Skip to main content
Erschienen in: Reproductive Biology and Endocrinology 1/2020

Open Access 01.12.2020 | Research

Evaluation of the protective effects of icariin on nicotine-induced reproductive toxicity in male mouse –a pilot study

verfasst von: Guochao Ni, Xuhui Zhang, Seth Yaw Afedo, Rong Rui

Erschienen in: Reproductive Biology and Endocrinology | Ausgabe 1/2020

Abstract

Background

Nicotine, a pharmacologically active component of tobacco adversely affects the male reproductive system and fertility whereas icariin (ICA), the main active ingredient in Epimedium herba has been used in the treatment of several male reproductive problems. This study aimed at evaluating the protective or ameliorative effect of ICA against reproductive toxicity induced by intraperitoneal injection of nicotine in mice.

Methods

Using simple random allocation, forty male mice were randomly divided into 4 groups: control (received 0.35 mL physiological saline via gastric gavage), nicotine (0.75 mg/kg BW/day intraperitoneally), ICA (75 mg/kg BW/day gastric gavage), and nicotine plus ICA (nicotine, 0.75 mg/kg BW/day intraperitoneally + ICA, 75 mg/kg BW/day gastric gavage) group. After 35 days of treatment, the mice were weighed, sacrificed, and their reproductive organs (testis and epididymis) were collected and examined for further studies.

Results

The nicotine-treated group showed significantly decreased epididymal sperm density and serum testosterone concentration relative to the control group. Nicotine also caused oxidative damage shown by significant reduction in the activities of antioxidant enzymes and elevation in Malondialdehyde (MDA) levels. ICA on the other hand, improved the reduction in sperm density, hormone levels, and activities of antioxidant enzymes altered in the nicotine treated mice.

Conclusions

These findings indicate that nicotine-induced reproductive toxicity and oxidative damage on male reproductive tissues could be attenuated by ICA.
Hinweise

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
ICA
Icariin
BW
Bodyweight
MDA
Malondialdehyde
ROS
Reactive oxygen species
SOD
Superoxide dismutase
GPx1
Glutathione peroxidase 1
OS
Oxidative stress
IACUC
Institutional Animal Care and Use Committee
PCR
Polymerase chain reaction
HTF
Human tubal fluid
HE
Haematoxylin-eosin
RIA
Radioimmunoassay
HSD
Hydroxysteroid dehydrogenase
StAR
Steroidogenic acute regulatory protein
PDE5-Is
Phosphodiesterase type 5 inhibitors
ED
Erectile dysfunction
NOS
Nitric oxide synthase
NO/cGMP
Nitric oxide / cyclic guanosine mono phosphate
CP
Cyclophosphamide
qRT-PCR
Quantitative real time polymerase chain reaction
SD
Standard deviation
ANOVA
Analysis of variance
SPSS
Statistics Package for Social Sciences

Introduction

Tobacco contains numerous compounds among which nicotine is the most addictive and toxic component. Among users of tobacco, nicotine plays a significant role in the development of cardiovascular disorders, pulmonary diseases, lung cancer, and many other diseases [1, 2]. Nicotine has also been known to cause oxidative stress (OS) by inducing the generation of reactive oxygen species (ROS) in tissues [3]. In addition, it adversely affects the male reproductive system and fertility [4]. Several studies have also reported that nicotine adversely affects spermatogenesis, epididymal sperm count, motility, and the fertilizing potential of sperms [58]. Nicotine causes disturbances in the function of Leydig cells, thus diminishing the production of testosterone [8].
Medicinal plants and their active ingredients have received greater attention as potential anti-peroxidative agents. Icariin (ICA), (C33H40O15; molecular weight: 676.67), the main active flavonoid glucoside from Epimedium herba is associated with a wide range of pharmacological and biological activities, including anti-inflammatory, antidepressant, anti-tumor activity, antioxidant effect, estrogenic activity, cardiovascular protection, enhancement of bone healing and neuroprotection, immunoregulation, and improved sexual function [912]. Experiment on animals has revealed that ICA improves erectile function when administered to aged male rats [13]. ICA supplementation could also elevate exercise endurance as it provides protective effects on exercise-induced OS [14, 15]. The testes contain an elaborate array of antioxidant enzymes and free radical scavengers which ensure that its twin spermatogenic and steroidogenic functions are not impacted by OS [16, 17].
ICA has testosterone mimetic properties. Testosterone plays a leading role in both morphological development and reproductive function in the testis [18]. There are several separate reports on nicotine (as a cause of fertility problems in males) and ICA (as a factor in enhancing male reproduction and fertility) [1, 4, 13, 19, 20], but there are no reports on the effects of ICA on nicotine-induced reproductive toxicity. Therefore, this present study was conducted to evaluate the possible protective effect of ICA against nicotine-mediated reproductive toxicity and OS in mice through assessment of reproductive function and activities of the main antioxidant enzymes.

Materials and methods

Drugs and chemicals

Nicotine ditartrate was purchased from Adooq Bioscience Co., Ltd. (Irvine,CA, USA) and ICA from Ze Lang Co., Ltd. (Nanjing, China). The SYBR® PrimeScript® real time-polymerase chain reaction (RT-PCR) Kit (Perfect Real Time) was purchased from TaKaRa Biotech (Liaoning, China). Superoxide dismutase (SOD), glutathione peroxidase (GPx), and malondialdehyde (MDA) assay kits were obtained from Jiancheng Bioengineering Institute (Nanjing, China), and testosterone (T) Radioimmunoassay (RIA) Kit from Abcam (Cambridge, UK).

Ethical approval

All procedures and protocols involving animals were in accordance with the Animal Ethics Procedure and Guidelines of the People’s Republic of China and the Guide for the Care and Use of Laboratory Animals. All animal procedures were also approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing Agricultural University with Permit No. 2018CB114306.

