Background
The head and neck squamous cell carcinoma (HNSCC) represents malignant tumors arising primarily in the oral cavity, tongue, floor of the mouth, tonsils, pharynx and larynx. Worldwide HNSCC is the fifth most common cancer and it accounts for about 6 % among all cancers [
1]. This tumor originates from various anatomic structures including the craniofacial bones, soft tissues, salivary glands, skin, and mucosal membranes [
2].
The main risk factors for larynx squamous cell carcinoma (LSCC) are smoking and alcohol consumption [
3]. Family history is another important risk factor for this cancer, suggesting that genetic factors may contribute to susceptibility of this disease [
4]. Others aspects that can modify cancer risk factors of the head and neck are the polymorphisms in drug metabolizing enzymes (DMEs) and prevalence of variant genotypes of cytochrome P450 (CYP) 1A1, 1B1, 2E1 or glutathione-S-transferase M1 (null). Furthermore, strong associations of the polymorphic genotypes of DMEs with cases of pharyngeal and oral cavity cancer who were tobacco chewers or alcohol users demonstrate that gene-environment interactions may explain differences in genetic susceptibility for cancers of the oral cavity, pharynx and larynx [
5].
Some authors have reported that DNA alterations are responsible for the onset of carcinogenesis that usually occur in genes involved with proteins regulating cell cycle, cell growth, and differentiation. These are classified as oncogenes and tumor suppressor genes [
6]. In HNSCC, the oncogenes
H-ras,
c-myc,
EGFR and
TGF-β are often activated and the tumor suppressor genes such as
TP53,
p16,
FHIT,
PTEN,
Rb and
APC are inactivated [
7,
8].
Other factors that may contribute to LSCC include diet, oral hygiene, body mass, environmental pollution, certain working conditions associated with industries such as metallurgy and petrochemical and infections by human papillomavirus - HPV, particularly types 16 and 18 and Epstein-Barr virus which appear to be associated with the development of more aggressive tumors [
7,
9‐
11]. The treatment for this neoplasm is defined depending on the type of cell, degree of differentiation, location, extent, presence of lymph node metastases, and macroscopic characteristics with bone and muscle tumor involvement. Conventional methods used for treatment are surgery, chemotherapy, and radiation therapies, but all these methods are considered highly invasive. Surgery can cause irreversible aesthetic injuries with possible functional alterations [
12]. However, some plants have been used in the treatment of cancer as alternative therapies in an attempt to soften the damage caused by conventional methods. The
Euphorbia tirucalli (
E. tirucalli), popularly known as aveloz, which is used in the herbal treatment of asthma, ulcers, warts and tumors in general has attracted scientific interest [
13,
14].
Originating from Africa,
E. tirucalli belonging to the family Euphorbiaceae, was subsequently introduced in other countries, it has some compounds that have been scientifically proven to have biological activities such as antiviral, anticancer for breast, antibacterial, anti-inflammatory, antimutagenic, antitumor and larvicidal [
13,
15‐
18]. In addition, some authors have reported that a lectin isolated from the latex of
E. tirucalli, called Eutirucallin showed biological activities such as neutrophils recruitment and cytokine production by macrophages [
19]. An alternative that justifies its antitumorigenic potential is antimutagenicity. Substances with antimutagenic potentials increase the efficiency of repair mechanisms thereby acting as protective agents that decrease the frequency of DNA damage while controlling the disorderly proliferation of tumor cells [
17].
The euphol (tetracyclic triterpene alcohol isolated from the latex of
E. tirucalli) showed anticancer effects, inhibiting the growth of human gastric cancer cells and tumor development, demonstrating its great value and potential for use in disease therapy [
20]. Anti-inflammatory properties of euphol was observed in skin diseases, because it markedly inhibited TPA (12-O-tetradecanoilphorbol-13-acetato)-induced inflammatory response, demonstrating that euphol can be used as an alternative therapy in skin diseases [
21].
To investigate the effects of E. tirucalli in LSCC, we evaluated the influence of this herbal medicine on the morphology, cell proliferation and gene expression in Hep-2 cells. We also identified the signaling pathways where genes modulated by E. tirucalli participate, which are important for tumorigenic and the inflammatory process.
