Background
Triple-negative breast cancer (TNBC) is an aggressive histological subtype, which is known as a breast cancer that lacks expression of ER, PR and HER2 [
1] and accounts for 15% of all breast cancer types. Currently, chemotherapy is the main treatment for TNBC [
2], such as anthracycline and paclitaxel. However, due to p53 mutation in TNBC anthracycline-related drug resistance has been reported [
3]. Cisplatin has an effective role in breast cancer, especially BRCA1-associated cancers, which are normally triple-negative type [
4]. A previous study found that the response to DDP-based drugs in breast cancer with
BRCA1
C61G
mutation is poorer than that with homozygous
BRCA1 mutation [
5]. The secondary mutation contributes to the restoration of reading frame of BRCA1 protein [
6]. Therefore, it is supposed that revertant mutation might be a source of resistance to DDP in TNBC.
In our study, the TNBC cell line 231/wt and DDP-resistant cell line 231/DDP were used. Differences were compared between chemo-sensitivity to different drug agents, intracellular DDP accumulations and apoptosis. We found: all results show that the cells line 231/DDP have DDP-resistance character; then, increased ABC transporters are induced by the activation of NF-κB pathway in 231/DDP cells.; furthermore, ETS1, RPL6, RBBP8, BIRC2, PIK3A and RARS are six important genes for DDP-resistance based on microarray analysis, PPI network and expression validation. However, it had been reported enforced over-expression of ETS1 induced IKKα mRNA and protein expression as well as IKKα promoter activity [
7]. Our results suggested that the protein expression of ETS1 and IKKα are significantly up-regulated in 231/DDP cells. In addition, inhibition of ETS1 expression enhanced chemo-sensitivity to DDP and reversed the activation of NF-κB pathway in 231/DDP cells. Besides, stable knocking-down ETS1 increased the efficacy of DDP in mouse xenograft models.
Methods and materials
Cell lines and cell culture
The TNBC cell line 231/wt was bought from the cell resource center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The DDP-resistant human TNBC cell line 231/DDP was obtained by stimulating 231/wt cell lines with different DDP concentrations, as described in our previous work [
8]. These cell lines were recovered in the medium without DDP, then was cultured in the medium with DDP (1.5 μg/mL) on the next day in the atmosphere of 5% CO
2 at 37 °C.
Detection of intracellular DDP concentration using ICP-MS method
The 1 μg/mL DDP was added in both of the 2 cell lines at the logarithmic phase, when the cell inhibitory concentration (IC
50) value was “0”. After 48 h pretreatment, the supernatant was abandoned, and the cells were washed in PBS for 3 times, and then collected by cell scraper. Thereafter, cells were suspended in lysis buffer containing concentrated nitric acid, and incubated at 60 °C for 20 min. Then, intracellular DDP concentration was measured. The splitting cells were transferred into a 1.8 mL EP centrifugal tube, and then put these into liquid nitrogen and water bath for 1 min, respectively. After repeating for 3 times, the DDP concentration was measured based on the inductively coupled plasma mass spectrometry (ICP-MS) method [
9].
Cell viability
MTT assay was used to measure the drug resistance of DDP-resistant cell line. In brief, cells were inoculated in the 96-well plate, 5000 cells per well. After 24 h incubation, if all cells were attached, which could be separately treated with four drugs as DDP, doxorubicin (DOX), paclitaxel and cyclophosphamide (CTX). The specific operation steps is that DDP was dissolved in amide,
n,
n-dimethyl-formicaci (DMF) (2 mg/mL, 6.67 mM) then diluted by phosphate buffer solution (PBS). DOX was dissolved in dimethyl sulfoxide (DMSO) (2 mg/mL, 3.45 mM) then diluted by PBS. CTX was dissolved in DMSO (2 mg/mL, 7.17 mM) then diluted by PBS. Paclitaxel was dissolved in DMSO (2 mg/mL, 2.34 mM) then diluted by PBS. After 48 h treatment, the cells were incubated in MTT for 4 h, and then DMSO was added and shocked for 10 min. OD value of the survival cells were determined under 490 nm wave, with the reference under 630 nm. On this basis [
10], the IC
50 value in each group was calculated.
Flow cytometric analysis of apoptosis
Extent of apoptosis was measured by Annexin V-FITC apoptosis detection kit (Invitrogen Corporation, California, USA) according to supplier’s instruction. Briefly, cells were treated with 1 μg/mL DDP for 48 h, collected and stained with Annexin V-FITC, then analyzed by using FACScan flow cytometer (Becton–Dickinson, Newjersey, USA).
Microarray analysis and PPI network analysis
There were six samples in the following GeneChip probe array analysis: DDP-resistant (231/DDP, n = 3) and non-resistant breast cancer cell lines (231/wt, n = 3). First, total RNAs in each sample were extracted by the TRIzol method (Invitrogen), and then examined by the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). Next, the RNAs were amplified and labeled using the GeneChip WT PLUS reagent kit (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s instruction. Afterwards, the labeled RNAs were hybridized to Affymetrix GeneChip Human Transcriptome Array 2.0 in hybridization oven (Affymetrix model 640) for 16 h at 45 °C [
11,
12].