Animals and experimental design

Forty healthy male Kunming mice (8-weeks-old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (permit number SCXK-Jing 2016–0011). The mice were purchased 1 week prior to the study, and for the purposes of acclimatization, all mice were routinely raised in a clean area with normal room temperature and fed with standard mouse feed and ordinary water ad libitum. A sample size calculation was made according to Daniel (1999) [21]. The minimum sample was calculated based on the formula: n = Z2 P (1-P) / d2, where n = sample size, Z = Z -score, P = margin of error, and d = standard deviation. The Z-score is a constant value automatically set based on the decided confidence level. Accordingly, the necessary sample from an unknown population was determined as 385 (95% confidence level, 50% standard deviation, and a 5% margin of error). However, it was not possible to treat or handle tissue samples from 385 mice in 1 day. Therefore, we conducted a pilot study with 40 mice divided into 4 treatment groups as previously suggested by Zhou et al. (2006) [22].
A simple random allocation was used to assign 10 mice to each group. Briefly, each mouse had equal chance to be selected as part of any of the groups to avoid statistical bias. All mice were marked on the ear; from 1 to 40 and paper cards bearing marks of numbers from 1 to 40 were also designed. Using a random number table, the mice were randomly picked and assigned (allocated) to any of the 4 groups under consideration until each group had a total of 10 mice. Group I served as the control, mice assigned to this group were administered 0.35 mL physiological saline via gastric gavage. Group II mice received intraperitoneal injection of nicotine tartrate (dissolved in 0.9% physiological saline) at 0.75 mg/kg BW/day. The mice assigned to group III were given ICA at 75 mg/kg BW/day through gastric gavage, and finally, group IV mice received intraperitoneal injection of nicotine tartrate (dissolved in 0.9% physiological saline) at 0.75 mg/kg BW/day and then administered ICA at 75 mg/kg BW/day via gastric gavage.
Each mouse was administered once a day for 35 consecutive days. The dosage of nicotine corresponded to the daily nicotine intake in people who smoke 10–20 cigarette sticks per day [8, 23]. The mice were weighed weekly to adjust the gavage or injection volume.

Dissection of testes and epididymides

At the end of treatment, the mice were sacrificed by cervical dislocation. The testes and epididymides were quickly collected and weighed. Testes samples for histopathological examination were kept in Bouin’s fixative to preserve normal morphology and facilitate further processing into paraffin blocks. Testes samples collected for assays of biochemical analysis and real-time PCR were snap-frozen in liquid nitrogen and stored at − 80 °C until they were used for further experiments. The epididymides were used for sperm density analysis. The organ (testicular / epididymal) index was determined as follows:
$$ \mathrm{Organ}\ \left(\mathrm{testicular}/\mathrm{epididymal}\right)\ \mathrm{index}=\mathrm{organ}\ \mathrm{weight}/\mathrm{body}\ \mathrm{weight}\times \mathrm{1,000}. $$

Epididymal sperm density

The left epididymis was used for sperm counting. The epididymides were cut into small pieces after which epididymal spermatozoa were collected and immersed in 4 mL of human tubal fluid (HTF) in a petri dish [24, 25]. This was incubated in 5% CO2 for 15 min at 37 °C, and homogenization-resistant sperms were counted using haemocytometer. The number of cells in at least 2 of the large corner squares (1 mm2) was counted [26].

Histopathological examination

The right testis was fixed in Bouin’s solution for 24 h and processed by standard histological procedures. Briefly, specimens were dehydrated in xylene and embedded in paraffin wax, 5 μm thick slices were cut from each sample onto a glass slide, and stained with haematoxylin-eosin (HE) routinely. Testicular morphology and structure were observed under the microscope.

Measurement of serum testosterone

When treatment ended, mice were placed in a plastic air-tight container, together with ketamine (100 mg/kg) and xylazine (10 mg/kg) soaked tissue paper and covered immediately for deep anesthesia, after which blood samples were obtained by cardiac puncture. The collected blood samples were centrifuged at 2000×g for 10 min to separate the serum. The serum was stored at − 20 °C until they were used for further analysis. The serum testosterone concentrations were measured using a radioimmunoassay (RIA) kits.

Determination of SOD, GPx activity, and MDA level

The testicular tissues stored at − 80 °C were homogenized after adding pre-cooled 0.9% physiological saline in the ratio of 1:9. When testicular tissues were disrupted, the homogenate was centrifuged at 5000 rpm for 10 min at 4 °C. The supernatant was used for assays involving superoxide dismutase (SOD), glutathione peroxidase (GPx), and MDA according to manufacturer’s instructions.

Quantitative real-time PCR analysis

The expression levels of 3β-hydroxysteroid dehydrogenase (3β-HSD), 17β-hydroxysteroid dehydrogenase (17β-HSD), steroidogenic acute regulatory protein (StAR), cytoplasmic superoxide dismutase 1 (SOD1), mitochondrial superoxide dismutase 2 (SOD2), extracellular superoxide dismutase 3 (SOD3), and glutathione peroxidase 1 (GPx1) mRNA in testicular tissues were assessed by qRT-PCR. Primers (Table 1) were synthesized at Shanghai Invitrogen Biotech Co. Ltd. Total RNA was extracted from testicular tissues using Trizol reagent (Invitrogen, CA, USA), and according to manufacturer’s instructions. The quality and quantity of the RNA preps were determined by gel electrophoresis and Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies Inc., DE, USA). Each real-time PCR reaction was carried out in triplicate in a 20-μL reaction mixture (2 μL cDNA, 6.8 μL H2O, 10 μL SYBR® Premix Ex Taq™, and 0.6 μL of each 10 μM forward and reverse primers). The PCR program was 30 s at 95 °C followed by 40 cycles of 5 s at 95 °C, 31 s at 60 °C. A melting curve was generated at the end of every run to ensure product uniformity (95 °C for 15 s, 60 °C for 15 s, 95 °C for 15 s). The relative expression of target genes was calculated using 2−ΔΔCt method with β-actin as an internal control.
Table 1
Primer sequences used in real-time polymerase chain reaction (RT-PCR)
Genes
Forward primer
Reverse primer
Lengths of amplicons (bp)
β-actin
TACTGAGCTGCGTTTTACACC
TCCTGAGTCAAAAGCGCCAA
177
3β-HSD
AGATAATCCTGAATGGCAACGA
TTTGCCCGTACAACCGAGA
245
17β-HSD
TGGGTGCTGTGTTGGATGTG
TGGCACAGTACACTTCGTGG
153
StAR
TGCGCTTAAATCTCCTAGCTC
TGGCTATCCTTCTGTGTAGACC
195
SOD1
AAGCGGTGAACCAGTTGTGT
CCGGGCCACCATGTTTCTTA
152
SOD2
AGGAGAGTTGCTGGAGGCTA
TAGTAAGCGTGCTCCCACAC
228
SOD3
GAGAAGATAGGCGACACGCA
GAGAACCAAGCCGGTGATCT
156
GPx1
ACAGTCCACCGTGTATGCC
CGTTCATCTCGGTGTAGTCCC
146
β-actin, Beta-actin; 3β-HSD, 3Beta-Hydroxysteroid dehydrogenase; 17β-HSD, 17Beta-Hydroxysteroid dehydrogenase; StAR, steroidogenic acute regulatory protein; SOD1, cytoplasmic superoxide dismutase 1; SOD2, mitochondrial superoxide dismutase 2; SOD3, extracellular superoxide dismutase 3; GPx1, Glutathione peroxidase 1

Statistical analysis

The results were expressed as mean ± standard deviation (SD) of the mean and statistically analyzed by one-way analysis of variance (ANOVA) using SPSS Statistics Package 25 (Chicago, IL, USA) and differences between experimental groups were considered significant at P < 0.05.

Results

Effects of icariin and nicotine on body weight, testicular, and epididymal weight

Comparisons of the body weights, testicular and epididymal weights, and testicular and epididymal indices between the four study groups of mice are shown in Table 2.
Table 2
Effects of icariin and nicotine on body weight, reproductive organ weight and index in the experimental mice
Groups
Initial Body Weight(g)
Final Body Weight(g)
Testicular weight(g)
Testicular index (mg/g)
Epididymal weight(g)
Epididymal index (mg/g)
Control
45.15 ± 2.20a
52.04 ± 4.67a
0.280 ± 0.023a
5.39 ± 0.30a
0.106 ± 0.008a
2.05 ± 0.11a
Nicotine
46.03 ± 2.27a
53.49 ± 4.10a
0.279 ± 0.019a
5.22 ± 0.15a
0.107 ± 0.011a
2.00 ± 0.14a
ICA
44.60 ± 3.35a
50.68 ± 3.76a
0.302 ± 0.023b
5.97 ± 0.39b
0.104 ± 0.007a
2.05 ± 0.13a
ICA + Nicotine
44.13 ± 2.56a
52.09 ± 5.01a
0.288 ± 0.021ab
5.56 ± 0.45ab
0.105 ± 0.008a
2.02 ± 0.11a
P-value
0.43
0.57
0.07
0.00
0.87
0.71
Values are expressed as means ± S.D.; (n = 10). Values not sharing a common superscript differ significantly at P < 0.05. ICA, Icariin

Effects of icariin and nicotine on testicle morphology

Figure 1 shows representative photomicrograph of the testes from the different groups. The seminiferous tubule basement membrane was continuous and complete, and the germ cells had normal morphology and regular arrangement in all groups (Fig. 1a, b, c, and d). Primary spermatocytes and early spermatids were also observed in the control, ICA, and nicotine plus ICA treated groups. However, developed lumina in the seminiferous tubules from the control (Fig. 1a) and ICA (Fig. 1c) treated mice showed complete spermatogenesis and high sperm density compared with that in the nicotine treated mice (Fig. 1b) where low sperm density was observed in constricted lumina. Upon co-treatment with ICA, the lumina of the seminiferous tubules showed complete spermatogenesis and improved sperm density (Fig. 1d).

Effects of icariin and nicotine on epididymal sperm density,serum testosterone concentration, MDA levels, activities of SOD, and GPx in mice testes

Comparisons of epididymal sperm densities, serum testosterone levels, and testicular tissue OS indices between the four study groups of mice are shown in Table 3.
Table 3
Testicular tissue SOD, GPx activities and MDA level, epididymal sperm density, and serum testosterone levels
Groups
SOD (U/mg protein)
GPx (U/mg protein)
MDA (nmol/g protein)
Epididymal sperm density
(107/mL)
Testosterone (ng/mL)
Control
159.35 ± 8.15a
23.26 ± 2.72a
3.97 ± 0.45a
1.02 ± 0.09a
0.341 ± 0.057a
Nicotine
147.34 ± 7.38b
22.83 ± 1.46ac
4.63 ± 0.67b
0.83 ± 0.07b
0.273 ± 0.035b
ICA
175.79 ± 9.03c
26.74 ± 1.95b
3.23 ± 0.61c
1.55 ± 0.31c
0.675 ± 0.105c
ICA+ Nicotine
169.55 ± 4.19c
24.13 ± 3.12ab
3.82 ± 0.57a
1.25 ± 0.19c
0.494 ± 0.065d
P-value
0.00
0.01
0.00
0.00
0.00
SOD superoxide dismutase; GPx glutathione peroxidase; MDA malondialdehyde; ICA Icariin. All data was expressed in mean ± SD; (n = 10); Values not sharing a common superscript differ significantly at P < 0.05

Effects of icariin and nicotine on mRNA expression levels of steroidogenic and antioxidant genes in mice testis

Comparisons of mRNA expression levels of steroidogenic and antioxidant genes in mice testis between the four study groups of mice are shown in Figs. 2 and 3.

Discussion

This pilot study evaluated the protective effects of ICA on reproductive toxicity induced by intraperitoneal injection of nicotine in adult male mice. Thirty-five consecutive days of nicotine treatment caused reproductive toxicity; as a result of decreased sperm concentration in the epididymis and increased MDA levels in the testis; however, co-treatment with ICA reversed these trends. This is probably because ICA improved testosterone concentration in blood and antioxidant enzyme activities in the testis thereby ameliorating the adverse effect of nicotine.
The result of our study also demonstrated that nicotine and ICA administration had no significant effect on body weight and epididymal weight/index. In 2014, Chen et al. reported that body weight of rats treated with ICA did not change significantly in any group, suggesting ICA has no obvious effects on adult rat growth [13]. Other studies also reported same findings and our results from ICA treatment were in concordant [10, 27]. On the other hand, Seema (2007) and Hasanzadeh (2017) reported that exposure to nicotine decreased body weight significantly in rats and mice respectively [2, 11]. Also, Williamson (1991), had earlier intimated that, in humans, cigarette smoking results in weight loss, and the smokers gained weight, when they quit smoking [28]. Our findings on nicotine were not the same and we speculate that these differences in weight results could be due to differences in dosage of nicotine administered, the administration route, duration of experiment, or the age of experimental animals.
Testosterone is essential for sexual differentiation, maintenance of spermatogenesis, and expression of male secondary sex characteristics [29]. Holdcraft (2004) reported that testosterone plays a leading role in both morphological development and reproductive function in the testis [18]. We found marked decreased serum testosterone concentrations and epididymal sperm density in the nicotine treated group. This finding was also in agreement with previous studies [4, 9, 10, 30]. However, co-treatment with ICA reversed these trends. Previous studies found that administration of E. brevicornum Maxim for 15 d dramatically increased testosterone levels compared with that in the control group and serum testosterone concentrations of ICA treated-rats significantly increased with increasing dosage [6, 13]. A report in human studies has revealed that the levels of nicotine detected in serum and semen of smokers showed positive correlation with the dose of smoking exposure [4]. In androgen-producing Leydig cells, nitric oxide/cyclic guanosine mono phosphate (NO/cGMP) signaling pathway participates in the regulation of steroidogenic activity [31]. Phosphodiesterase type 5 inhibitors (PDE5-Is) can inhibit PDE5, an enzyme responsible for the degradation of cGMP. Hence PDE5-Is could be involved in the activation of steroidogenic pathways and testosterone secretion. PDE5 is identified in Leydig cells [32]. Zhang et al. in 2012 described ICA as a PDE5-I with the potential to increase cellular cGMP through enhancement of nitric oxide synthase (NOS) in diabetic erectile dysfunction (ED) rats’corpus cavernosum tissue [33]. Considering the effects of ICA on the production of testosterone we speculate that ICA could play an important role in the activation of NO/cGMP pathway. A future study on the mechanism through which ICA improves testosterone production is therefore worth considering.
Testicular 3β-HSD and 17β-HSD plays a pivotal role in the biosynthesis of testosterone, which is a prerequisite for sperm production and maturation [34]. The mRNA expression level of 3β-HSD decreased following nicotine exposure, but the down-regulation tendency reversed as a result of co-treatment with ICA. We also found decreased levels of 17β -HSD activity due to nicotine exposure, meanwhile Pant (2003) and Pushpalatha (2005) earlier reported that male reproductive potentials decreased with decreasing testicular 17β-HSD activity levels following exposure to several xenobiotics in rats [35, 36]. Nevertheless, upon ICA treatment the results showed significant increase in 17β-HSD mRNA expression when compared with the nicotine treated group. StAR as a key transmembrane transport regulator plays a crucial role in testosterone production and its involvement in the transport of cholesterol across mitochondrial membrane is generally considered a rate-limiting step in steroidogenesis. In our study, steroidogenic gene StAR mRNA expression levels decreased following nicotine exposure, but the down-regulation trend reversed, when the adult mice were co-treated with ICA. The production of testosterone therefore could be affected when the mRNA expression levels of 3β-HSD, 17β-HSD, and StAR are up and down-regulated [13, 37]. This study suggests a possible mechanism through which ICA improves testosterone production.
ROS include hydroxyl radicals (•OH), superoxide anion (•O2-), hydrogen peroxide (H2O2), and nitric oxide (NO). ROS overproduction depletes sperm antioxidant system, which leads to a condition of OS. The OS arises when excess free radicals overwhelm the antioxidant defense of the male reproductive tract thereby damaging cells, tissues, and organs [38, 39]. There exist an elaborate array of antioxidant enzymes and free radical scavengers in the testes, and they ensure that the twin spermatogenic and steroidogenic functions are not impacted by OS [16, 17]. In cells, the SOD enzyme rapidly converts superoxide anion (•O2-) to less dangerous hydrogen peroxide (H2O2) so that GPx can decompose H2O2 to water [40, 41]. The MDA level is frequently used as key indicative index of tissue OS, which results from free radical damage to membrane components of cells [42]. In our study, administration of nicotine caused decreased activities of SOD and GPx enzymes, while MDA levels in the testes increased, leading to testicular OS. These results are in agreement with previous studies [23, 24]. However, co-treatment with ICA significantly inhibited depletion of SOD enzyme activity (as a result of nicotine exposure) and elevated MDA level in the testes. Testicular OS caused by nicotine was therefore eliminated by co-treatment with ICA. The results of this study suggest a possible protective mechanism of ICA against nicotine-mediated reproductive toxicity.
It is well known that SOD serves as an important antioxidant defense against OS. Three forms of SOD, namely, SOD1, SOD2, and SOD3 are present in mammals. More so, GPx1, the most abundant selenoperoxidase, is a key antioxidant enzyme in various cell types [17, 37]. In our study, the mRNA expression of SOD1 in the testes markedly decreased in the nicotine treated group compared with that in the control group, but when co-treated with ICA, these down-regulation tendencies of SOD1 efficiently reversed. The mRNA expression of SOD3 in the ICA and nicotine plus ICA treated group also increased significantly compared with that in the control and nicotine-treated group. Taniyama in 2003 explained that under physiological conditions, superoxide anions are scavenged by SOD1, SOD2, and SOD3 producing a relatively stable ROS H2O2 [43]. ICA treatment increased the mRNA expression of GPx1 significantly. Reporting on SOD1, SOD2, SOD3, and GPx1, Yuan et al. (2013) indicated that the mRNA expression of these antioxidant genes in mice testes decreased in the presence of cyclophosphamide (CP) which is a cytotoxic agent [44]. The mRNA expression levels of SOD1 and SOD3 decreased upon nicotine treatment, but co-treatment with ICA reversed these trends, this shows that ICA can protect against cytotoxic agents such as nicotine.

