Everolimus downregulates estrogen receptor and induces autophagy in aromatase inhibitor-resistant breast cancer cells

The MCF-7 cell line [31, 32] was obtained from Dr. V. Craig Jordan (University of Texas MD Anderson Cancer Center, Houston) and maintained in RPMI-1640 medium supplemented with 10 % fetal bovine serum, 2 mM glutamine, Antibiotic/Antimitotic mix, MEM Non-Essential Amino Acids (Invitrogen, Waltham, MA), and bovine insulin at 6 ng/mL (Sigma Aldrich, St. Louis, MO). The long-term estrogen deprived human breast cancer cell lines; MCF-7:5C [31, 33] and MCF-7:2A [32, 34] were cloned from parental MCF-7 cells following long term (>12 months) culture in estrogen-free medium composed of phenol red-free RPMI-1640, 10 % fetal bovine serum treated three times with dextran-coated charcoal (SFS), 2 mM glutamine, bovine insulin at 6 ng/mL, Antibiotic/Antimitotic mix, and MEM Non-Essential Amino Acids (Invitrogen). The MCF10A cell line was purchased from the American Type Tissue Culture Collection. They are maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) in a 1:1 mixture and supplemented with 5 % horse serum, Antibiotic/Antimitotic mix (100 IU/mL penicillin, 100 μg/mL streptomycin, 25 μg/mL of Fungizone® from Invitrogen, Grand Island, NY), 20 ng/ml EGF (Millipore), 0.5 mg/ml hydrocortisone, 100 ng/ml cholera toxin (Sigma Aldrich). All cell lines were cultured at 37 °C under 5 % CO₂. After overnight acclimatization period, cells were cultured with 20 nM everolimus alone or in combination with 1 μM 4-hydroxytamoxifen (Sigma Aldrich) or 50 μM Chloroquine (InvivoGen, San Diego, CA), in their normal culture medium.

Cells were assayed for viability in 24-well plates using the Cell-Titer Blue Assay Kit (Promega, Madison, WI) per the manufacturer’s instructions. Assay plates were kept at 37 °C in 5 % CO₂ for 3 h and read at 560–590 nM on a BioTek Synergy 4 microplate reader using the Gen 5 data analysis software (BioTek Instruments, Winooski, VT).

Cells were seeded in 6-well plates, collected using a cell scraper and suspended in RIPA buffer (Thermo Scientific, Pittsburgh, PA) supplemented with protease inhibitor cocktail and phosphatase inhibitor (Sigma Aldrich). Cells were homogenized over ice by sonication. After purification of the sample by centrifugation, protein concentration was determined by protein assay (Bio-Rad, Hercules, CA). The proteins were separated by 4-12 % SDS–polyacrylamide gel electrophoresis (SDS–PAGE) and electrically transferred to a polyvinylidene difluoride membrane (Santa Cruz Biotechnology). After blocking the membrane using 5 % non-fat milk, target proteins were detected using either Anti-mTOR, anti-phospho-mTOR, anti- LC3A/B (Cell Signaling, Beverly, MA), anti-p70S6K, anti-phospho-p70S6K, anti-AKT, anti-phospho-AKT (S473) or anti-ERα (Santa Cruz Biotechnology) antibodies. Membranes were stripped and re-probed for β-actin (Cell Signaling) or β-tubulin (Sigma Aldrich). The appropriate horseradish peroxidase (HRP)-conjugated secondary antibody was applied and the positive bands were detected using Amersham ECL Plus Western blotting detection reagents (GE Health care, Piscataway, NJ). In the case of LC3 analysis, cells were treated with 50 μM chloroquine (CQ) for 24 or 48 h to allow for LC3-II accumulation. Immunoreactivity was detected using anti-mouse or anti-rabbit IgG conjugated to Dylight 680 or 800 fluorochromes (Thermo Scientific, Waltham, MA), respectively. Blots were visualized on Odyssey imager (LiCor, Lincoln, NE). Quantitation of immunoreactive signals was done by densitometry using ImageJ 1.46r software (NIH, Bethesda, MA). The ratio of protein expression to β-tubulin in each lane was calculated and presented relative to the respective controls within each experiment.

Cells were incubated in the appropriate cell culture media with and without drug treatment. Cells were harvested at the indicated time points by trypsinization. They were washed once with cold PBS and stained with 50 μg/mL Propidium Iodide and 100 μg/mL RNase A in PBS (Invitrogen). Samples were analyzed using a BD FACSAria™ II Flow Cytometer (BD, Franklin Lakes, NJ) and the data were analyzed with FlowJo software (Ashland, OR).

