Background
The gains in malaria control by health authorities are consistently being challenged by widespread resistance of anopheline mosquito vectors to multiple classes of insecticides [
1]. Changing climate trends are also expanding habitats for malaria and other tropical disease vectors [
2]. Pyrethroids are the most commonly used insecticides for disease control as they are fast-acting, readily available, present relatively low mammalian toxicity, and are inexpensive. However, widespread use has led to high levels of pyrethroid resistance in mosquito vectors of malaria and other diseases [
3,
4]. New tools to overcome insecticide resistance are urgently needed.
Mechanisms of resistance are complex and include insecticide avoidance, altered penetration, sequestration, target site alteration, or biodegradation. Metabolic resistance, associated with the biodegradation of xenobiotic compounds, is a common mechanism of resistance in mosquitoes caused by the overexpression of detoxification enzymes such as cytochrome P450s (CYPs), glutathione
S-transferases (GSTs) and carboxy/cholinesterases (CCE) [
5]. Of these, CYPs are the gene family primarily associated with resistance to pyrethroids and most other classes of insecticides used for vector control. In general, the evolution of consistently elevated levels of CYP gene expression in insects results in the rapid decomposition of insecticides, leading to a decrease in efficacy [
5,
6]. However, compounds that can inhibit the catalytic activity of mosquito CYPs have the potential to reduce resistance caused by insecticide metabolism and reinstate susceptibility. Piperonyl butoxide (PBO), a broad-spectrum inhibitor of CYP activity, is commonly used in combination with pyrethroids as a synergist to increase their effectiveness against pyrethroid-resistant mosquitoes [
7]. In 2017, the World Health Organization (WHO) recommended the use of pyrethroid–PBO combination bed nets for malaria control [
8]. These have since proven more effective in reducing malaria cases than pyrethroid-only nets in areas of high pyrethroid resistance [
9,
10]. Thus, identifying new compounds that inhibit CYP activity will increase the variety of synergists that can be developed to attenuate insecticide resistance, reducing the reliance on individual compounds that might evolve resistance. Secondary metabolites of plants supply a large and diverse pool of compounds that block human metabolic enzymes by inhibiting their mode of action or serve as alternative substrates [
11,
12]. As such, these metabolites may have application as synergists to overcome metabolic resistance in malaria vector populations known to overexpress CYPs. Work described in this paper was undertaken to explore the value of Caribbean biodiversity as insecticide synergists against anopheline mosquitoes, particularly routed through CYP inhibition.
Anopheles gambiae CYP6P3 and CYP6M2 and
Anopheles funestus CYP6P9a are CYPs that metabolize pyrethroids and are frequently overexpressed in African populations of pyrethroid-resistant mosquitoes [
13‐
15]. They are also associated with cross-resistance due to their broad substrate specificity and capacity to metabolize a wide range of different insecticide classes [
16‐
18]. Heterologously expressed CYP6P3, CYP6M2, and CYP6P9a enzymes were used to screen extracts from native and non-native Jamaican plants with therapeutic or insecticidal properties,
Condea verticillata,
Piper amalago var.
amalago, and
Kalanchoe pinnata, to identify potential insecticide synergists and demonstrate their added toxic effect when used in combination with a pyrethroid insecticide. Further, in silico modelling was used to explore possible enzyme interactions with bryophyllin A, bryophyllin C, luteolin-7-
O-β-
d-glucoside in
Kalanchoe pinnata, 2,3-diacetoxytormentic acid in
Condea verticillata, and piperine in
Piper amalago var.
amalago (supplemental 1), compounds previously attributed to the insecticidal activities of these plants [
19‐
22].
Methods
Reagents
Potassium phosphate, magnesium chloride, nicotinamide adenine dinucleotide phosphate (NADP+), glucose-6-phosphate, glucose-6-phosphate dehydrogenase, deltamethrin (98%) dimethyl sulfoxide (DMSO) (99.9%), acetonitrile (99.8%), and piperine (97%) were purchased from Sigma-Aldrich (Gillingham, UK). Piperonyl butoxide (PBO; 90%; Fluka, Buchs, Switzerland), ethanol (99%), and acetone (99%) were purchased from Fisher Bioreagent (NJ, USA). Diethoxyfluorescein (DEF; 98.1%) was purchased from Cypex Ltd., (Dundee, UK), and permethrin (99%) was purchased from Chem Service Inc. (PA, USA).
