Zum Inhalt

Exchanging the stem-loop A promoter of Zika virus with the corresponding region of tick-borne encephalitis virus generates a chimeric virus that replicates in vertebrate and mosquito cells

  • Open Access
  • 01.12.2025
  • Original Article
Erschienen in:

Abstract

The 5’ end of the orthoflavivirus genome contains a stem-loop structure, known as stem-loop A (SLA), which interacts with the viral polymerase (the NS5 protein) and functions as the promoter during RNA replication. Previously, we replaced the SLA of Zika virus (ZIKV; a mosquito/vertebrate orthoflavivirus) with the corresponding region of Long Pine Key virus (a dual-host-associated insect-specific orthoflavivirus), producing a chimeric virus capable of replicating in both mosquito and vertebrate cells. Here, we investigated whether additional chimeric viruses could be created by replacing the SLA of ZIKV with those of other orthoflaviviruses that are maintained in different transmission cycles, namely: tick-borne encephalitis virus (TBEV; a tick/vertebrate orthoflavivirus), Culex flavivirus (a classical insect-specific orthoflavivirus), Modoc virus (a rodent-associated vertebrate-specific orthoflavivirus), and Rio Bravo virus (a bat-associated vertebrate-specific orthoflavivirus). Exchanging the SLA of ZIKV with that of TBEV produced a chimeric virus capable of replicating in mosquito and vertebrate cells, whereas the other SLA replacements did not yield infectious virus. The chimeric virus replicated more slowly, reached lower titers, and produced smaller plaques than wild-type ZIKV in vertebrate cells. The chimeric virus also exhibited reduced fitness in mosquito cells. These findings demonstrate that replacement of the SLA of ZIKV with the corresponding region of TBEV produces a chimeric virus that replicates in both mosquito and vertebrate cells, revealing that ZIKV NS5 is able to recognize and bind to the TBEV promoter, rendering it active. This study highlights the importance of SLA–polymerase compatibility in flavivirus replication and provides insight into the molecular basis of host adaptation.
Handling Editor: Hugo Soudeyns

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s00705-025-06435-x.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Introduction

Many viruses in the genus Orthoflavivirus (formerly "Flavivirus") have evolved to cycle between vertebrate hosts and blood-feeding arthropods, facilitating dual-host transmission [1, 2]. These viruses can be broadly separated into two main groups: mosquito-borne and tick-borne orthoflaviviruses. An example of a mosquito-borne flavivirus (MBFV) is Zika virus (ZIKV), a widespread pathogen linked to serious neurological disorders such as microcephaly and Guillain-Barré syndrome in humans [3]. Among the tick-borne flaviviruses (TBFVs), tick-borne encephalitis virus (TBEV) is the most extensively studied, as it is a leading cause of viral encephalitis in humans across Europe and Asia [4].
While many orthoflaviviruses utilize both arthropod and vertebrate hosts, some are restricted to a single host and replicate exclusively in insects or vertebrates [57]. Insect-specific flaviviruses (ISFs) can be separated into two groups: classical ISFs (cISFs) and dual-host-associated ISFs (dISFs). cISFs were the first to be discovered and form a distinct phylogenetic lineage separate from other orthoflaviviruses. In contrast, dISFs are phylogenetically related to MBFVs, despite their inability to replicate in vertebrate cells. Representative viruses from the cISF and dISF groups are Culex flavivirus (CxFV) and Long Pine Key virus (LPKV), respectively [8, 9]. Vertebrate-specific orthoflaviviruses, also known as "no known vector" (NKV) orthoflaviviruses, are maintained in nature by direct transmission between bats or rodents [6]. Notable examples include Rio Bravo virus (RBV), which is associated with bats, and Modoc virus (MODV), which is found in rodents [10, 11].
Orthoflaviviruses possess a positive-sense, single-stranded RNA genome of 10–11 kb [1214]. The genome is capped at the 5’ end with a type I cap structure but lacks a polyadenine tail at the 3’ end. The genome contains a long open reading frame (ORF), flanked by 5′ and 3′ untranslated regions (UTRs) of approximately 100 and 400–700 nucleotides (nt), respectively. The ORF encodes a polyprotein that is processed by both viral and host proteases into three structural proteins, designated the capsid (C), pre-membrane/membrane (prM/M), and envelope (E) proteins, and seven nonstructural (NS) proteins, organized in the genome in the following order: 5′-C-prM(M)-E-NS1-NS2A-NS2B-NS3-NS4A-2K-NS4B-NS5-3′. The structural proteins, along with the viral RNA and host-derived lipid membrane, comprise the virion, while the NS proteins are required for genome replication, translation, assembly, and evasion of host immune responses [12, 13, 15].
The 5’ and 3’ UTRs of the orthoflavivirus genome contain multiple conserved structural motifs that play critical roles in viral RNA replication and translation [14, 16]. Among these motifs is stem-loop A (SLA), located in the 5’ UTR and consisting of approximately 70 nt [16, 17]. SLA functions as the promoter for genome replication and is recognized at least twice by NS5, a large (103-kDa) multifunctional enzyme composed of an N-terminal methyltransferase (MTase) domain and a C-terminal RNA-dependent RNA polymerase (RdRp) domain [1820]. NS5 engages with SLA to initiate synthesis of the negative-strand RNA, then binds again during positive-strand RNA synthesis to methylate the 5’ guanine cap [19]. Negative-strand synthesis also depends on genome circularization, which is achieved through long-range interactions between complementary RNA sequences spanning the 5′ UTR, C gene, and 3′ UTR [16, 21, 22].
Although SLA sequences vary greatly among orthoflaviviruses, many share a predicted Y-shaped secondary structure. This structure typically includes a top loop (TL), a side-stem loop (SSL), a bulge, and a bottom stem (BS), suggesting that NS5 recognizes shared structural features rather than specific nucleotide sequences [17, 2325]. Structural studies using X-ray crystallography have confirmed these key features in the SLAs of both dengue virus 2 (DENV2) and ZIKV [19]. Additionally, nuclear magnetic resonance spectroscopy has confirmed the topology of the SLA of dengue virus 1 [26]. High-resolution crystal structures have also been determined for the NS5 proteins of ZIKV and several other pathogenic viruses from the MBFV and TBFV groups [2736].
The NS5 proteins and SLAs of different MBFVs can functionally interact [18, 3739]. For example, substitution of the SLA of West Nile virus (WNV) with that of DENV2 generated a chimeric virus capable of replicating in both mosquito and vertebrate cells, indicating that WNV NS5 recognizes and binds to the DENV2 SLA [38]. SLA exchanges have also been performed between MBFVs and dISFs [40, 41]. In a previous study, we generated a chimeric virus by replacing the SLA of ZIKV with the corresponding region of LPKV [41]. When the reciprocal swap was performed using ZIKV and Donggang virus (a dISF), no chimeric virus was produced, although transfection of cells with the chimeric infectious plasmid clone resulted in viral RNA replication [40].
In the current study, we extended these analyses by replacing the SLA of ZIKV with those of viruses from the TBFV, cISF, bat-associated NKV (bNKV), and rodent-associated rNKV (rNKV) groups to further assess the binding promiscuity of the orthoflavivirus NS5 polymerase. By systematically testing SLA swaps across orthoflaviviruses with distinct transmission cycles, we provide unique insight into the limits of SLA-NS5 compatibility and the extent of polymerase binding promiscuity. Additionally, this study advances our understanding of the molecular determinants that modulate orthoflavivirus host range, cross-species transmission, and evolutionary potential.

Materials and methods

Cell lines and virus

Aedes albopictus (C6/36) and African green monkey kidney (Vero) cells were obtained from the American Type Culture Collection (Manassas, VA). C6/36 cells were grown in Liebovitz L15 medium (Thermo Fisher Scientific, Carlsbad, CA), and Vero cells were propagated in Dulbecco’s modified Eagle medium (Thermo Fisher Scientific). Both medium types were supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 units of penicillin per ml, and 100 μg of streptomycin per ml. For experiments requiring limited cell proliferation, the FBS concentration was reduced to 2%. C6/36 cells were cultured at 28 °C under ambient atmospheric conditions, while Vero cells were cultured at 37 °C in a humidified 5% CO2 environment. ZIKV (strain PRVABC59) was acquired from the World Reference Center for Emerging Viruses and Arboviruses, located at the University of Texas Medical Branch in Galveston, Texas, USA.

SLA secondary structure predictions

The genome sequences of CxFV (strain CxFV-Mex07), MODV (strain M544), RBV (strain M64), TBEV (strain Neudoerfl), and ZIKV (strain PRVABC59) were obtained from the GenBank database under the accession numbers EU879060.1, AJ242984.1, JQ582840.1, U27495.1, and KX377337.1, respectively. The 5’ UTR sequences of these viruses (Supplementary Table S1) were analyzed using RNAfold to identify the genomic positions and predict the RNA secondary structures of their SLAs. RNAfold predictions were generated using the following settings: (i) minimum free energy and partition function, (ii) G-U pairs at the end of helices, and (iii) avoid isolated base pairs (available at http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi; accessed on 5 January, 2025) [42]. The resulting data files were downloaded in Vienna format and subsequently visualized and annotated using VARNA version 3–93 (http://varna.lri.fr/).

Molecular docking analysis

Two computational approaches, HDOCK and AlphaFold3, were used to generate protein-RNA docking models. HDOCK (http://hdock.phys.hust.edu.cn/; accessed on 10 February 2025) is an in silico tool designed to simulate protein-protein and protein/nucleic acid interactions and predict optimal docking conformations [4345]. The key output parameters are docking scores, confidence scores, and root mean square deviation (RMSD) values, which collectively assess the reliability of the binding pose predictions. For each protein-RNA complex, 100 docking poses were generated, with the pose exhibiting the lowest docking score considered optimal. Docking scores are measured in units of energy (kcal/mol), where a more negative score represents stronger predicted binding affinity. Typically, scores below −300 kcal/mol indicate favorable binding conformations. The confidence score is a numerical value that provides an indication of the likelihood of ligand binding. A confidence score >0.7 is considered high and suggests that the two molecules are very likely to bind. A score between 0.5 and 0.7 is of moderate confidence and suggests that an interaction is possible. A score <0.5 is considered low and indicates that binding is unlikely. RMSD measures conformational deviation by calculating the average atomic distance between aligned residue-nucleotide pairs. Values <2.5, between 2.5 and 5.0, and >5.0 Å indicate excellent, good, and poor predictions, respectively.
AlphaFold3 (https://alphafoldserver.com; accessed on 18 February, 2025) is a computational tool designed to predict tertiary structures of proteins, nucleic acids, and other biomolecules, as well as their interactions [46]. Output data include several confidence metrics: predicted template modeling (pTM), interface predicted template modeling (ipTM), and predicted local distance difference test (PLDDT) scores. pTM scores range from 0 to 1, with values >0.5 suggesting that the predicted overall fold for the complex may resemble the true structure. ipTM scores, also on a scale of 0 to 1, evaluate the confidence in interface interactions, where scores >0.8 indicate a high-quality prediction, scores <0.6 indicate a likely failed prediction, and scores between 0.6 and 0.8 fall into a gray area, where predictions may or may not be reliable. PLDDT scores are per-atom confidence estimates ranging from 0 to 100. Scores ≥90 indicate an extremely high confidence, scores ≥70 but <90 indicate confidence, scores ≥50 but <70 indicate low confidence, and scores <50 indicate very low confidence in the predicted structure.

SLA dsDNAs

Four dsDNAs, designated as CxFV(SLA), MODV(SLA), RBV(SLA), and TBEV(SLA), were synthesized by Integrated DNA Technologies (Coralville, Iowa, USA). Each dsDNA encodes the 5’-proximal portion of the 5’ UTR of CxFV, MODV, RBV, or TBEV, spanning from nucleotide 1 to the final nucleotide of the SLA element, as defined by the RNAfold structural predictions. These SLA segments were engineered with flanking sequences: at the 5’ end, they are preceded by the terminal 37 bp of a modified Orgyia pseudotsugata multicapsid nucleopolyhedrosis virus immediate-early 2 promoter (OpIE2-CA), and at the 3’ end, by the last 37 nt of the ZIKV 5’ UTR (genomic positions 71–197), which represents all of the 5’ UTR sequence downstream of the SLA.

Plasmids

Chimeric virus assembly was based on three previously described plasmids, pUC19-F1, pUC19-F2, and pUC19-F3, which together encode the full-length ZIKV genome as overlapping fragments [47]. The pUC19-F1 plasmid includes the OpIE2-CA promoter upstream of the portion of the ZIKV genome sequence spanning nucleotides 1 to 3460. The OpIE2-CA promoter has been used successfully in prior studies to produce recombinant and chimeric orthoflaviviruses in C6/36 cells [41, 4750]. The pUC19-F2 plasmid encodes the portion of the ZIKV genome sequence spanning nucleotides 3413 to 8071. The final plasmid, pUC19-F3, encodes the portion of the ZIKV genome sequence spanning nucleotides 8016 to 10,807, followed by a hepatitis delta virus (HDV) anti-genomic ribozyme sequence and a simian virus 40 (SV40) polyadenylation signal [51, 52].

Chimera production

Four viral chimeras were generated by replacing the SLA region of the ZIKV genome with the corresponding region of the CxFV, MODV, RBV, and TBEV genome, respectively. The construction strategy for the chimera containing TBEV SLA is detailed here, with similar strategies applied for the remaining constructs (Fig. 1). First, pUC19-F1 was modified to replace the native ZIKV SLA with the SLA element of TBEV. To this end, PCR was performed using pUC19-F1 as template, a forward primer (ZIKV-5UTR-1F) targeting nucleotides 71–100 of the ZIKV 5’ UTR, and a reverse primer (OpIE2-1R) specific for the 3’ end of OpIE2-CA. This amplification yielded a fragment lacking the SLA region while preserving the remainder of the pUC19-F1 sequence. This amplicon was then assembled with the synthetic TBEV(SLA) fragment using Gibson assembly, facilitated by the 37-bp overlapping sequences at their termini. The resulting plasmid, designated pUC19-F1-TBEV(SLA), was introduced by transformation into chemically competent E. coli cells. Colonies was screened by Sanger sequencing, and clones containing viral sequences without mutations were identified. The sequences of the primers used for chimera construction are shown in Table 1.
Fig. 1
A schematic depiction of the strategy used to generate the full-length chimeric infectious cDNAs of ZIKV and TBEV. (A) PCR was performed using pUC19-F1 as a template, a forward primer (ZIKV-5UTR-1F) specific for nucleotide positions 71 to 100 of the ZIKV 5’ UTR, and a reverse primer (OpIE2-1R) specific for the 3’ end of OpIE2-CA. The resulting amplicon lacked the ZIKV SLA but contained the remainder of the pUC19-F1 sequence. (B) Gibson assembly was performed using the aforementioned amplicon and a synthetic dsDNA containing the TBEV SLA sequence flanked at the 5’ end by the final 37 bp of the OpIE2-CA and at the 3’ end by the final 37 nt of the ZIKV 5’ UTR, with the resulting plasmid designated as pUC19-F1-TBEV(SLA). (C) Three PCR procedures were performed, yielding three overlapping amplicons that encompass the entire chimeric orthoflavivirus genome. The first PCR was performed using pUC19-F1-TBE(SLA) as a template and primers designated as Chimera-1F and −1R, generating an amplicon containing an OpIE2-CA sequence, followed by the first one-third of the ZIKV genome, in which its SLA had been replaced by the TBEV SLA. The second PCR was performed using pUC19-F2 as a template and primers designated as Chimera-2F and −2R, generating an amplicon containing the middle one-third of the ZIKV genome. The final PCR was performed using pUC19-F3 as a template and primers designated as Chimera-3F and −3R, generating an amplicon containing the final one-third of the ZIKV genome, followed by a hepatitis delta virus anti-genomic ribozyme and an SV40 polyadenylation signal. (D) The three aforementioned overlapping amplicons were joined by Gibson assembly, creating a chimeric orthoflavivirus genome flanked at the 5’ end by OpIE2-CA and at the 3’ end by the hepatitis delta virus anti-genomic ribozyme and the SV40 polyadenylation signal
Bild vergrößern
Table 1
Primers used for the construction of viral chimeras
Primer namea
Primer sequence (5’−3’)
Target
ZIKV genomic position
ZIKV-5UTR-1F
GGTTTTATTTTGGATTTGGAAACG
ZIKV 5’ UTR
71–94
OpIE2-1R
GTTTACCAGATCGTTGCGGGCTG
OpIE2-CA
N/A
Chimera-1F
GGATCATGATGATAAACAATGTATGG
OpIE2-CA
N/A
Chimera-1R
CGGAACGACAGTGGGG
ZIKV NS1
3444-3459
Chimera-2F
GGAGTGCACAATGCCC
ZIKV NS1
3430-3445
Chimera-2R
AAGACGGACTATGTTCCACC
ZIKV NS5
8025-8044
Chimera-3F
CAAAGCTATGGGTGGAACATAG
ZIKV NS5
8015-8036
Chimera-3R
AACTTGTTTATTGCAGCTTATAATGG
SV40 polyadenylation signal
N/A
aPrimer names ending in F and R denote forward and reverse primers, respectively
N/A not applicable, OpIE2-CA Orgyia pseudotsugata multicapsid nucleopolyhedrosis virus immediate-early 2 promoter, SV40 simian virus 40, UTR untranslated region, ZIKV Zika virus
Following sequence confirmation, pUC19-F1-TBEV(SLA), along with pUC19-F2 and pUC19-F3, were used as templates in separate PCR reactions designed to amplify all of the viral sequences and none of the pUC19 vector backbone. For pUC19-F1-TBEV(SLA), the amplicon was generated using Chimera-1F and Chimera-1R as primers (Table 1). For pUC19-F2, Chimera-2F and −2R were used. For pUC19-F3, Chimera-3F and Chimera-3R were used. The three resulting amplicons contained 30-bp overlaps and collectively encompassed the entire genome of the chimeric orthoflavivirus. The fragments were joined by Gibson assembly, and this construct was used to transfect C6/36 cells. The same approach was used to generate the other three chimeras, the only variation being the use of different synthetic dsDNAs in the initial Gibson assembly reactions.

Gibson assembly, transfection, and virus recovery

DNA fragments were joined using Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA), and the resulting assembled DNAs were introduced into C6/36 cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific). The cells were incubated in six-well plates (9.6-cm2) for 7 days, and 50 µl of the culture supernatant was then used to inoculate fresh monolayers of C6/36 cells in 25-cm2 flasks. At 5 days post-inoculation (p.i.), a second passage was performed by transferring 50 µl of supernatant to new C6/36 cell cultures in 25-cm2 flasks. Two additional passages were performed as described above, except that, after 1 hour of virus adsorption, the inoculum was removed, the cells were washed five times in phosphate-buffered saline (PBS, pH 7.2), and fresh medium was added. Each Gibson assembly and transfection experiment was conducted twice independently, with three replicates per experiment.

Reverse transcription polymerase chain reaction

Total RNA was extracted from cell monolayers and supernatants using TRIzol Reagent (Thermo Fisher Scientific) and a QIAamp Viral RNA Mini Kit (QIAGEN, Valencia, CA), respectively. Reverse transcription and PCR were performed using Superscript III reverse transcriptase (Thermo Fisher Scientific) and high-fidelity Taq polymerase (Thermo Fisher Scientific), respectively. Primers specific for ZIKV, CxFV, MODV, RBV, and TBEV were designed using published genome sequences. PCR products were resolved by electrophoresis in 1% agarose gels. Selected amplicons were purified using QIAquick spin columns (QIAGEN) and sequenced using a 3730x1 DNA sequencer (Applied Biosystems, Foster City, CA).

Western blots

Protein lysates were prepared from cell monolayers inoculated with wild-type or chimeric virus and analyzed by Western blot using an anti-ZIKV prM polyclonal antibody (GeneTex Inc., Irvine, CA) or anti-β-actin polyclonal antibody (GeneTex Inc.) as described previously [41].

Growth curves

Subconfluent monolayers of C6/36 and Vero cells in 150-cm2 flasks were inoculated with ZIKV or chimeric virus at a multiplicity of infection of 0.0001. After 1 hour, the virus inoculum was removed and the cell monolayers were washed three times with PBS. Cell culture supernatants were collected daily for 7 days and stored at −80°C in aliquots until titrated by plaque assay using Vero cells as described previously [47]. Six replicates of each virus/dilution/time point were tested. Data were used to calculate mean viral titers ± standard deviation.

Viral plaque morphology

Viral plaque morphology was assessed using Vero cells as described previously [41]. Plaque diameters were measured using ImageJ software (version 1.54i; https://imagej.net/ij/), with 30 plaques measured for each virus to determine plaque size.

Results

SLA secondary structure predictions

Secondary structure predictions of the SLA elements of CxFV, MODV, RBV, TBEV, and ZIKV are shown in Fig. 2. The SLA of TBEV is considerably longer than those of the other viruses, comprising 101 nt and spanning genomic positions 4 to 104. In contrast, the SLAs of the other viruses range from 53 to 73 nt in length. The SLAs of the four vertebrate-infecting orthoflaviviruses exhibit a characteristic predicted Y-shaped structure, consisting of a TL, bulge, SSL, and BS. In contrast, the CxFV SLA lacks an apparent SSL. In each SLA, the BS is composed of two smaller stems separated by a U bulge (the four vertebrate-infecting viruses) or U-U mismatch (CxFV). The greatest sequence and structural variability occurs in the SSL. In ZIKV, MODV, and RBV, the SSLs are 10 to 19 nt in length, with three to seven base pairs and no mismatches in the stem. In TBEV, the SLA is two- to four-fold longer, consisting of 42 nt, with 16 base pairs and five mismatched or unpaired nucleotides within the stem. As already noted, the CxFV SLA lacks a predicted SSL.
Fig. 2
Predicted RNA secondary structures for the SLA elements of selected orthoflaviviruses. Structural predictions were generated using RNAfold for (A) Zika virus, (B) tick-borne encephalitis virus, (C) Culex flavivirus, (D) Modoc virus, and (E) Rio Bravo virus sequences. Structural features are color-coded as follows: top stem-loop, green; side stem-loop, blue; bottom stem, pink; bulge, gray; unpaired nucleotides at the base of the structure, red
Bild vergrößern

SLA and NS5 sequence alignments

Nucleotide sequence alignments were performed using the SLA regions of CxFV, MODV, RBV, TBEV, and ZIKV (Supplementary Table S2). The ZIKV SLA has the highest nucleotide sequence similarity to the TBEV SLA (56.7% identity) and the lowest to the MODV SLA (40.0% identity). Alignments were also performed using the deduced NS5 amino acid sequences of the aforementioned viruses (Supplementary Table S3). ZIKV NS5 has the highest amino acid sequence similarity to the TBEV NS5 (56.6% identity) and the lowest to CxFV NS5 (44.5% identity).

Chimera production and virus recovery

The SLA region of the ZIKV genome was replaced with the corresponding sequences from CxFV, MODV, RBV, and TBEV, using Gibson assembly. The assembled constructs were introduced by transfection into C6/36 cells, followed by multiple passages in the same cell line. RT-PCR analysis of the final-passage cultures revealed the presence of chimeric ZIKV/TBEV sequences, which were subsequently confirmed by Sanger sequencing. In contrast, no chimeric viral sequences were detected for the constructs containing the SLAs of CxFV, MODV, or RBV (data not shown). These findings suggest that a chimeric virus, designated as ZIKV-TBEV(SLA), was produced following the replacement of the ZIKV SLA with that of TBEV, whereas the other SLA substitutions failed to produce infectious virus.
Multiple cell culture passages were performed to confirm that the positive RT-PCR result was due to active viral replication rather than residual input DNA from the initial Gibson assembly products. To verify the successful construction of all four viral chimeras, supernatants from the initial transfection cultures were tested by RT-PCR and Sanger sequencing. Chimeric orthoflavivirus sequences were recovered from all transfection cultures, confirming that each genetic exchange was successful (data not shown). No mutations were observed in the 5’ UTR regions of any of the chimeric constructs. The genome of ZIKV-TBEV(SLA) was fully sequenced, revealing that there were no mutations in the 5’ and 3’ UTRs and no nonsynonymous mutations in the coding region.

In vitro growth characteristics of ZIKV-TBEV(SLA)

Western blots performed using an anti-ZIKV prM polyclonal antibody confirmed the production of ZIKV-TBEV(SLA) in C6/36 cells and demonstrated that Vero cells support its replication (Fig. 3). The presence of viral antigen in ZIKV-TBEV(SLA)-inoculated Vero cells was not due to the detection of input virus in the absence of active virus production, because the virus had undergone several sequential passages in Vero cells prior to these experiments. A cytopathic effect was observed in Vero cells inoculated with ZIKV-TBEV(SLA), providing further evidence of active viral replication in this cell line (data not shown). The positive and negative controls yielded the expected results, with viral antigen detected in C6/36 and Vero cells inoculated with wild-type virus, while no viral antigen was detected in any of the uninfected cell cultures (Fig. 3). β-actin was used as an internal loading control and was detected in each of the samples.
Fig. 3
Western blot analysis showing that ZIKV/TBEV(SLA) replicates in vertebrate and mosquito cells. Subconfluent monolayers of Vero cells (lanes 1–3) and C6/36 cells (lanes 4–6) were inoculated with wild-type ZIKV (lanes 1 and 4) or ZIKV/TBEV(SLA) (lanes 2 and 5) or mock-inoculated (lanes 3 and 6). Cell lysates were harvested at 3 days post-inoculation for Vero cells and at 5 days post-inoculation for C6/36 cells. Equal amounts of protein were resolved on 8–16% Tris-glycine gels and analyzed by Western blot using (A) a polyclonal antibody against ZIKV prM and (B) a polyclonal antibody against β-actin to ensure equal loading across lanes. Arrows indicate the expected migration positions of ZIKV prM (19 kDa) and β-actin (42 kDa)
Bild vergrößern
The replication kinetics of ZIKV-TBEV(SLA) were compared to those of wild-type ZIKV in C6/36 and Vero cells. In both cell types, the chimeric virus showed delayed replication and achieved lower peak titers compared to ZIKV (Fig. 4). In C6/36 cells, the titers of ZIKV-TBEV(SLA) and ZIKV were below the limit of detection of our plaque assays on day 1 and on days 1–2 p.i., respectively. From days 3–5 p.i., ZIKV reached titers that were approximately tenfold higher than those of the chimeric virus. The titers of ZIKV-TBEV(SLA) peaked at 5.97 (± 0.13) log10 pfu/ml at 6 days p.i., whereas ZIKV titers continued to increase, reaching 6.47 (± 0.08) log10 pfu/ml at 7 days p.i. The replication kinetics of ZIKV and ZIKV-TBEV(SLA) in C6/36 cells were analyzed by repeated-measure analysis of variance (ANOVA). The analysis demonstrated significant effects of day (F (6,30) = 131.0, p < 0.0001), virus type (F (1,5) = 93.1, p = 0.0002), and their interaction (F(6,30) = 88.5, p < 0.0001), revealing that the temporal replication patterns differed significantly between the two viruses. In Vero cells, ZIKV-TBEV(SLA) was undetectable during the first two days postinfection. At all subsequent time points, ZIKV titers were approximately 100- to 1000-fold higher than those of ZIKV-TBEV(SLA). The titers of both viruses increased at each time point, reaching 4.57 (± 0.11) log10 pfu/ml for ZIKV-TBEV(SLA) and 6.13 (± 0.12) log10 pfu/ml for ZIKV at day 7 p.i. Repeated-measures ANOVA demonstrated significant effects of day (F(6,30) = 63.4, p < 0.0001), virus type (F(1,5) = 248.4, p = 0.000019), and their interaction (F(6,30) = 62.5, p < 0.0001), again revealing that the temporal replication patterns differed significantly between the two viruses.
Fig. 4
Comparison of the in vitro replication kinetics of ZIKV/TBEV(SLA) and ZIKV. Subconfluent monolayers of (A) C6/36 and (B) Vero cells were inoculated with chimeric or wild-type virus at a multiplicity of infection of 0.0001. Supernatants were collected daily for 7 days and tested by plaque assay
Bild vergrößern
ZIKV produced plaques on Vero cells that were almost fivefold larger than those produced by ZIKV-TBEV(SLA) (Fig. 5). At 6 days p.i., ZIKV plaques had a mean diameter ± 1 standard deviation of 2.23 ± 0.66 mm, while those produced by ZIKV-TBEV(SLA) had a mean diameter of 0.53 ± 0.18 mm. These differences are considered significant, as determined by Welch’s t-test (p-value < 0.0001).
Fig. 5
Comparison of the plaque morphology of ZIKV and ZIKV/TBEV(SLA). Confluent monolayers of Vero cells in 35-mm2 culture dishes were inoculated with (A) ZIKV or (B) ZIKV/TBEV(SLA) and then incubated for 6 days and fixed. Two independent replicate experiments were performed, and 30 plaques were measured for each virus
Bild vergrößern

In silico molecular docking analysis

Two docking programs were used to model interactions between ZIKV NS5 and the SLAs of the selected orthoflaviviruses, but neither program yielded high-confidence data. Using HDOCK, the top binding pose for each NS5-SLA complex had a RMSD value >60 Å (Supplementary Table S4). Since RMSD values >5.0 indicate poor predictive quality, none of the binding models were considered reliable. High RMSD values can occur when small ligands and large protein are modeled [53]. Therefore, to improve the modeling context, additional simulations were performed using longer RNA sequences, but RMSD values remained high (>95 Å). AlphaFold3 also produced low-confidence models (Supplementary Table S5). Most ipTM scores were <0.6, indicating likely failed predictions, and average PLDDT scores were also low (34.7–47.1.7.1), indicating poor reliability.

Discussion

RNA secondary structure predictions indicated that the SLAs of MODV, RBV, TBEV, and ZIKV are likely to adopt a Y-shaped configuration composed of four distinct elements: a TL, bulge, SSL, and BS. In contrast, the SLA of CxFV is not predicted to form this Y-shaped structure due to the apparent absence of an SSL. These structural predictions are consistent with those reported previously for the SLAs of the aforementioned viruses [19, 41, 5460]. A Y-shaped SLA is common among MBFVs, TBFVs, and NKV orthoflaviviruses, particularly those that cause disease [56]. While some dISFs, such as LPKV, also exhibit Y-shaped SLAs, this topology is not common among cISFs [41, 56]. It has been suggested that non-pathogenic orthoflaviviruses are more likely to emerge as pathogens if their SLAs exhibit a Y-shaped topology [56].
Replacement of the SLA of ZIKV with the corresponding region of TBEV generated a chimeric virus capable of replicating in both mosquito and vertebrate cells. These findings suggest that the structural conformation adopted by the TBEV SLA is sufficient to permit recognition and binding by ZIKV NS5, thereby activating the promoter. The binding interface between ZIKV NS5 and its native SLA has been characterized previously [19, 54]. ZIKV NS5 initially binds to the TSS and SL of the SLA via its thumb subdomain, and then to the 5’ terminus and BS of the SLA via its MTase domain [19, 54]. This docking mechanism has been reported for other MBFVs [19, 61, 62]. If this docking mechanism is also utilized by TBFVs, ZIKV NS5 must be able to recognize the TSS, SL, 5’ terminus, and BS of the TBEV SLA. These results underscore the importance of SLA secondary structures in NS5-mediated promoter activation, even in heterologous systems.
ZIKV/TBEV(SLA) is capable of replicating in both vertebrate and mosquito cells, but its replication efficiency is reduced in both cell types compared to wild-type ZIKV, suggesting that the interaction between NS5 and the heterologous SLA is suboptimal. Secondary structure predictions revealed that the SSL of TBEV SLA is considerably longer than the ZIKV SLA. Prior research with DENV2 has shown that removing the SSL completely abolishes viral replication [37]. While increasing the length of the SSL had no impact on DENV2 replication, shortening it was associated with delayed replication. Likewise, large deletions within the SSL of TBEV SLA have been reported to delay replication [58]. Additional work with DENV2 has demonstrated that mutations in the apical loop of the TS can also delay virus replication [22, 37]. Notably, the apical loops of the TSs of the ZIKV and TBEV SLAs differ in both length and sequence, which may partly explain the different replication kinetics of ZIKV-TBEV(SLA) and wild-type ZIKV.
A likely explanation for why the SLA swap between ZIKV and CxFV did not produce virus is that ZIKV NS5 is unable to recognize SLAs that lack the characteristic Y-shaped conformation. This is the first study to insert an orthoflavivirus SLA lacking the predicted Y-shaped topology into the genetic background of another orthoflavivirus. It is also the first study to perform an SLA swap using a cISF, although SLA swaps have been performed with dISFs [40, 41]. For example, insertion of the SLA of LPKV in the genetic background of ZIKV produced a chimeric virus capable of replicating in both mosquito and vertebrate cells [41]. In contrast, replacing the SLA of Donggang virus with that of ZIKV did not result in virus production [40]. Unlike CxFV, the SLAs of Donggang virus and LPKV have predicted Y-shaped topologies [41, 56].
The inability to generate chimeric viruses containing the SLAs of MODV or RBV is more difficult to explain because the predicted secondary structures of these SLAs closely resemble that of ZIKV. One explanation for the lack of virus production is that critical virus-host interactions required for viral replication could not occur. Multiple host proteins bind to the 5’ and 3’ UTRs of orthoflavivirus genomes [30, 5158]. Many of these proteins bind to the 3’ stem loop in the 3’ UTR, but some (i.e. the La protein and 2’−5’-oligoadenylate synthetase) bind to SLA [58]. It is plausible that mosquito SLA-binding proteins do not recognize the SLAs of MODV and RBV because these two viruses are adapted to vertebrate-only replication. Successful chimeric virus production may have been possible if the promoter was derived from a vertebrate virus and the transfections were performed using vertebrate cells. Alternatively, the chimeric genomes may have contained lethal mutations introduced during PCR amplification. None of the chimeric 5’ UTR sequences contained nucleotide errors, but the constructs were not fully sequenced, and therefore, the presence of downstream deleterious mutations cannot be ruled out.
To better understand why only the chimera containing the TBEV SLA produced infectious virus, we modeled the interactions between ZIKV NS5 and the SLAs of selected orthoflaviviruses using two docking programs, but neither yielded reliable data. Both programs produce static models that represent interactions as single snapshots in time [43, 63, 64]. Static modeling fails to account for the dynamic nature of molecular interactions. Dynamic modeling is generally considered more biologically relevant because it accounts for the conformational changes that occur in molecules over time [65, 66]. Dynamic modeling was not performed in this study because it requires an enormous amount of computational power and is relatively expensive.
The deduced amino acid sequences of the NS5 proteins of TBEV and ZIKV share 56.6% identity. The NS5 proteins of CxFV, MODV, and RBV exhibit lower amino acid sequence identity to ZIKV NS5, ranging from 44.5% to 53.7%. This greater sequence divergence could contribute to the observed functional differences, where ZIKV NS5 can activate the promoter of TBEV but fails to activate the promoters of CxFV, MODV, and RBV. A higher degree of sequence similarity may be critical for cross-species promoter recognition and activation. Further, the SLAs of TBEV and ZIKV share 56.7% nucleotide sequence identity, whereas those of CxFV, MODV, and RBV show less similarity to ZIKV SLA, ranging from 40.0 to 54.8% sequence identity. These differences may contribute to the selective activation of the TBEV promoter by ZIKV NS5.
In summary, chimeric orthoflavivirus genomes were created by inserting the SLA sequences of CxFV, MODV, RBV, and TBEV into the genetic background of ZIKV. Replacement of the SLA sequence of ZIKV with that of TBEV resulted in the production of a chimeric virus, providing the first evidence of the functional interchangeability of SLA across mosquito- and tick-borne flaviviruses, while the genetic exchanges involving the single-host orthoflaviviruses failed to produce a virus. Previous studies have also demonstrated that chimeric viruses can be produced when the SLAs of ZIKV and WNV are replaced with those of LPKV and DENV2, respectively [38, 41]. However, exchanging SLA of Donggang virus with that of ZIKV failed to produce virus [40]. Collectively, these findings suggest that the orthoflavivirus polymerase exhibits considerable flexibility in recognizing heterologous SLA elements, but chimeric virus production is less likely when promoters are exchanged between dual- and single-host orthoflaviviruses. Our study is important because it reveals critical constraints on SLA-polymerase compatibility that limit the host range and evolution of orthoflaviviruses.

Declarations

Institutional biosafety approval

All experimental protocols were reviewed and approved by the Institutional Biosafety Committee of Iowa State University (protocol no. IBC-24-035).

Conflict of interest

The authors declare that there are no conflicts of interest.
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Download
Titel
Exchanging the stem-loop A promoter of Zika virus with the corresponding region of tick-borne encephalitis virus generates a chimeric virus that replicates in vertebrate and mosquito cells
Verfasst von
Chandra S. Tangudu
Wichan Dankaona
Bradley J. Blitvich
Publikationsdatum
01.12.2025
Verlag
Springer Vienna
Erschienen in
Archives of Virology / Ausgabe 12/2025
Print ISSN: 0304-8608
Elektronische ISSN: 1432-8798
DOI
https://doi.org/10.1007/s00705-025-06435-x

Supplementary Information

1.
Zurück zum Zitat Postler TS, Beer M, Blitvich BJ, Bukh J, de Lamballerie X, Drexler JF et al (2023) Renaming of the genus Flavivirus to Orthoflavivirus and extension of binomial species names within the family Flaviviridae. Arch Virol 168(9):224PubMedCrossRef
2.
Zurück zum Zitat Holbrook MR (2017) Historical perspectives on Flavivirus research. Viruses 9(5):97PubMedPubMedCentralCrossRef
3.
Zurück zum Zitat Musso D, Ko AI, Baud D (2019) Zika virus infection - after the pandemic. N Engl J Med 381(15):1444–1457PubMedCrossRef
4.
Zurück zum Zitat Johnson N, Migne CV, Gonzalez G (2023) Tick-borne encephalitis. Curr Opin Infect Dis 36(3):198–202PubMedCrossRef
5.
Zurück zum Zitat Blitvich BJ, Firth AE (2015) Insect-specific flaviviruses: a systematic review of their discovery, host range, mode of transmission, superinfection exclusion potential and genomic organization. Viruses 7(4):1927–1959PubMedPubMedCentralCrossRef
6.
Zurück zum Zitat Blitvich BJ, