then reverse transcribed using a High Capacity cDNA reverse transcription kit (4,368,814, Applied Biosystems) as per the manufacturer’s protocol. Real-time PCR was conducted in triplicate using Luna® Universal qPCR Master Mix (New England BioLabs, Ipswich, MA, USA) as the SybrGreen Probe on an Ariamx Real-Time PCR System (Agilent, Santa Clara, CA, USA). Primer sequences for PCR were as follows: TET2 F GCTTCCATTCTGGAGCTTTG, TET2 R GGACATGATCCAGGAAGAGC. Large group-specific differences were observed in housekeeper genes therefore data presented as sample TET2 Ct from equivalent original input RNA (lower Ct indicates a higher expression level).

Genomic DNA was extracted from areas in FFPE tissue sections that predominantly of tumour cells. DNA was extracted using the AllPrep DNA/RNA FFPE Kit (Qiagen). DNA content was assessed using the NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Enzymatic conversion was performed on 1 µg of DNA with the Enzymatic Conversion Module (New England Biolabs). Primer sequences for converted DNA were designed by Methprimer [12] and manufactured by Eurofins Genomics (Ebersberg, Germany). Semi-nested PCR was performed with the second primer (inner) containing 5′-prime octamer tags for the sequencing of barcodes. Primer sequences for amplification from enzymatically converted DNA were as follows: TET2 Outer F GGAAGTAAGATGGTTGTTTTTTAGG, TET2 Outer R AAACTTCCCTCTTCCCTCTTAATATT, TET2 Inner F GGAAGTAAGATGGTTGTTTTTTAGG and TET2 Inner R ACACTACAAAATTTACTCCCCAATC. PCR was performed according to the Hot Start protocol for EpiMark Taq polymerase (New England Biolabs). The next-generation sequencing of PCR products was conducted by Amplicon-EZ (Genewiz, Leipzig, Germany), and the data obtained were initially analysed in the Unix shell to separate patients according to octamer barcodes and convert fastq files to fasta, followed by the BiQ Analyzer HT software [15], which revealed the methylation state of each individual CpG site.

Statistical analyses were performed using JMP statistical software (version 12; SAS Institute, Cary, NC, USA). Continuous variables not showing a bell-shaped distribution were assessed using the unpaired t test or Mann–Whitney U test, whereas categorical variables in each group were compared using the X² test or Fisher’s exact test. Survival curves were constructed using the Kaplan–Meier method and compared between two groups by the Log-rank test. Univariate and multivariate analyses of multiple prognostic factors were performed on prognostic factors assessed by the Cox proportional hazards model. In RT-qPCR and DNA methylation analyses, values more or less than 2 standard deviations from the mean were considered to be outliers and, thus, were excluded.

Among the 52 cases examined, 33 (63%) were classified as the small-duct type and 19 (37%) as the large-duct type. Eighteen patients (35%) had a history of chronic liver disease and two (4%) had features of established cirrhosis. Tumours were larger than 5 cm in 25 cases (48%) and lymph node metastasis was confirmed in 14 cases (27%). Intrahepatic metastasis including satellite nodules was observed in 16 cases (31%). Molecular or IHC studies confirmed KRAS mutations in 9 cases (17%), IDH1 mutations in 4 (8%), the loss of BAP1 expression in 12 (13%), the diffuse expression of p53 in 13 (25%) and the loss of SMAD4 expression in 7 (13%). IDH2 was the wild type in all cases.

RT-qPCR revealed that the mRNA expression levels of TET2 were significantly higher in iCCA tissue than in background liver/bile duct tissue with a group average Ct difference of 1.5 PCR cycles, equivalent to a 2.8-fold difference (p = 0.004; Fig. 1A). However, no significant difference was observed in CpG methylation at 8 CpG sites in the promoter of TET2 when all iCCA samples were compared to non-cancer tissue (Fig. 1B).

Immunostaining for TET2 was conducted to examine the protein expression of TET2 in 52 cases of iCCA relative to background liver/bile duct tissue. The non-neoplastic cholangiocytes of the small and large bile ducts did not show nuclear immunoreactivity for TET2. In contrast, 42 cases of iCCA (81%) showed variable degrees of expression in TMA (Fig. 2). TET2 expression was located in the nuclei and cytoplasm, and the nuclear expression was slightly more pronounced than cytoplasmic staining in most cases. The remaining 10 cases of iCCA (19%) were negative for TET2 in TMA. However, additional immunostaining on whole sections of those cases demonstrated focal TET2 expression. Based on IHC scores of TMA, cases were classified as TET2-high (IHC scores 4–9; n = 25) and TET2-low (IHC scores 0–3; n = 27).

Table 1 compares clinicopathological features between TET2-high and -low cases. No significant differences were observed in any of the parameters examined. No correlations were found between TET2 expression and histological subtypes. The frequencies of KRAS or IDH1 mutations and the loss of BAP1 or SMAD4 expression were also similar. Ct values in TET2 mRNA RT-qPCR on TET2-high cases were not significantly different from those for TET2-low cases (Table 1); however, both were significantly lower than those for non-cancer tissue (Fig. 3).

In order to examine the relationship between TET2 expression and TET2 promoter methylation, the methylation of 8 CpG sites in the promoter region was quantitatively assessed. The mean value of methylation in the 8 CpG sites did not significantly differ between TET2-high and -low cases (2.31 ± 0.15% vs. 2.62 ± 0.21%; p = 0.238; Table 1). However, a comparison of individual CpG sites revealed that methylation levels at two CpG sites in TET2-high cases were significantly lower than those in TET2-low cases (Fig. 4).

As shown in Fig. 5, overall and recurrence-free survival were significantly worse in patients with TET2-high iCCA than in those with TET2-low iCCA (p = 0.014 or p = 0.044, respectively). In a multivariate analysis, TET2 and other potential prognostic factors that showed a significant (p < 0.05) or slight difference (p < 0.20) in the univariate analysis were applied to the Cox proportional hazards model. TET2 overexpression, the large-duct histological type and intrahepatic metastasis were identified as independent poor prognostic factors in patients with iCCA (Table 2).