Eight aromatic plants widely used in Jamaica for their therapeutic or insecticidal properties were screened for their ability to inhibit heterologously expressed
An. funestus and
An. gambiae (sensu stricto) CYPs. Collected plant material was bench-dried and prepared according to previously developed and refined methods [
23,
24]. Leaves and smaller woody material were finely crushed and prepared as infusions or decoctions as previously described [
22,
25]. Briefly, 1 g of dried, finely ground material (leaf, stem) was infused in 100 ml of boiled deionized water for 15–20 min. Barks were decocted for 2 h and left to stand overnight. The resulting liquor was suction-filtered to remove suspended solids. The samples were lyophilized using a freeze-dryer (Labconco, MO, USA). The resulting solids were kept at − 20 °C until required and not subjected to more than two freeze–thaw cycles.
Bidens pilosa,
Croton linearis,
Condea verticillata, and
Piper amalago var.
amalago were prepared from a leaf and stem infusion.
Bursera simaruba,
Cinnamodendron corticosum, and
Guazuma ulmifolia were prepared from a bark decoction.
Kalanchoe pinnata, a succulent plant, not native to Jamaica, was prepared from fresh leaves as a juice extract that was subsequently lyophilized. Voucher specimens of each plant sample were prepared and deposited in the herbarium at the University of the West Indies, Mona, Jamaica. Each specimen was identified by the botanist and herbarium curator, and given voucher numbers.
Ethanol extraction was conducted as follows: the aerial parts of each plant (K. pinnata, C. verticillata, and P. amalago var. amalago) were collected and left to air-dry over a 72-h period. The leaves and stem of each plant were pulverized and then submerged in 300 ml of analytical-grade ethanol. After the 72-h period, each extract was suction-filtered to separate plant particles from the extract. The extract was then concentrated via rotary evaporation (Büchi B-481, DE, USA), decanted and placed under a fume hood to remove excess solvent. The final mass of each extract was obtained.
In vitro mosquito CYP assays
Escherichia coli membranes expressing mosquito CYP co-expressed with CYP reductase were obtained from Cypex Ltd. (Dundee, UK): CYP6P9a from
An. funestus and CYP6P3 and CYP6M2 from
An. gambiae (sensu stricto) [
16]. Diethoxyfluorescein (DEF), the fluorogenic substrate, was used to measure enzyme activity.
The Michaelis–Menten kinetics were initially calculated for each enzyme. These calculated values (CYP6P9a (40 pmol/ml;
Km 5 µM), CYP6P3 (40 pmol/ml;
Km 0.83 µM), and CYP6M2 (10 pmol/ml;
Km 1.66 µM) were employed for inhibitory activity from thereon. CYP assays were conducted on lyophilized plant extracts resuspended in either water or 0.1% final acetonitrile concentration per assay. DEF was dissolved in DMSO with a final concentration of 0.5%. A solvent control was included to correct for any solvent effects across the dilution range. Single-point enzyme inhibition assays, conducted at 8.16 µg/ml plant extract, were initially conducted to determine whether the plant decoctions or infusions had an inhibitory effect on anopheline CYPs. Deltamethrin and PBO were used as standard controls to compare the inhibitory properties of the plant extracts. The procedure followed similar methods routinely conducted with human CYP enzymes [
26,
27].
Extracts that demonstrated a percentage inhibition > 60% at 8.16 µg/ml were further assessed to determine IC50 values, the concentration at which 50% inhibition is observed. The enzyme assays were performed in triplicate using black 96-well plates (Thermo Labsystems, Basingstoke, UK), in 50 mM potassium phosphate buffer containing 5 mM MgCl2, pH 7.4, with enzyme and substrate at the concentrations stated above while varying the concentration of the test compound. Reactions were preincubated at 37 °C for 5 min, while continuously shaken at 420 spm. The reactions were initiated by the addition of the NADPH-generating system consisting of NADP+, glucose-6-phosphate, and glucose-6-phosphate dehydrogenase at final concentrations of 0.001 mM, 0.025 mM and 5 units/ml, respectively. The final reaction volume was 200 µL. The reactions were monitored at 485 nm excitation/530 nm emission using a fluorescence spectrophotometer with an incubator and shaker (Thermo Electron Varioskan, UK). IC50 values were calculated in SigmaPlot v. 10. (Systat Software Inc.).