Cells were seeded at 1,000 cells per well in 6-well plate in singe cell suspension. After 24 h acclimatization, they were treated every three days and allowed to proliferate and establish colonies for 9 days. Cells were stained with 0.5 % crystal violet in 1:7 acetic acid: methanol and imaged at 1X in a Bio-Rad ChemiDoc™ XRS+ System with Image Lab™ Software (Bio-Rad Laboratories Inc., Hercules, CA). Colonies were counted and measured using Image J software (The National Institute of Health, Bethesda, MD).

6-well plates were coated with 1 mL of 0.8 % agarose in the appropriate culture media. Cells were then suspended in 0.48 % agarose and immediately overlaid on the pre-coated plates. Once the agarose was solid, 1 mL of culture medium with or without 20 nM everolimus was added and replaced every 4 days for 15 days. Cultures were then stained with 0.005 % crystal violet in PBS, washed with PBS until the background was clear and imaged microscopically at 10X for measurement of colony diameter. Plates were also imaged at 1X in a Bio-Rad ChemiDoc™ XRS+ System with Image Lab™ Software (Bio-Rad). Colonies were counted and measured using Image J software (NIH).

Cells were seeded in 6-well plates and allowed to acclimatize overnight. Following 72 h treatment with 20 nM everolimus, cells were harvested by cell scraping in RLT lysis buffer and total RNA was isolated using the Qiagen RNeasy kit (Venlo, Limburg). First strand cDNA synthesis was performed from 3 μg total RNA using MulV Reverse Transcriptase (Applied Biosystems, Carlsbad, CA) on a Bio Rad MyCycler™. RT-PCR was conducted using the ViiA™ 7 Real-Time PCR system (Applied Biosystems) and SYBR Green Reagent (Life Technologies, Carlsbad, CA) with primers specific for ERα and the housekeeping gene PUM1. Primers for ERα: Forward 5’–AAGAGGGTGCCAGGCTTTGT–3’, Reverse 5’–CAGGATCTCTAG CCAGGCACAT –3’. Primers for PUM1: Forward-TCACCGAGGCCCCTCTGAACCCTA Reverse- GGCAGTAATCTCCTTCTGCATCCT (Integrated DNA Technologies, Coralville, Iowa). Relative ERα mRNA expression level was determined as the ratio of the signal intensity to that of PUM1 using the formula: 2^-ΔCT. When treated with everolimus, fold change in ERα expression was normalized to PUM1 and then compared to the untreated value for that cell line using the formula: 2^-ΔΔCT.

Cells were seeded in 12-well tissue culture plates overnight for attachment before transfection. The cells were transfected using Lipofectamine 2000™ Transfection Reagent (Invitrogen, San Diego) according to the manufacturer's recommendations. Briefly, 4 μL of Lipofectamine 2000, 0.8 μg of ERE Luciferase plasmid DNA and 0.01 μg of the pRL CMV Renilla (Promega) were diluted individually in 250-μl aliquots of OptiMEM Reduced-Serum Medium (Invitrogen). Cells were incubated for 24 h after transfection, and then treated with 20 nM EVE or vehicle in complete media for 24 h. The Luciferase and Renilla activities were measured using the dual luciferase assay kit (Promega) according to the manufacturer's instructions. To confirm the specificity of the ERE Luciferase construct, EVE treated cells were also compared to those treated with 1nM 17β-estradiol and 1nM Fulvestrant, a pure anti-estrogen (Sigma). Relative Fluorescence Units (RFUs) were calculated as a ratio of Luciferase to Renilla signal intensity. The ERE Luciferase reporter construct was a kind gift from Dr. Clodia Osipo (Loyola University, Chicago, IL).

Cells grown on glass coverslips were washed in PBS and fixed with 100 % ice cold methanol for 10 min. After permeabilization by 0.1 % Triton X-100 in PBS for 10 min, cells were incubated with 5 % normal horse serum/PBS for 30 min, followed by incubation with ERα or LC3B antibody, 2 μg/mL in 0.01 % Triton X-100 /PBS overnight (Santa Cruz Biotechnology). Cells were stained with fluorescein isothiocyanate (FITC)-conjugated labeled goat anti-rabbit IgG (Cell Signaling), 4 μg/mL in PBS for 1 h, followed by coverslip mounting with the ProLong® Gold anti-fade reagent with DAPI (Life Technologies). Samples were imaged on a Leica TCS SPE confocal microscope in the Confocal Imaging Core at The University of Kansas Medical Center. Images were collected and analyzed using the Leica LAS AF Lite software (Leica Biosystems, Nussloch, Germany). For quantification, mean fluorescent intensity was determined using Image J software on green (FITC) channel images.

1 x10⁶ cells were seeded in 6-well plates and treated after an overnight acclimatization. After 72 h of treatment cells were harvested by scraping and fixed for 24 h at 4 °C in 0.1 M cacodylate buffer supplemented with 2 % glutaraldehyde. Samples were then processed in The Electron Microscopy Research Laboratory at KU Medical Center as follows. Briefly, cell pellets were washed in 0.1 M cacodylate buffer for 10 min, and resuspended. Cell pellets were post fixed in 1 % osmium tetroxide buffered in 0.1 M cacodylate, rinsed in distilled water 3X’s and then dehydrated in a graded series of ethanol as follows: 50 %, 70 %, 80 %, 95 %, 100 %, 100 % 10 min each step. Cells were placed into propylene oxide for 20 min, then into a 50:50 mixture of propylene oxide and Embed 812 resin medium overnight at room temperature. Samples were cured overnight in beem capsules at 60 degrees and then sectioned with a diamond knife on a Leica UC-7. Sections were cut at 80 nm and contrasted with uranyl acetate and lead citrate and imaged on a JEOL 100CX II Transmission Electron Microscope (Tokyo, Japan).

At least three separate experiments were performed for each measurement unless otherwise indicated. All quantitative data were expressed as means with error bars representing 1 standard deviation (mean ± 1SD). Comparisons between two treatments were analyzed using a two-way student t-test with P-value of < 0.05 considered to be statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001 unless otherwise indicated.

We tested the anti-proliferative effect of everolimus in two AI-resistant breast cancer cell lines, MCF-7:5C and MCF-7:2A and their parental AI-sensitive cell line, MCF-7. We found that everolimus inhibited the proliferation of MCF-7:5C and MCF-7:2A cells with relatively equal efficiency compared to MCF-7 breast cancer cells (Fig. 1a, upper panel). The IC₅₀ values for MCF-7, MCF-7:5C and MCF-7:2A cells were 25 nM, 38 nM and 20 nM, respectively, indicating only minor differences in sensitivity to everolimus between these cell lines (Fig. 1a, lower panel). Treatment with 20 nM everolimus achieved maximal inhibition of all three cell lines (Fig. 1a) as early as 24 h post-treatment (Fig. 1b). Additionally, the everolimus mediated inhibition of proliferation could be maintained with treatment every three days under clonogenic assay conditions (Fig. 1c). In contrast, everolimus had no effect on the proliferation of the immortalized normal breast epithelium cell line, MCF10A (Additional file 1: Figure S1a and b).

Cell cycle analysis of MCF-7, MCF-7:5C, and MCF-7:2A cells treated with everolimus indicated that the anti-proliferative effect of the drug was due to G1 arrest. The percentage of cells in G1 phase increased by at least 20 % in all three cells lines as early as 24 h after treatment (Fig. 2a) and this persisted through 72 h (Fig. 2b). Everolimus had no effect on the cycling of the normal breast epithelial cell line MCF10A (Additional file 1: Figure S1c). Additionally, we found that the expression of cyclin D1 and p21 were significantly reduced in MCF-7, MCF-7:5C and MCF-7:2A cells 48 and 72 h after treatment (Fig. 2c). This data indicates that everolimus is effective at inhibiting the proliferation of breast cancer cells due to marked induction of G1 arrest.

The ability of cancer cells to grow in an anchorage-independent manner is a critical marker of tumor forming and metastatic potential. We compared the abilities of MCF-7, MCF-7:5C and MCF-7:2A cells to grow in an anchorage-independent manner using the soft-agar 3D colony formation assay. We found that MCF-7:5C cells produced three times more 3D colonies than the MCF-7 and MCF-7:2A cells. Additionally, 20 nM everolimus significantly reduced the number of 3D colonies in all three cell lines (Fig. 3a). The 3D colonies formed by the MCF-7:5C cells averaged 18 μM², while those formed by the MCF-7 and MCF-7:2A cells averages 40 and 35 μM² respectively. Upon microscopic inspection, we found that 20 nM everolimus dramatically reduced the size of 3D colonies in all three cell lines, with the most pronounced effect being on the MCF-7:5C cells (Fig. 3b). These data indicate that everolimus inhibits not just the proliferation of breast cancer cells, but also their tumor forming and metastatic potential.

We also examined the effect of everolimus treatment on the activation of the PI3K/Akt/mTOR pathway. We found that everolimus significantly inhibited mTOR phosphorylation as early as 30 min post treatment but not Akt, p70S6K and 4EBP1 (Fig. 4, upper panels). Everolimus inhibited the phosphorylation of downstream members of the PI3K/Akt/mTOR pathway at 12 h. This was most prominent at 24 h in MCF-7, MCF-7:5C and MCF-7:2A cells (Fig. 4, bottom panels). 25 nM everolimus was sufficient to inhibit PI3K/mTOR/Akt signaling at 12 and 24 h but higher doses were more effective at blocking phosphorylation. Notably, inhibition of p70S6K phosphorylation was observed by 60 min in the AI-sensitive MCF-7 cell line, especially with higher doses, but not in the AI-resistant MCF-7:5C and MCF-7:2A cells until 12 h post-treatment (Fig. 4). Reduction of phospho- mTOR, p70S6K and Akt were maintained by 20 nM everolimus through 48 and 72 h (Additional file 2: Figure S2). Everolimus successfully targets the Akt/mTOR pathway in AI-sensitive and AI-resistant breast cancer cells.

The activity of ER can be regulated by the PI3K/Akt/mTOR pathway and is critical to the survival and proliferation of AI-sensitive MCF-7 cells, as well as the AI-resistant MCF-7:5C and MCF-7:2A cell lines. The ligand-independent activity of ER maintains the growth and survival of AI-resistant breast cancer cells [35, 36]. We found that treatment with everolimus significantly reduced ER transcriptional activity and protein expression (Fig. 5a and b). This was compared to the action of the pure anti-estrogen fulvestrant (Fig. 5a and b). Everolimus also dramatically reduced ERα mRNA expression (Fig. 5c) in addition to protein expression of the ER chaperone, HSP90 (Fig. 5d). Downregulation of ER expression was confirmed by immunofluorescent confocal microscopy (Fig. 5e). Notably, there was higher ER transcriptional activity in AI-resistant MCF-7:5C and MCF-7:2A cells compared to parental MCF-7 cells, confirming estrogen-independent ER action in the resistant cells (Fig. 5a). Taken together, these data indicate that everolimus, and therefore PI3K/Akt/mTOR signaling, is capable of regulating ER expression and transcriptional activity in both wild-type MCF-7 cells and AI-resistant MCF-7:5C and MCF-7:2A cells.

Due to earlier studies that have found synergy between tamoxifen and everolimus in endocrine-sensitive breast cancer cell models and patients, we investigated the efficacy of this combination in our MCF-7, MCF-7:5C and MCF-7:2A cells. We have previously shown that the AI-resistant MCF-7:5C cells are not responsive to 4OHT, whereas MCF-7:2A are partially sensitive to 4OHT [36]. In this study, 1 μM 4OHT significantly inhibited the proliferation of MCF-7 and MCF-7:2A cells, reducing the number of 2D colonies by 20 % and 10 % respectively, but had no effect on MCF-7:5C cells (Fig. 6a). Treatment with 20 nM everolimus for 9 days significantly reduced the proliferation of all three cell lines, reducing colony numbers by ~ 60 % (Fig. 6a). Co-treatment of MCF-7, MCF-7:5C and MCF-7:2A cells with 1 μM 4OHT and 20 nM everolimus reduced colony formation in MCF-7 and MCF-7:2A cells by ~ 95 % and also had added benefit in the 4OHT-resistant MCF-7:5C cells, bringing the anti-proliferative effect from 60 % to 76 %. Synergy between 4OHT and everolimus treatment was present despite reductions in ERα expression in all three cell lines (Fig. 6b). This data supports clinical observations that the combination of tamoxifen with everolimus has therapeutic benefit in patients with ER+ breast cancer and can re-sensitize AI-resistant breast cancer to endocrine therapy.

We investigated whether everolimus treatment induced autophagy in MCF-7, MCF-7:5C and MCF-7:2A cells. We found that everolimus reduced the levels of HSP70 and HSP27 in all three cell lines (Fig. 7a). Interestingly, everolimus also induced PARP cleavage (Fig. 7a); however, this was not associated with apoptosis by annexin v/PI staining (data not shown). Chloroquine was used as an autophagic flux inhibitor, and basal autophagy was assessed with and without everolimus treatment. Both immunofluorescent microscopy and western blot (Fig. 7b and 7c), indicate that everolimus markedly enhanced LC3-II above basal level, respectively. A lysosomal protease inhibitor cocktail (100 μM leupeptin, 10 μg/mL pepstatin A and 10 μg/mL e-64d for 24 h) was also used to inhibit autophagic flux but results were not as robust as with 50 μM chloroquine (data not shown). As further indication of everolimus’ ability to induce autophagy, the number of autophagosomes identified by electron microscopy in all three cell lines was also increased (Fig. 8a and 8b). Combined inhibition of autophagy with 50 μM CQ significantly improved the efficacy of everolimus treatment on cell proliferation, indicating that autophagy is a method of everolimus insensitivity in MCF-7 cell lines (Fig. 8c). Under normal conditions, the MCF-7:5C cell line displayed dilated endoplasmic reticulum, and both AI-resistant cell lines had pleomorphic mitochondria, indicating that aberrant metabolism is likely part of the phenotype of these AI-resistant breast cancer models (Fig. 8a). These data suggest that MCF-7, MCF-7:5C and MCF-7:2A cells use autophagy as a method of everolimus resistance and that this response may be inhibited to improve the efficacy of everolimus treatment in breast cancer.