Quantitative real-time reverse transcription-PCR
As aforementioned, total RNA was extracted by the TRIzol method (Invitrogen), and was then reversely transcribed into cDNA according to the manufacturer’s instruction of the TaqMan reverse transcription kit (Applied Biosystems) (Logan et al. 2006). Following, the quantitative real-time reverse transcription-PCR (qRT-PCR) was performed to calculate gene expressions, with GAPDH as the internal reference. Primer sequences of the genes are listed in Table
1. Rotor-Gene6 software was used to calculate the Ct value, and gene expressions were calculated by 2
−ΔΔCt method [
13].
Table 1
Primer sequences of genes
ETS1 | F: TTACTCAGCGCCTCGTCCT | 59.9 |
R: GATCCCCAGTCGTTGCTGTT |
RPL6 | F: TCAGAGGAATTGGCAGGTA | 61.4 |
R: AGGCACATCTTCAGTAGGA |
BIRC3 | F: TTGTGATGGTGGCTTGAG | 61.2 |
R: AGTGGTATCTGAAGTTGACA |
RBBP8 | F: TGAAGAAGCAAGAGCAGAA | 58.1 |
R: TGGAATGTAGCGGAATCG |
RARS | F: GAAGCGAGCATATCAGTGT | 58.3 |
R: AGCCAGGTCAGATGTATCA |
PIK3A | F: CGAGGTTTTGCTGTTCGGTG | 62.4 |
R: CAGGCCAAACCTCTGGCTAA |
Western blot
Total proteins were extracted and protein concentrations were evaluated using Bradford assay (Pierce Biotechnology Inc., Rock-ford, USA). Western blotting assay was performed as described previously [
3]. The antibodies against ETS1(ab26096), MRP2(ab3373), BRCP(ab3380), P-gp(ab103477), P38(ab31828), p-P38(ab45381), IKKα(ab32041), IKKβ(ab32135), and NF-κB (ab16502) were purchased from Abcam.
shRNA transfection
PHY-310-GFP plasmid expressing human ETS1 was provided by Hanyi Biotechnology Shanghai. For the knockdown experiment, the ETS1 shRNA (5′-CGCUAUACCUCGGAUUACU-3′) was cloned into PHY-31-GFP vector. The 231/DDP cells were subcultured in a 6-well plate for 24 h, with a concentration of 70–80%. 231/DDP was transfected stably PHY-310-GFP-shETS1 by using Lipofectamine™ 2000 Reagent (Invitrogen, USA), followed by selection in 2-μg/mL puromycin. Stable ETS1 knockdown cells were used in the subsequent study.
Immunofluorescence assay
Cells were placed on a glass slide at the density of 1.0 × 105 cells/mL. Cultured for 48 h, the cells washed for with PBS and then fixed with 4% paraformaldehyde for 20 min at 4 °C. Cells were permeabilized using 0.3% Triton X-100/PBS for 20 min and washed with PBS. The cells were then incubated for 30 min in the 0.5% BSA. Diluted primary antibody (1:50) was applied to each coverslip and incubate overnight at 4 °C. After washing in PBS, the cells were incubated with rabt antibody at a 1:200 dilution for 1 h at room temperature in the dark and followed by DAPI nuclear staining (1 μg/mL) for 5 min. After washing, the images were taken using a Zeiss Laser Scanning Confocal Microscope (LSM7 DUO).
To construct the IKKα promoter, we amplified the promoter region from − 217 to − 2216 from transcription start site by PCR using hot-start DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA). A 3-kb fragment containing KpnI and XhoI sites was then ligated into the PCR2 vector by using a Plasmid minni Kit I (200) (OMEGA). The promoter fragment was excised from IKKαby digesting it with KpnI and XhoI and then clone in PGL3-Basic vector (IKKα-NC) and IKKα-luciferase vector (IKKα-OE) to produce promoter luciferase report.
Sub-confluent cells cultured in 6-well plates were transiently co-transfected with luciferase reporter and internal control plasmids, using the DNAfectin Transfection Reagent according to the manufacture’s protocol. Cells were lysed in passive lysis buffer, and luciferase assay was performed using dual-luciferase reporter assay kit in 48 h post transfection. Renilla luciferase activity was used as control for transfection was performed in triplicate.
Chromatin immunoprecipitation (ChIP)
ChIP was performed using ChIP assay kit (Cell Signaling Technology, CST, USA) according to the manufacture`s instruction. The main step is that cells in a 10-cm culture plate were crosslinked for 10 min by 1% formaldehyde. Crosslinking was neutralized by 0.2 M glycine. Cells were collected and suspended in lysis buffer (25 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 1% SDS and 5% glycerol). Genomic fragments were sonicated to a proper length. Protein–DNA complexes were precipitated with ETS1 antibody or immunoglobulin G overnight at 4 °C. The complexes were purified by protein A/G magnetic beads and the crosslinks were reversed at 68 °C. Quantitative PCR was performed, after DNA fragments were purified. Primer sequences used in ChIP-qPCR are as follows: IKKa 5′-GTGGTTCCGTTCAGCCCT-3′ (Forward), 5′-TGCTCGCGCGTCTTTG-3′ (Reverse); U2 5′-ATCGCTTCTCGGCCTTTTGG-3′ (Forward), 5′-AGGTCGATGCGTGGAGTGGA-3′ (Reverse).
Mouse xenograft studies
Four-week old female BALB/C nude mice, weight of 15–16 g, were obtained from Shanghai SLAC Laboratory Animal Company (Shanghai China). The mice were housed specific pathogen-free conditions at 22 ± 2 °C, at 70% relative humidity and under a 12-h light/dark cycle. Six-week old female nude mice, approximately 20 g, were transfected 231/DDP cells (sh-ETS1 and empty vector) were harvested at a concentration of 1.0 × 107 cells/mL and suspended cell (0.2 mL) subcutaneously implanted into the left second breast fat pad of each mouse. Tumor growth was examined every 3 days, and tumor volume was calculated using the equation V = D × d2/2 (V, volume; D, long diameter; d, short diameter). When the average tumor size reached approximately 60 mm3, DDP was administered 2 times per week by intraperitoneal injection at a dose of 4.2 mg/kg. A month after the injection, mice were killed and the subcutaneous growth of each tumor was examined.
Statistical analysis
The SPSS 19.0 software was used to perform the statistical analysis.
P values less than 0.05 were considered significant. All the data were presented using “mean ± SD”, each experiment was repeated for three times [
14].
Discussion
Drug resistance is a major barrier in cancer treatment [
18]. Although DDP has been applied for TNBC treatment, drug resistance is detected. In the present study, 231/DDP cell line had a higher IC
50 value of DDP than 231/wt cell line (Fig.
1a). Meanwhile, 231/DDP cell line had a lower intracellular DDP concentration compared with 231/wt cell line, indicating 231/DDPcell line had a higher excretive ability of DDP, which might explain its strong drug resistance. Moreover, expressions of three drug-resistant membrane proteins (MRP1, P-gP and BCRP) [
19,
20] were remarkably increased in 231/DDP cell line. Collectively, these might be the physiochemical and molecular basis of DDP-drug resistance mechanisms.
ETS1 is a TF regulates genes involved in stem cell development, tumor genesis and metastasis [
21]. In drug-resistant MCF-7 breast cancer cells, ETS1 is overexpressed and results in up-regulation of MDR1 [
22]. Thus, down-regulation of ETS1 via shRNA stably transfection might be a promising treatment for MDR breast cancer therapy [
23]. MiR-200c counteracts trastuzumab resistance by suppressing TGF-β signaling and targeting ZEB1 in breast cancer [
24]. ETS1 could regulate expression of ZEB1 [
25], implying that targeting ETS1 might also counteract the drug resistance. In MCF-7/ADR cells, silencing of ETS1 by down-regulating MDR1 reverses adriamycin resistance [
22]. Consistent with these previous studies, in our study, ETS1 was overexpressed in 231/DDP-resistant cell line via microarray analysis and expression validation experiment (Fig.
4). Meanwhile, down-regulation of ETS1 via shRNA stably transfection remarkably increased DDP response by reducing IC
50 to DDP and increasing intracellular DDP concentration (Fig.
4). These give potent evidence that knockdown ETS1 might be an effective strategy to reverse DDP-resistance in TNBC.
In our study, we used public data deposited in TCGA database [
26] and performed survival analysis in breast cancer with different ETS1 expressions, and found high ETS1 expression was significantly associated with poor survival in breast cancer (Fig.
3c), which was consistent with previous findings.
Activation of the NF-κB canonical pathway, leading to the translocation of NF-κB into the nucleus, is one of the strategies which leading cancer cells become drug resistance [
27]. Signaling of ETS1/P38 has been proposed to play an important role in the development of tumor [
25,
28‐
31]. Several studies have revealed that ETS1 is over-expression in drug resistant cancer cells [
21‐
23]. As our research found that the high expression of ETS1 and IKKα, not IKKβ,in 231/DDP cells. On the other hand, the binding of ETS1 leads the down-regulation expression of IKKα and ABC transporters. Thus, we hypothesize that high expression of ETS1 may influence the activation of NF-κB [
32], though the IKKα pathway not IKKβ and further leading to down-regulation of ABC transporters. Our team has proved it though luciferase assay and chromatin immunoprecipitation technique (ChIP).
Authors’ contributions
YZ and JW performed the experiments. YZ performed the data analyses and wrote the manuscript. MY helped perform the analysis with constructive discussions. BW contributed significantly to analysis and manuscript preparation. JS and BS prepared for the study. HC contributed to the conception of the study. All authors read and approved the final manuscript.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.