Characterization of plant extracts by GC–MS and HPLC
The GC–MS system (Agilent 7820 A) was coupled to a mass selective detector (Agilent 5975 series; Agilent Technologies, CA, USA) with a Hewlett-Packard DB-5 ms column (60 m × 0.25 mm; 0.25 μm film thickness). Purified helium was used as the carrier gas with a flow rate of 1 ml/min. The temperature program employed was from 45 °C (1 °C/min) to 280 °C (2 °C/min). Injector and detector temperatures were maintained at 210 °C and 220 °C, respectively. The injection volume for the extract was 1 μl. Retention indices were directly obtained via the application of Kovats’ procedure. The components of the extract were identified via a comparison of mass spectral data with those of the NIST17 library, as described in ref. [
28].
Separation of the extract was undertaken using a stationary-phase HPLC (Agilent 1100 series, Agilent Technologies, CA, USA). The column used was C-18, with the solvents 75% acetonitrile: 25% water. The extract was standardized against piperine, a phytochemical identified with 99% confidence by the GC–MS analysis, that is known to contribute to the insecticidal properties of most Piperaceae [
29‐
32].
Mosquito rearing
Extracts demonstrating strong inhibitory properties towards one or more anopheline CYPs in vitro were further assessed for their effect on Anopheles mosquitoes in vivo. Mosquitoes for the in vivo assays were obtained from the Malaria Research and Reference Reagent Resources center (MR4, CDC, Atlanta, GA, USA). They were maintained at a constant temperature of 27 ± 2 °C and 70 ± 10% humidity on a 14-h/10-h light/dark cycle (Environmental Specialties Incubator, Model ES 10–10 WR, NC, USA). Routinely, the larvae were maintained in trays (Bugdorm, Taiwan, L35 × W26 × H4.5 cm), with 350–500 ml of distilled water per 300 larvae. An. gambiae (G3 strain) larvae were fed a diet of 50–100 mg of ground koi pellets until pupation. An. funestus (Fumoz strain) larvae were fed 50–100 mg of ground koi pellets with the addition of 50 mg of powered Spirulina until pupation. Pupae were removed and transferred in cups to insect rearing cages (Bugdorm, Taiwan) per species. Anopheles gambiae (AKDR strain) pupae were obtained directly from MR4. Adult mosquitoes were provided 10% sucrose ad libitum.
Mosquito toxicity assay
Each prepared plant extract was resuspended in ethanol to give an initial stock solution (0.08–0.2 mg/μl), and then serially diluted (0–7.15 μg/μl) in ethanol. The resuspended extract was topically applied to the thorax of 3–5-day-old non-blood-fed adult
An. gambiae (G3) or
An. funestus (Fumoz) female mosquitoes (
n = 10–30) following methods described in ref. [
33]. Briefly, the female mosquitoes were anaesthetized on ice and 0.2 μl of the resuspended extract was applied to the dorsal thorax using a 700 series syringe and a PB600 repeating dispenser (Hamilton, NV, USA). The control treatment was applied with 0.2 μl of ethanol only. After treatment, mosquitoes were contained in paper cups and fed 10% sucrose solution. The mosquitoes were observed for 3 h to observe response to initial exposure. Mortality was recorded at 24 h under standard insectary conditions as previously described. Assays for each concentration were conducted in triplicate. Mosquitoes that survived concentrations of 715 ng of plant extract were collected for RNA extraction and sequencing studies.
Synergistic assays using the CDC bottle bioassay
To determine synergism, a modification to the CDC bottle bioassay [
34] was used.
Anopheles gambiae (AKDR) mosquitoes, which have demonstrated resistance to permethrin were used in these assays [
35]. Non-blood fed adult female
An. gambiae (AKDR), 3–5 days old (
n = 25–30), were topically exposed to ethanol or 1430 ng of plant extract while anaesthetized, as described above. The mosquitoes were transferred to a netted cup and observed for 1 h. After 1 h, actively flying mosquitoes were gently removed from the cups with a mouth aspirator and then transferred to bottles precoated with 21.5 µg of permethrin per bottle or acetone as a control treatment. Bottles were prepared 24 h prior to use [
34]. The rate of knockdown/mortality was observed every 15 min for 120 min or until 100% mortality was achieved. Knockdown/mortality was recorded if mosquitoes were either inactive or the mosquitoes shed their legs or gave a sporadic jump without flight when the bottle was agitated/tapped. The experiment was conducted in duplicate. The experiment was repeated; results were pooled to give mortality rates.