Methods
Hep-2 culture conditions
The Hep-2 cell line originally established from an epidermoid carcinoma of the larynx (ATCC, Rockville, Maryland, USA), was obtained and seeded at a density of 1 × 106 cells/ml per 75 cm2 culture flask (Corning, NY, USA). Minimum Essential Medium (MEM - Cultilab, Campinas, SP, Brazil) was used at pH 7.5 and supplemented with 10 % fetal calf serum (Cultilab), 1 % non-essential amino acids and 1 % antibiotic/antimycotic (Invitrogen Corporation, Carlsbad, CA, USA) and cultured at 37 °C under an atmosphere of 5 % CO2.
Pharmacological treatments
The Hep-2 cells were subdivided into three groups: a) control that was not manipulated, b) the group that was submitted to the addition of vehicle (ethanol) and c) an experimental group where E. tirucalli latex was added at concentrations of 0.25 to 250 μg/ml. The experiments were conducted for periods of 1, 3, 5, and 7 days to determine the statistically significant time for further use in the methodology, for all the three groups.
The sap from E. tirucalli was initially extracted with hexane through an incision in the trunk and branches of the adult plant, and the resulting precipitate was extracted with n-butanol. The active fraction of this latex, diluted in this polar solvent, was used to treat the cells. In this butanol fraction of the E. tirucalli latex, ingenol-3-hexanoate was used to obtain a useful composition for the treatment of disease. Synthesis and modifications were done by Kyolab Laboratories (Campinas, Brazil), by Dr. Luiz Francisco Pianowski.
Separation of the butanol fraction by HPLC (High Performance Liquid Chromatography) allowed the compounds present to be taken off in group scales, mainly by size. In a column chromatography separation with silica gel Sephadex G75, using a mixture of hexane:ethyl acetate (0 to 100 %), eight fractions were separated from the butanol fraction of the latex extract. But one of them show the best presence of components with higher polarity, with solubility and affinity characteristics with the substrate, then this fraction was submitted to tests to verify its anticancer action, as disclosed in the “patent of the active fraction of a polar solvent extract from the latex of Euphorbiaceae plants” (Additional file
1) and results in decreased of growth of seven cancer cell lines [
22].
Growth curve
Hep-2 cells were seeded in triplicate at a density of 5 × 104 cells in plastic 6-well plates and divided in three groups. The control group was grown on complete medium, the other groups were submitted to the addition of vehicle (ethanol), whereas E. tirucalli latex was added to the experimental group. Twenty four (24) hours later, when the cells had already adhered, Hep-2 cultures were incubated with serum free medium (MEM 0 %). After an additional 24 h, the control group was maintained in complete medium without any pharmacological manipulation, whereas vehicle (ethanol) was added to the other groups and E. tirucalli latex was added to the experimental group.
The cell morphology was observed on each day. The cytotoxic effects of the E. tirucalli on the proliferation of Hep-2 cells were investigated in three experimental groups at 1, 3, 5 and 7 days. The cells were harvested, stained with trypan blue and counted using the Countess® Automated Cell Counter (Invitrogen®). Significant differences between the groups were determined by one-way analysis of variance (GraphPad Prism 5) and statistical significance was assumed when P <0.05. The same experiment was repeated twice.
Hep-2 cells were seeded at a density of 1 × 10
6 cells/ml in 75 cm
2 culture flasks in complete medium (control group), vehicle (ethanol) was added and they were incubated with
E. tirucalli latex for 3 days (experimental group). The RNA from Hep-2 cells (three groups) was extracted using Trizol [
23] following treatment with DNase (Invitrogen). cDNA synthesis was performed using a High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.
Rapid Subtraction Hybridization (RaSH)
The
RaSH technique [
24] was performed with two subtractions. The first was termed “Sub I”, in which the Hep-2 control cells were referred to as
tester and the cells treated with
E. tirucalli latex were termed
driver. In the second subtraction, “Sub II,” the opposite test was performed.
The first cDNA strand was obtained by reverse transcriptase with 2 μl of oligo (dT) (50 mM) and 2 μl of 10 mM dNTPs at 65 °C for 5 min. The samples were immediately placed on ice for 1 min and 2.0 μl of 0.1 mM DTT, 1 μl of 40 U/μl RNA-OUT and 4.0 μl of 5X First-Strand Buffer [250 mM Tris-HCl (pH 8,3), 375 mM KCl, 15 mM MgCl2] were added. The samples were incubated at 42 °C for 2 min and 1.0 μl of Superscript™ II reverse transcriptase (RT) (200 U/μl) was added. The samples were incubated again at 42 °C for 50 min and then at 70 °C for 15 min. Segments of β-actin cDNA were also amplified to verify the quality of these reactions.
The second strand of cDNA was synthesized in reactions containing 30 μl of 5X Second Strand Buffer, 3 μl of 10 mM dNTPs, 1 μl of DNA ligase (10 U/μl), 4 μl of DNA Pol I (10 U/μl) and 1.0 μl of RNase H (2 U/μl). The samples were incubated for 2 h at 16 °C before the addition of 2 μl of T4 DNA Pol (5 U/μl) and further incubation for an additional 5 min. The action of the enzyme T4 DNA Pol was inhibited by the addition of 10 μl of 0.5 M EDTA. Phenol/chloroform extraction was used to purify the sample and the pellet was resuspended in 45 μl of water. The cDNA was used in amplification reactions for segments of GAPDH and was subsequently digested with 2 μl of MboI enzyme (10 U/μL) and incubated for 1 h at 37 °C. Finally, over 1 μl of this enzyme was added to the reaction, and the samples were incubated overnight at 37 °C.
A volume of 4.1 and 4.5 μl, of the adapters XDPN-14 5′-CTGATCACTCGAGA and XDPN-12 5′-GATCTCTCGAGT (Sigma Chemical, final concentration 10 mM) was added to the cDNA respectively, 8 μl of 5X T4 DNA ligase buffer Invitrogen©, heated at 55 °C for 1 min, and cooled down to 14 °C within 1 h was also added. The cDNA received 3 μl (9 U) of T4 DNA ligase (3 U/μl), ligation was carried out overnight at 14 °C. After phenol/chloroform extraction and ethanol/glycogen precipitation, the mixtures were diluted to 100 μl with TE buffer (10 mM Tris/1 mM EDTA); 40 μl of the mixtures were used for PCR amplification.
The PCR mixtures were set up using 10 μM XPDN-18 5′-CTGATCACTCGAGAGATC, 0.4 mM dNTPs, 10 × PCR buffer, 1.5 mM MgCl2 and 1U Taq DNA polymerase (Invitrogen). Thermocycler conditions were one cycle at 72 °C for 5 min, followed by 25 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min, ending in a final extension at 72 °C for 3 min. Ten (10 μg) micrograms of purified PCR product (tester) was digested with 10 U/μl XhoI (Invitrogen) for 6 h at 37 °C and followed phenol/chloroform extraction and ethanol precipitation.
One-hundred nanograms of the tester cDNA were mixed with 5 μg of the driver cDNA in hybridization solution (0.5 M NaCl, 50 mM Tris/HCl, SDS 2 % and 40 % formamide) and, after heating at 99.9 °C for 5 min, they were incubated at 42 °C for 1 h, and 42 °C for 48 h. After extraction and precipitation, the hybridization mixture (1 μg) was ligated with XhoI-digested pZero plasmid and transformed into competent bacteria. Bacterial colonies were picked and used as DNA template for PCR. Clones were sequenced using an automated DNA sequence and homologies sequences were searched using the BLAST program. Gene ontology (GO) annotation was used for the functional classification of up- and down-regulated genes using terms from Gene Ontology database.
The genes were further analyzed through Ingenuity Pathway (IPA - Ingenuity Systems©) to relate the differentially expressed genes with biological functions and processes in which these genes are involved and evaluate the main networks of interaction between them.
Quantitative PCR - RT-qPCR
The RNA from control, vehicle (ethanol) and E. tirucalli latex treated Hep-2 cells was extracted and cDNA synthesis was performed as described above.
Five differentially expressed genes were selected for validation by quantitative real time PCR experiments according to their direct or indirect involvement in tumorigenesis. Their expression was checked in treated samples relative to matched non-treated samples.
The primers were manually designed with: 19–23 bp length, 30–80 % GC content and a short amplicon size (80–120 bp). Their sequences are shown in Table
1. Real-time PCR was performed in triplicate using a 7500 Fast Real-Time PCR System (Applied Biosystems). Reaction mixture consisted of a 20 μl volume solution containing 10 μl of Power SYBR Green PCR Master Mix (Applied Biosystems).
Table 1
Primers for the selected genes. ANXA1, ITPR1, CD55, NGFRAP1 and TCEA1 primers to quantitative PCR validation
ANXA1 antisense | 5′ TAAGGGTGACCGATCTGAGG 3′ |
ANXA1 sense | 5′ ACGTCTGTCCCCTTTCTCCT 3′ |
ITPR1 antisense | 5′ GCTCTATGAGCAGGGGTGAG 3′ |
ITPR1 sense | 5′ GGAACACTCGGTCACTGGAT 3′ |
CD55 antisense | 5′ CAGCACCACCACAAATTGAC 3′ |
CD55 sense | 5′ TGCTCTCCAATCATGGTGAA 3′ |
NGFRAP1 antisense | 5′ GGGGGAGCTCTCTAATCACC 3′ |
NGFRAP1 sense | 5′ AAAGAAAACAGCGGGAATCA 3′ |
TCEA1 antisense | 5′ AGCTGAAAGAGATGCGGAAA 3′ |
TCEA1 sense | 5′ TGCCACATGTGAACAAGTCA 3′ |
Reaction mixture consisted of a 20 μl volume solution containing 100 and 500 ηg of Power SYBR Green PCR Master Mix (Applied Biosystems), 100 nM of each primer and 100 ng cDNA (control and treated with E. tirucalli latex). The PCR conditions were 95 °C for 10 min followed by 40 cycles of 95° for 15 s and 60° for 1 min. Melting curve analysis was performed for each gene to check the specificity and identity of the RT-PCR products. For each primer set, the efficiency of the PCR reaction (linear equation: y = slope + intercept) was measured in triplicate on serial dilutions of the same cDNA sample. The PCR efficiency (E) was calculated by the formula E = [10(-1/slope)] and ranged from 1.96 to 2.02 in the different assays.
Two control genes (
GAPDH, ACTB) were used as internal standards. The relative expression ratio (fold change) of the target genes was calculated according to Pfaffl [
25]. Statistical analysis was performed by a two-tailed unpaired
t test using GraphPad prism software.
Discussion
The active fraction present in the
E. tirucalli latex that was used in our experiments inhibits proliferation of tumor-related enzymes and presents potential anti-inflammatory and analgesic effects [
26]. Also, due to the importance of its antitumogenic action, we analyzed the effect of herbal medicine in the cell line of laryngeal squamous cell carcinoma (Hep-2) and it was observed that the morphology did not change after treatment with
E. tirucalli latex, however, cell proliferation decreased significantly. Other authors corroborate these results, they also observed that treatment with
E. tirucalli in cell line of breast cancer did not alter the morphology of these cells independent on the vehicle [
15]. Regarding the reduced proliferation,
E. tirucalli must have acted in tumorigenic cells causing cell death and also causing the growth of these cells to be reduced. In vitro
, it is known that latex works in the cell colonies fighting breast cancer and gastric cancer [
19,
27].
The
E. tirucalli latex effect was also analyzed in the gene expression, for the first time, by RaSH that isolates differentially expressed genes including new genes and rare transcripts as can be seen in some researches [
28] and others who use this technology [
29]. It is possible to generate significant genomic libraries that can assist in the search for genes differentially expressed in treated Hep-2 cells with herbal cell lines which is faster and less costly than other alternative hybridization techniques [
24].
The results showed changes in the expression of some genes in the cells of LSCC after treatment with
E. tirucalli latex, including
ANXA1,
TCEA1,
NGFRAP1,
ITPR1 and
CD55 genes. These genes belong to the same gene signaling network related by software IPA, correlating the tumorigenic and inflammatory processes. Other authors used the software IPA to identify the biological activities of the genes that distinguish between the thermal properties, hot (warm effects, disperse cold) or cold (cooling effect, removes heat) of Chinese medicinal herb. It was demonstrated that the main biological gene networks in the herbs with hot properties include inflammation and immunity regulation while the genes of the herbs with cold properties affect cell growth, proliferation and development [
30].
The selection of the validated
ITPR1 gene (inositol 1,4,5-trisphosphate receptor, type 1) can contribute significantly to the understanding of processes including cancer of the larynx since it has functions related to apoptosis, tumorigenesis of cells squamous and cell proliferation. Inositol 1,4,5-trisphosphate receptor type1 (IP3R1) is known as an IP3-gated Ca
2+ channel that is located on the endoplasmic reticulum (ER). The ER stores intracellular Ca
2+ and it has been reported to play a critical role in a variety of cell functions including cell proliferation, contraction of smooth muscle and apoptosis by pumping out Ca
2+ from ER to cytosol [
31‐
33].
We observed reduced
ITPR1 gene expression in Hep -2 cells after treatment with
E. tirucalli latex. Other project showed that IP3 receptors act as in vivo substrates for Akt kinase, which plays a key role in suppressing apoptosis [
34]. According to our tests, it can be inferred that the
E. tirucalli latex decreases the expression of
ITPR1 gene by restricting the action of the enzyme Akt kinase and activating apoptosis, decreasing cell growth of LSCC since these receptors are substrates for the action of this enzyme.
Another gene studied was
ANXA1 (Annexin 1), there was increased expression in Hep-2 cells after treatment with
E. tirucalli latex. This gene is important for the carcinogenic process such as cell cycle control, regulation of apoptosis, cell proliferation and growth, inflammatory response and calcium ion transport regulation [
35]. The annexin family consists of ubiquitous proteins that interact with phospholipids in a Ca
2+-dependent manner. Each annexin consists of an N-terminal domain and a typical core domain. The annexin core is conserved among all members of the annexin family. In contrast, N-terminal domains are variable in length and are believed to regulate annexin functions, forming a truncated molecule with altered sensitivity to calcium [
36].
Changes in the expression of
ANXA1 have been reported in various cancers and, furthermore, its expression has been compared to that of other proteins. This scenario prompted Jorge et al. [
37] to investigate the relationship between the gene and protein expression of annexin-A1 (
ANXA1/AnxA1) and galectin-1(
LGALS1/Gal-1) in an inflammatory gastric lesion as chronic gastritis (CG) and gastric adenocarcinoma (GA) and its association with
H. pylori infection. High
ANXA1mRNA expression levels were observed in 90 % of CG cases and in 80 % of GA cases. However,
LGALS1 mRNA levels were high in 60 % of the GA cases, while low expression was found in CG. These results have provided evidence that galectin-1 and mainly annexin-A1 are overexpressed in both gastritis and gastric cancer, suggesting a strong association of these proteins with chronic gastric inflammation and carcinogenesis [
37].
The expression of
ANXA1 was evaluated in larynx cancer and it was observed that this protein plays a regulatory role in Hep-2 cells, decreasing the growth of these cells [
38]. We infer that the
E. tirucalli latex contributes to increased expression of the gene
ANXA1 in the larynx squamous cell carcinoma, confirming the role of Annexin A1 in the regulation of cell proliferation, besides the anti-inflammatory function.
The gene CD55 (decay accelerating factor) presents functions related with squamous tumor cells, apoptosis, cell growth and proliferation, inflammatory response, calcium ion transport regulation and innate immune response, according to the reported data Gene Ontology (GO).
This gene is a key regulator affecting all three complement activation pathways and encoding a globular glycoprotein known as DAF - decay accelerating factor. DAF inhibits the activation of C3 and C5 by preventing the formation of new and accelerating the decay of preformed C3 and C5 convertases which can mediate the downstream effect of all 3 complement-activation pathways, therefore,
CD55 functions to protect host cells from complement attack and inhibits amplification of the complement cascade [
39].
CD55 is an anti-inflammatory and immunological anti-adhesive molecule implicated in the resolution of ongoing inflammation of mucosal epithelia through clearance of transmigrating neutrophils [
40]. In our tests, it was demonstrated that the expression of
CD55 was elevated in cell lines of laryngeal squamous cell carcinoma after treatment with
E. tirucalli latex, confirming its anti-inflammatory role.
The genes evaluated in this study showed differential expression in Hep-2 cells in a manner dependent on E. tirucalli latex treatment. This study highlights the importance of the RaSH technique as a fast and efficient method for identifying genes modulated by E. tirucalli latex in cells of epithelial origin. The functions of the genes identified in this study are important in tumor progression and are amenable to changes through interactions with the metabolism of the Hep-2 cells. The treatment for larynx carcinoma commonly involves surgery, chemotherapy or radiotherapy. However, new therapeutics such as the use of gene therapy associated with nanoparticles tested in larynx cancer derived Hep-2 cells are being developed, allowing the delivery of drugs into target cells.
Furthermore, the E. tirucalli latex alters the proliferation and gene expression of Hep-2 cells. These changes are most likely related to inflammatory and tumorigenic processes. Thus, we suggest that the this herb has modulatory effects on the metabolism of this cell type. Our findings suggest the importance of future studies using Hep-2 cells for the development of new therapies. These studies should focus on gene activities that involve the action of E. tirucalli and applications of this herb as a possible therapeutic in the treatment larynx carcinoma.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
GBF-S carried out the cell culture experiments, RaSH assay, real-time PCR assay, performed the statistical analysis, and drafted the manuscript. JP assisted with the cell culture experiments and RaSH assay. ARDS and WASJr assisted with the RaSH assay. BRC assisted with the real-time PCR assay. EHT and SMO were involved in drafting the manuscript or revising it critically for important intellectual content. FCR-L conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All of the authors read and approved the final manuscript.