Study limitations

This pilot study is limited by the low number of mice (sample size) used. A study with much larger sample size will be needed to confirm the protective effect of ICA on nicotine-induced reproductive toxicity in male mouse.

Conclusions

In conclusion, our results show that nicotine-mediated reproductive toxicity in adult mice was ameliorated through ICA treatment, with characteristic actions such as increase secretion of testosterone, antioxidant capacities, and the suppression of OS. These results suggest that ICA could be used as a potential therapeutic agent in cases of decreased sperm production and OS mediated by cigarette smoking.

Acknowledgements

Not applicable.
All procedures and protocols involving animals were in accordance with the Animal Ethics Procedure and Guidelines of the People’s Republic of China and the Guide for the Care and Use of Laboratory Animals. All animal procedures were also approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing Agricultural University. There was no human participation in this study.
Not applicable.

Competing interests

The authors declare they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
2.
Zurück zum Zitat Seema P, Swathy SS, Indira M. Protective effect of selenium on nicotine-induced testicular toxicity in rats. Biol Trace Elem Res. 2007;120:212–8.PubMedCrossRef Seema P, Swathy SS, Indira M. Protective effect of selenium on nicotine-induced testicular toxicity in rats. Biol Trace Elem Res. 2007;120:212–8.PubMedCrossRef
3.
Zurück zum Zitat Kalpana C, Sudheer AR, Rajasekharan KN, Menon VP. Comparative effects of curcumin and its synthetic analogue on tissue lipid peroxidation and antioxidant status during nicotine-induced toxicity. Singap Med J. 2007;48:124–30. Kalpana C, Sudheer AR, Rajasekharan KN, Menon VP. Comparative effects of curcumin and its synthetic analogue on tissue lipid peroxidation and antioxidant status during nicotine-induced toxicity. Singap Med J. 2007;48:124–30.
5.
Zurück zum Zitat Oyeyipo IP, Raji Y, Emikpe BO, Bolarinwa AF. Effects of nicotine on sperm characteristics and fertility profile in adult male rats: a possible role of cessation. J Reprod Infertil. 2011;12:201–7.PubMedPubMedCentral Oyeyipo IP, Raji Y, Emikpe BO, Bolarinwa AF. Effects of nicotine on sperm characteristics and fertility profile in adult male rats: a possible role of cessation. J Reprod Infertil. 2011;12:201–7.PubMedPubMedCentral
6.
Zurück zum Zitat Mosbah R, Yousef MI, Mantovani A. Nicotine-induced reproductive toxicity, oxidative damage, histological changes and haematotoxicity in male rats: the protective effects of green tea extract. Exp Toxicol Pathol. 2015;67:253–9.PubMedCrossRef Mosbah R, Yousef MI, Mantovani A. Nicotine-induced reproductive toxicity, oxidative damage, histological changes and haematotoxicity in male rats: the protective effects of green tea extract. Exp Toxicol Pathol. 2015;67:253–9.PubMedCrossRef
7.
Zurück zum Zitat Salahipour MH, Hasanzadeh S, Malekinejad H. Ameliorative effects of Achillea millefolium inflorescences alcoholic extract against nicotine-induced reproductive failure in rat. Exp Toxicol Pathol. 2017;69:504–16.PubMedCrossRef Salahipour MH, Hasanzadeh S, Malekinejad H. Ameliorative effects of Achillea millefolium inflorescences alcoholic extract against nicotine-induced reproductive failure in rat. Exp Toxicol Pathol. 2017;69:504–16.PubMedCrossRef
8.
Zurück zum Zitat Hasanzadeh KA, Hasanzadeh S, Shalizar JA. Ameliorative effects of Achillea millefolium inflorescences alcoholic extract on nicotine-induced reproductive toxicity in male rat: apoptotic and biochemical evidences. Vet Res Forum. 2017;8:97–104.PubMedPubMedCentral Hasanzadeh KA, Hasanzadeh S, Shalizar JA. Ameliorative effects of Achillea millefolium inflorescences alcoholic extract on nicotine-induced reproductive toxicity in male rat: apoptotic and biochemical evidences. Vet Res Forum. 2017;8:97–104.PubMedPubMedCentral
9.
Zurück zum Zitat Pozharitskaya ON, Karlina MV, Shikov AN, Kosman VM, Makarova MN, Makarov VG. Determination of icariin in rat plasma by reverse-phase high-performance liquid chromatography after oral administration of a lipid-based suspension of Epimedium koreanum extract. Biomed Chromatogr. 2008;22:625–9.PubMedCrossRef Pozharitskaya ON, Karlina MV, Shikov AN, Kosman VM, Makarova MN, Makarov VG. Determination of icariin in rat plasma by reverse-phase high-performance liquid chromatography after oral administration of a lipid-based suspension of Epimedium koreanum extract. Biomed Chromatogr. 2008;22:625–9.PubMedCrossRef
10.
Zurück zum Zitat Pan Y, Kong L-D, Li Y-C, Xia X, Kung H-F, Jiang F-X. Icariin from Epimedium brevicornum attenuates chronic mild stress-induced behavioral and neuroendocrinological alterations in male Wistar rats. Pharmacol Biochem Behav. 2007;87:130–40.PubMedCrossRef Pan Y, Kong L-D, Li Y-C, Xia X, Kung H-F, Jiang F-X. Icariin from Epimedium brevicornum attenuates chronic mild stress-induced behavioral and neuroendocrinological alterations in male Wistar rats. Pharmacol Biochem Behav. 2007;87:130–40.PubMedCrossRef
11.
Zurück zum Zitat Xin H, Zhou F, Liu T, Li G-Y, Liu J, Gao Z-Z, Bai G-Y, Lu H, Xin Z-C. Icariin ameliorates Streptozotocin-induced diabetic retinopathy in vitro and in vivo. Int J Mol Sci. 2012;13:866–78.PubMedPubMedCentralCrossRef Xin H, Zhou F, Liu T, Li G-Y, Liu J, Gao Z-Z, Bai G-Y, Lu H, Xin Z-C. Icariin ameliorates Streptozotocin-induced diabetic retinopathy in vitro and in vivo. Int J Mol Sci. 2012;13:866–78.PubMedPubMedCentralCrossRef
12.
Zurück zum Zitat Huang Z-S, Xiao H-J, Qi T, Hu Z-M, Li H, Chen D-L, Xu Y-L, Chen J. Antioxidative protective effect of icariin on the FeSO4/H 2O 2-damaged human sperm based on confocal raman micro-spectroscopy. J Huazhong Univ Sci Technolog Med Sci. 2014;34:755–60.PubMedCrossRef Huang Z-S, Xiao H-J, Qi T, Hu Z-M, Li H, Chen D-L, Xu Y-L, Chen J. Antioxidative protective effect of icariin on the FeSO4/H 2O 2-damaged human sperm based on confocal raman micro-spectroscopy. J Huazhong Univ Sci Technolog Med Sci. 2014;34:755–60.PubMedCrossRef
14.
Zurück zum Zitat QiaoPing C, Ping W. Icariin supplementation protects mice from exercise-induced oxidant stress in liver. Food Sci Biotechnol. 2013;22:1409–13. QiaoPing C, Ping W. Icariin supplementation protects mice from exercise-induced oxidant stress in liver. Food Sci Biotechnol. 2013;22:1409–13.
15.
Zurück zum Zitat Liu T, Xin H, Li W-R, Zhou F, Li G-Y, Gong Y-Q, Gao Z-Z, Qin X-C, Cui W-S, Shindel AW, Xin Z-C. Effects of Icariin on improving erectile function in Streptozotocin-induced diabetic rats. J Sex Med. 2011;8:2761–72.PubMedCrossRef Liu T, Xin H, Li W-R, Zhou F, Li G-Y, Gong Y-Q, Gao Z-Z, Qin X-C, Cui W-S, Shindel AW, Xin Z-C. Effects of Icariin on improving erectile function in Streptozotocin-induced diabetic rats. J Sex Med. 2011;8:2761–72.PubMedCrossRef
16.
Zurück zum Zitat Aitken RJ, Roman SD. Antioxidant systems and oxidative stress in the testes. Mol Mech Spermatogenesis. 2008;636:154–71.CrossRef Aitken RJ, Roman SD. Antioxidant systems and oxidative stress in the testes. Mol Mech Spermatogenesis. 2008;636:154–71.CrossRef
17.
Zurück zum Zitat Sujatha R, Chitra KC, Latchoumycandane C, Mathur PP. Effect of lindane on testicular antioxidant system and steroidogenic enzymes in adult rats. Asian J Androl. 2001;3:135–8.PubMed Sujatha R, Chitra KC, Latchoumycandane C, Mathur PP. Effect of lindane on testicular antioxidant system and steroidogenic enzymes in adult rats. Asian J Androl. 2001;3:135–8.PubMed
18.
Zurück zum Zitat Holdcraft RW, Braun RE. Hormonal regulation of spermatogenesis. Int J Androl. 2004;27:335–42.PubMedCrossRef Holdcraft RW, Braun RE. Hormonal regulation of spermatogenesis. Int J Androl. 2004;27:335–42.PubMedCrossRef
19.
Zurück zum Zitat Xin ZC. Effects of Icariin on preventive erectile function in diabetic rats and its possible mechanism. J Sex Med. 2010;7:172. Xin ZC. Effects of Icariin on preventive erectile function in diabetic rats and its possible mechanism. J Sex Med. 2010;7:172.
20.
Zurück zum Zitat Liu T, Xin H, Li WR, Zhang J, Zhou F, Cui WS, Li GY, Gong YQ, Nan Z, Xin ZC. Effects of Icariin on improving erectile function in Streptozotocin-induced diabetic rats. J Sex Med. 2012;9:151. Liu T, Xin H, Li WR, Zhang J, Zhou F, Cui WS, Li GY, Gong YQ, Nan Z, Xin ZC. Effects of Icariin on improving erectile function in Streptozotocin-induced diabetic rats. J Sex Med. 2012;9:151.
21.
Zurück zum Zitat Fahyan SE. Biostatistics : a foundation for analysis in the health sciences / by Wayne W. Daniel: Wiley Sons; 1999. Fahyan SE. Biostatistics : a foundation for analysis in the health sciences / by Wayne W. Daniel: Wiley Sons; 1999.
22.
Zurück zum Zitat Zhou DX, Qiu SD, Zhang J, Tian H, Wang HX. The protective effect of vitamin E against oxidative damage caused by formaldehyde in the testes of adult rats. Asian J Androl. 2006;8:584–8.PubMedCrossRef Zhou DX, Qiu SD, Zhang J, Tian H, Wang HX. The protective effect of vitamin E against oxidative damage caused by formaldehyde in the testes of adult rats. Asian J Androl. 2006;8:584–8.PubMedCrossRef
23.
Zurück zum Zitat Paunovi MG, Ognjanovi BI, Štajn AŠ, Saičić ZS. Protective effects of quercetin and vitamin C against nicotine-induced toxicity in the blood of Wistar rats. Arh Hig Rada Toksikol. 2016;67:304–10.CrossRef Paunovi MG, Ognjanovi BI, Štajn AŠ, Saičić ZS. Protective effects of quercetin and vitamin C against nicotine-induced toxicity in the blood of Wistar rats. Arh Hig Rada Toksikol. 2016;67:304–10.CrossRef
24.
Zurück zum Zitat Yan FH, Chen YF, Zuo ZH, Chen YX, Yang ZM, Wang CG. Effects of tributyltin on epididymal function and sperm maturation in mice. Environ Toxicol Pharmacol. 2009;28:19–24.PubMedCrossRef Yan FH, Chen YF, Zuo ZH, Chen YX, Yang ZM, Wang CG. Effects of tributyltin on epididymal function and sperm maturation in mice. Environ Toxicol Pharmacol. 2009;28:19–24.PubMedCrossRef
26.
Zurück zum Zitat Oliveira H, Spano M, Santos C, Pereira MD. Lead chloride affects sperm motility and acrosome reaction in mice. Cell Biol Toxicol. 2009;25:341–53.PubMedCrossRef Oliveira H, Spano M, Santos C, Pereira MD. Lead chloride affects sperm motility and acrosome reaction in mice. Cell Biol Toxicol. 2009;25:341–53.PubMedCrossRef
27.
Zurück zum Zitat Cheng K, Ge BF, Zhen P, Chen KM, Ma XN, Zhou J, Song P. Ma HP: [effects of icariin and genistein on peak bone mass in rats]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2013;35:542–6.PubMed Cheng K, Ge BF, Zhen P, Chen KM, Ma XN, Zhou J, Song P. Ma HP: [effects of icariin and genistein on peak bone mass in rats]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2013;35:542–6.PubMed
28.
Zurück zum Zitat Williamson DF, Madans J, Anda RF, Kleinman JC, Giovino GA, Byers T. Smoking cessation and severity of weight gain in a national cohort. N Engl J Med. 1991;324:739–45.PubMedCrossRef Williamson DF, Madans J, Anda RF, Kleinman JC, Giovino GA, Byers T. Smoking cessation and severity of weight gain in a national cohort. N Engl J Med. 1991;324:739–45.PubMedCrossRef
29.
Zurück zum Zitat Payne AH, Youngblood GL. Regulation of expression of Steroidogenic enzymes in Leydig-cells. Biol Reprod. 1995;52:217–25.PubMedCrossRef Payne AH, Youngblood GL. Regulation of expression of Steroidogenic enzymes in Leydig-cells. Biol Reprod. 1995;52:217–25.PubMedCrossRef
30.
Zurück zum Zitat Abd El-Aziz GS, El-Fark MO, Hamdy RM. Protective effect of Eruca sativa seed oil against oral nicotine induced testicular damage in rats. Tissue Cell. 2016;48:340–8.PubMedCrossRef Abd El-Aziz GS, El-Fark MO, Hamdy RM. Protective effect of Eruca sativa seed oil against oral nicotine induced testicular damage in rats. Tissue Cell. 2016;48:340–8.PubMedCrossRef
31.
Zurück zum Zitat Andric SA, Janjic MM, Stojkov NJ, Kostic TS. Testosterone-induced modulation of nitric oxide-cGMP signaling pathway and androgenesis in the rat Leydig cells. Biol Reprod. 2010;83:434–42.PubMedCrossRef Andric SA, Janjic MM, Stojkov NJ, Kostic TS. Testosterone-induced modulation of nitric oxide-cGMP signaling pathway and androgenesis in the rat Leydig cells. Biol Reprod. 2010;83:434–42.PubMedCrossRef
32.
Zurück zum Zitat Saraiva KL, Silva AK, Wanderley MI. De Ara¨2jo AA, De Souza JR, Peixoto CA: chronic treatment with sildenafil stimulates Leydig cell and testosterone secretion. Int J Exp Pathol. 2009;90:454–62.PubMedPubMedCentralCrossRef Saraiva KL, Silva AK, Wanderley MI. De Ara¨2jo AA, De Souza JR, Peixoto CA: chronic treatment with sildenafil stimulates Leydig cell and testosterone secretion. Int J Exp Pathol. 2009;90:454–62.PubMedPubMedCentralCrossRef
33.
Zurück zum Zitat Zhang J, Wang YB, Ma CG, Liu T, Li WR, Gong YQ, Xin ZC. Icarisid II, a PDE5 inhibitor from Epimedium wanshanense, increases cellular cGMP by enhancing NOS in diabetic ED rats corpus cavernosum tissue. Andrologia. 2012;44(Suppl 1):87–93.PubMedCrossRef Zhang J, Wang YB, Ma CG, Liu T, Li WR, Gong YQ, Xin ZC. Icarisid II, a PDE5 inhibitor from Epimedium wanshanense, increases cellular cGMP by enhancing NOS in diabetic ED rats corpus cavernosum tissue. Andrologia. 2012;44(Suppl 1):87–93.PubMedCrossRef
34.
Zurück zum Zitat Priya PH, Reddy PS. Effect of restraint stress on lead-induced male reproductive toxicity in rats. J Exp Zool A Ecol Genet Physiol. 2012;317:455–65.PubMedCrossRef Priya PH, Reddy PS. Effect of restraint stress on lead-induced male reproductive toxicity in rats. J Exp Zool A Ecol Genet Physiol. 2012;317:455–65.PubMedCrossRef
35.
Zurück zum Zitat Pant N, Srivastava SP. Testicular and spermatotoxic effects of quinalphos in rats. Journal of applied toxicology : JAT. 2003;23:271–4.PubMedCrossRef Pant N, Srivastava SP. Testicular and spermatotoxic effects of quinalphos in rats. Journal of applied toxicology : JAT. 2003;23:271–4.PubMedCrossRef
36.
Zurück zum Zitat Pushpalatha T, Srinivas M, Sreenivasula Reddy P. Exposure to high fluoride concentration in drinking water will affect spermatogenesis and steroidogenesis in male albino rats. Biometals. 2005;18:207–12.PubMedCrossRef Pushpalatha T, Srinivas M, Sreenivasula Reddy P. Exposure to high fluoride concentration in drinking water will affect spermatogenesis and steroidogenesis in male albino rats. Biometals. 2005;18:207–12.PubMedCrossRef
37.
Zurück zum Zitat Das J, Ghosh J, Manna P, Sil PC. Taurine protects rat testes against doxorubicin-induced oxidative stress as well as p53, Fas and caspase 12-mediated apoptosis. Amino Acids. 2012;42:1839–55.PubMedCrossRef Das J, Ghosh J, Manna P, Sil PC. Taurine protects rat testes against doxorubicin-induced oxidative stress as well as p53, Fas and caspase 12-mediated apoptosis. Amino Acids. 2012;42:1839–55.PubMedCrossRef
38.
Zurück zum Zitat Agarwal A, Sekhon LH. The role of antioxidant therapy in the treatment of male infertility. Hum Fertil (Camb). 2010;13:217–25.CrossRef Agarwal A, Sekhon LH. The role of antioxidant therapy in the treatment of male infertility. Hum Fertil (Camb). 2010;13:217–25.CrossRef
40.
Zurück zum Zitat Das S, Gautam N, Dey SK, Maiti T, Roy S. Oxidative stress in the brain of nicotine-induced toxicity: protective role of Andrographis paniculata Nees and vitamin E. Appl Physiol Nutr Metab. 2009;34:124–35.PubMedCrossRef Das S, Gautam N, Dey SK, Maiti T, Roy S. Oxidative stress in the brain of nicotine-induced toxicity: protective role of Andrographis paniculata Nees and vitamin E. Appl Physiol Nutr Metab. 2009;34:124–35.PubMedCrossRef
41.
Zurück zum Zitat Oyeyipo IP, Raji Y, Bolarinwa AF. Antioxidant profile changes in reproductive tissues of rats treated with nicotine. J Hum Reprod Sci. 2014;7:41–6.PubMedPubMedCentralCrossRef Oyeyipo IP, Raji Y, Bolarinwa AF. Antioxidant profile changes in reproductive tissues of rats treated with nicotine. J Hum Reprod Sci. 2014;7:41–6.PubMedPubMedCentralCrossRef
42.
Zurück zum Zitat Hong Z, Hailing L, Hui M, Guijie Z, Leyan Y, Dubing Y. Effect of vitamin E supplement in diet on antioxidant ability of testis in Boer goat. Anim Reprod Sci. 2010;117:90–4.PubMedCrossRef Hong Z, Hailing L, Hui M, Guijie Z, Leyan Y, Dubing Y. Effect of vitamin E supplement in diet on antioxidant ability of testis in Boer goat. Anim Reprod Sci. 2010;117:90–4.PubMedCrossRef
43.
Zurück zum Zitat Taniyama Y, Griendling KK. Reactive oxygen species in the vasculature: molecular and cellular mechanisms. Hypertension. 2003;42:1075–81.PubMedCrossRef Taniyama Y, Griendling KK. Reactive oxygen species in the vasculature: molecular and cellular mechanisms. Hypertension. 2003;42:1075–81.PubMedCrossRef
44.
Zurück zum Zitat Yuan D, Wang H, He H, Jia L, He Y, Wang T, Zeng X, Li Y, Li S, Zhang C. Protective effects of total flavonoids from Epimedium on the male mouse reproductive system against cyclophosphamide-induced oxidative injury by up-regulating the expressions of SOD3 and GPX1. Phytother Res. 2014;28:88–97.PubMedCrossRef Yuan D, Wang H, He H, Jia L, He Y, Wang T, Zeng X, Li Y, Li S, Zhang C. Protective effects of total flavonoids from Epimedium on the male mouse reproductive system against cyclophosphamide-induced oxidative injury by up-regulating the expressions of SOD3 and GPX1. Phytother Res. 2014;28:88–97.PubMedCrossRef
Metadaten
Titel
Evaluation of the protective effects of icariin on nicotine-induced reproductive toxicity in male mouse –a pilot study
verfasst von
Guochao Ni
Xuhui Zhang
Seth Yaw Afedo
Rong Rui
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
Reproductive Biology and Endocrinology / Ausgabe 1/2020
Elektronische ISSN: 1477-7827
DOI
https://doi.org/10.1186/s12958-020-00620-0

Weitere Artikel der Ausgabe 1/2020

Reproductive Biology and Endocrinology 1/2020 Zur Ausgabe

Update Gynäkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.