RNA extraction and sequencing assays
RNA extraction and sequencing studies were conducted on mosquitoes that survived the 24-h topical application of 715 ng of plant extract assays. Total RNA was isolated from pools containing ten mosquitoes each per plant assessed or from mosquitoes exposed to ethanol only. RNA was extracted using Arcturus®; PicoPure®; RNA isolation kit (Applied Biosystems, Vilnius, Lithuania). The extractions were conducted in triplicates. RNA was quantified using the Agilent RNA ScreenTape on the Agilent 4200 TapeStation (Agilent Technologies, CA, USA), according to the manufacturer’s protocol.
Library construction and hybridization capture
RNA libraries were prepared for each pool of extracted RNA using TruSeq Stranded Total RNA kit (Illumina, CA, USA) using 14 cycles of PCR amplification. All protocols were performed following the manufacturer's instructions. Briefly, 500 ng of RNA per treatment was processed to deplete rRNA before being purified, fragmented, and primed with random hexamers. Fifty (50) ng of ribosomal-depleted primed RNA fragments were reverse transcribed into first strand cDNA using First-Strand Synthesis Actinomycin D mix and SuperScript II Reverse Transcriptase. RNA templates were removed, and a replacement strand was synthesized to generate ds cDNA. Libraries were purified using AMPure XP beads (Beckman Coulter, IN, USA). The quality and quantity were consistently evaluated on the Agilent 4200 TapeStation. The cDNA was stored at − 80 °C. The libraries were sequenced (2 × 125 bp, paired-end reads) on the Illumina HiSeq 2500 sequencer, using v2 chemistry. Sequencing was performed at the Biotechnology Core Facility at the CDC, Atlanta, GA, USA.
Read filtering and mapping
Sequenced reads were assigned to each sample and adaptors were removed. Overall read quality was checked for each sample using FastQC [
36]. Reads were then filtered on the basis of their length, pairing, and quality using Trimmomatic version 0.39 [
37]. Only paired reads were kept for mapping. Reads were mapped to the
An. gambiae (PEST) and
An. funestus (Fumoz) [
38,
39] reference genomes obtained from VectorBase using hisat2 version 2.2.1 [
40] with default parameters. SAMtools [
41] and HTSeq version 0.13.5 [
42] were used to sort the output files and count reads according to the respective genome annotation files obtained from VectorBase. The raw counts were processed using RStudio version 2021.09.0 [
43], and the differential gene expression analysis was performed using the DESeq2 package [
44]. Genes were considered differentially expressed if their absolute log
2 fold change values were > 1 at FDR-adjusted
p < 0.05. The Panther classification system [
45] was used for further characterization of gene enrichment of
An. gambiae genes. For
An. funestus, Panther classification was performed by determining the
An. gambiae homologs for differentially expressed genes. XMgrace [
46] was used to generate the volcano plot of differentially expressed CYP genes.
Validation of RNA sequencing from An. gambiae with qPCR
To confirm the expression of the genes observed in the RNA sequencing, CYP genes with low–high expression levels were selected. All primers (Table
1) were obtained from the Biotechnology Core Facility Branch (CDC). The primers were validated using conventional PCR. The PCR products were then visualized using the UVP GelStudio plus (Analytik Jena, CA, USA). Only primers that formed single-banded amplification products between 150 and 200 bp were used for the quantitative PCR assay. The qPCR amplification was carried out on a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems) using PowerUp SYBR Green Master Mix (Applied Biosystems). cDNA from each sample was used as a template in a three-step program as follows: Uracil-DNA glycosylase (UDG) activation at 50 °C for 2 min, DNA polymerase activation at 95 °C for 10 min, followed by 40 cycles of DNA denaturation for 15 s at 95 °C, DNA annealing and extension for 1 min at 60 °C, and a last DNA extension step of 15 s at 95 °C. The relative expression level and fold change (FC) of each target gene from treated samples relative to the untreated samples were calculated using the 2 − ΔΔCT method. Housekeeping genes were used to normalize the expression of the target genes.
Table 1
Primers used in An. gambiae quantitative real-time PCR reactions
AGAP008209 | CYP6M1 | GTGCTCGCCAAGCATAATGG | ACTTGCGTAGGGATTCTTTCA | |
AGAP008213 | CYP6M3 | ATCTGGAGCTGCTGAAGTGT | TTCATCTTCCCGGACGTGAA | |
AGAP008214 | CYP6M4 | GGAACAGGAATCGAAGCGTC | GCACAGGAGTTTTGGAGCAA | |
AGAP012291 | CYP9J3 | CACGTTTAACATGCGCCAAC | ATATCGCGCCACTTTTGTCC | |
Housekeeping genes | GDPH | CTGCAAAAAGTCGATACCGC | CCTCGTACACGTACATCGTGA | |
Housekeeping genes | RPS7gam | AGAACCAGCAGACCACCATC | GCTGCAAACTTCGGCTATTC | |
Homology modelling
To ascertain binding affinity and possible interactions of the active metabolite within each extract with the CYP enzymes inhibited in vitro, as well as those found differentially expressed in the RNA-seq. studies, in silico models were generated. Preliminary structural models for CYPs 4G17, 6M2, 6P3, 9J3 (
An. gambiae), and 6P9a (
An. funestus), constructed using AlphaFold [
47], were obtained from VectorBase [
48]. Following structural alignment with
Homo sapiens CYP3A4 (PDB ID: 6DAA) [
49], the heme group coordinates were introduced for each CYP isoform.
Coordinates for the protein structures (CYPs 4G17, 6M2, 6P3, 6P9a, and 9J3) obtained as described above were subjected to a molecular dynamics simulation in water using GROMACS version 2020.4 [
50], with the CHARMM27 force field [
51]. To begin, each enzyme was centered in a cubic box 10 Å away from the edge with periodic boundary conditions. The box was subsequently solvated using spc water [
52], prior to neutralizing each system with the appropriate number of counterions. The complete system was then subjected to 1000 steps of steepest descent energy minimization in preparation for the molecular dynamics simulation. Each simulation was initiated using the same equilibration scheme. Firstly, the initial velocities were randomly generated from a Maxwell–Boltzmann distribution at 300 K for a 100 ps equilibration under an NVT ensemble. The temperature coupling was controlled using a modified Berendsen thermostat [
53] with a time constant of 0.1 ps. Secondly, the system was further equilibrated for 100 ps under an NPT ensemble. Pressure coupling was controlled using a Parrinello–Rahman barostat [
54] with a time constant of 2.0 ps and an isothermal compressibility of 4.5 × 10
−5 bar
−1 in isotropic conditions.
The final system for each enzyme was used as the starting configuration for a 100-ns production run at 300 K, with structures saved every 100 ps. The LINCS algorithm [
55] was used with an order of 4 to constrain bond lengths and water bond angles, allowing for an integration time step of 2 fs. Nonbonded interactions were calculated using a Verlet cutoff scheme [
56], whereby interactions within 10 Å were calculated at every time step from a pair list that was updated every fifth time step. On the other hand, electrostatic interactions beyond 10 Å were approximated using the particle mesh Ewald summation [
57]. Following the 100-ns simulation, the protein coordinates were extracted for molecular docking analysis.
Molecular docking
The protein structures for each enzyme (CYPs 4G17, 6M2, 6P3, 6P9a, and 9J3) were extracted from the final coordinates of the molecular dynamics simulations described above. Polar hydrogens were added using AutoDock tools [
58], and the grid box was centered within each enzyme with dimensions in the
x-,
y-, and
z-planes adequate to encompass its entire structure, thereby identifying the theoretical binding sites. Molecular structures for the compounds constituting the various treatments (piperine from
P. amalago var.
amalago; bryophyllin A, bryophyllin C, and luteolin-7-
O-β-
d-glucoside from
K. pinnata; 2,3-diacetoxytormentic acid from
C. verticillata) were generated using Avogadro version 1.90.0 [
59], optimized, and suitably protonated at pH 7.4 before being prepared with AutoDock Tools [
58]. Once both ligand and receptor files were ready, automated flexible docking was performed using AutoDock Vina [
60], with no added restrictions. The best docking poses were selected in each case; the coordinates were visualized with VMD [
61], through which images of the binding mode were generated. Lastly, LigPlot + version 2.2 [
62], was applied to visualize the protein–ligand interactions, using default settings.
Data analysis
The inhibition concentrations at 50% enzyme activity (IC
50) were calculated in SigmaPlot v. 10. (Systat Software Inc.). The inhibitory concentrations are displayed as mean ± the standard error of the mean (SEM). The toxicity assays are presented as lethal doses at 50% mortality ± 95% confidence interval (95% CI) per population. R (version 3.6.2) was used to calculate confidence intervals. Abbott’s formula [
63] (% Corrected Mortality = ((T−C)/(100−C)) × 100; where T is the total percent mortality in the treated group, and C is the percent mortality in the control group, providing that the control mortality was greater than 0% but less than or equal 20%) was used to correct the mortality rate in each treated group when necessary. The mortality in the control group for all toxicity assays was less than 20%. Statistical analyses were completed using SPSS for Windows (version 17.0). One-way analysis of variance (ANOVA) and
Posthoc Tukey test were used to determine significant differences (
p < 0.05) between means where possible.
The differential gene expression analysis was performed using the DESeq2 package [
44]. Genes were considered differentially expressed if their absolute log
2 fold change values were > 1 at FDR-adjusted
p < 0.05.
Discussion
The secondary metabolites of plants provide diverse chemical structures with multiple biological activities. The study identified compounds that might be used as synergists to inhibit CYPs associated with the detoxification of insecticides in mosquitoes. Extracts were prepared from plants for their potential to inhibit the activities of representative CYPs commonly overexpressed in African malaria vectors associated with pyrethroid resistance, An. gambiae CYP6P3 and CYP6M2 and An. funestus CYP6P9a, and their activity in vivo confirmed.
Of the eight aqueous plant extracts explored,
P. amalago var
. amalago, C. verticillata, and
K. pinnata demonstrated specificity for one or more recombinant CYPs, overexpressed in
Anopheles mosquitoes resistant to pyrethroids, with IC
50s < 10 μg/ml in vitro (Table
3). These values were comparable to the inhibitory properties of the insecticidal compound deltamethrin and the synergist PBO, suggesting that the compounds have potential as insecticide synergists. As such, these three plant extracts were assessed for their effect in vivo. Chemical separation of the extract was conducted if information on the possible active secondary metabolites was not available. GC–MS analysis and stationary-phase HPLC found piperine to be abundant in the
P. amalago var
. amalago extract (Supplemental 2). Piperine exhibited similar inhibitory trends to that of the water extract (Table
3). The results suggest that piperine, a compound found commonly in
Piper spp. [
76,
80], with previously demonstrated insecticidal [
30], synergistic [
81], and larvicidal [
77] properties, was the most likely secondary metabolite responsible for the CYP inhibitory property of the
P. amalago var
. amalago extract in vitro as well as the insecticidal activity of the extract against
An. gambiae in this study.
Further in vivo studies found that
C. verticillata demonstrated no insecticidal activity against the mosquitoes tested; however, the ethanolic extracts of
P. amalago amalago and
K. pinnata produced dose-dependent insecticidal activity against
An.
gambiae (Fig.
1). In order to identify genes that may play a protective role against the toxicity of the plant extracts, the effects on gene expression following exposure to sublethal doses of extracts (Figs.
3,
4, and Tables
4,
5) was assessed. The paired-end sequences following exposure of
An. gambiae to a sublethal dosage of
P. amalago var.
amalago or
K. pinnata could be mapped to a total of 13,797 genes, with good alignment obtained for both treatments (~ 88% and ~ 84%, respectively) and the solvent control (~ 90%). Of these, 708 genes and 893 genes were differentially expressed, respectively, compared to the control. The enzymes that were upregulated following both plant extract treatments (Fig.
3 and Table
4) were likely involved in the metabolism of the compounds found in the plant extracts when applied topically. In contrast, the downregulation of trypsins, along with the upregulation of DNA-damage-inducible protein (Table
4), may indicate a move towards survival. Cuticular proteins, including CYP4G17, frequently overexpressed in resistant populations, are known to be involved in the oxidative decarbonylases that catalyze the final step in cuticular hydrocarbon synthesis [
82,
83]; they were observed to be downregulated in relation to the control (Fig.
3), along with other cuticular proteins (Table
4). However, previous whole-genome transcription studies demonstrated differential upregulation of CYP4G17 along with the differential upregulation of other cuticular proteins in anopheline mosquitoes treated with insecticides [
83].
RNA sequencing analysis for
An. funestus following exposure to the ethanolic extract of
C. verticillata was compared to
An. funestus treated with ethanol only. The paired-end sequences could be mapped to a total of 14,177 genes. A similar pattern to the findings for
An. gambiae could be observed, with a number of genes coding for enzymes being upregulated. In this study, similar CYP orthologs were similarly upregulated or downregulated across the treatments (Table
5). An overall limitation of the RNA sequencing analysis was the large number of genes for which no annotation was available; this was especially applicable to the
An. funestus genome. As these genomes are further characterized, the number of differentially expressed genes coding for unspecified products may reveal new information describing the mechanism of action underlying the treatments applied. CYP6P9a was downregulated in
An. funestus treated with
C. verticillata, albeit not differentially. Its low toxicity in vivo may explain the limited differential expression (Table
5) of the known genes.
Following the in vitro and RNA sequencing results, in silico studies were conducted to ascertain binding affinity and possible interactions of the active ingredients within each extract with the CYP enzymes they were predicted to regulate. A common feature of the molecular docking results with the five active ingredients (piperine (identified in
P. amalago var.
amalago; Supplemental 2); 2,3-diacetoxytormentic acid [from
C. verticillata previously identified in the extract [
22]; bryophyllin A, bryophyllin C, and luteolin-7-
O-β-
d-glucoside (widely reported in an ethanol extract of
K. pinnata [
20])] on five CYP isoforms (4G17, 6M2, 6P3, and 9J3 from
An. gambiae; 6P9a from
An. funestus; selected on the basis of in vitro and RNA sequencing results) was the mediation of the ligands in their respective active sites by π–π stacking interactions with phenylalanine residues conserved across all eukaryotic CYP enzymes [
84,
85]. These phenylalanine residues constitute key interaction points in substrate recognition sites surrounding the binding pocket. The molecular docking results revealed strong binding affinity by all compounds evaluated, with compounds from
K. pinnata showing more specific activity toward CYP6P3 and CYP6M2 from
An. gambiae (Table
6, Fig.
5), 2,3-diacetoxytormentic acid from
C. verticillata showing specificity toward CYP6P9a from
An. funestus (Fig.
6, Table
6), and piperine, showing broader activity toward all CYPs evaluated, with the exception of CYP9J3 (Table
6, Fig.
7). The results are similar to those obtained in vitro, demonstrating the likeliness of these compounds as active agents in the plant extracts.
With the exception of piperine and bryophillin A, CYP4G17 exhibited relatively low affinity toward the compounds evaluated in comparison to the other CYPs that were modelled. This may be a function of a differently shaped binding pocket to isoforms from the CYP6 and CYP9 families. Specifically, its active site is narrower and more elongated, which may confer some substrate specificity suited for long-chain insecticides commonly used on mosquitoes. This could explain its upregulation in the presence of insecticides [
82,
83] but downregulation following treatment with
P. amalago var.
amalago and
K. pinnata, which may be preferentially metabolized by isoforms from the CYP6 family.
Kalanchoe pinnata and
P. amalago amalago were the only extracts to demonstrate dose-dependent toxicity towards anopheline mosquitoes by targeting key metabolic enzymes associated with insecticide resistance in these vectors. The observed in vitro and in silico results, as well as the toxicity towards
An. gambiae supports the synergistic potential of these compounds. This synergistic effect is a result of the decreased availability of those key enzymes involved in the metabolism of insecticides, allowing the insecticide to reach its target site. The increase in the effectivity of permethrin, when used synergistically with
K. pinnata, demonstrates this effect. Although synergistic studies were not conducted with
P. amalago amalago on any anopheline mosquitoes in this study, a previous study demonstrated synergism of
P. amalago var.
amalago with pyrethroids on aedine mosquitoes [
86]. Other studies have also demonstrated the synergistic activity of
Piper spp. and the active metabolite piperine with pyrethroids [
74,
76]. Piperine, the active metabolite in the
P. amalago amalago extract
, demonstrated strong binding affinity to all CYPs assessed in silico. Piperine’s broad-spectrum activity, as a function of its methylenedioxyphenyl group, enables it to bind to the active site of multiple CYPs responsible for metabolizing insecticides [
29,
76,
79]. This makes it a strong candidate as a synergist. Its smaller, less decorated nature also makes it an ideal scaffold for further optimization as a single compound. On the other hand, the extract from
K. pinnata, with more than one compound (bryophyllin A, bryophyllin C, and luteolin-7-
O-β-
d-glucoside) exhibiting very strong affinity for CYPs central to insecticide resistance, may be a suitable natural candidate in extract form to bypass this obstacle in large mosquito populations.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.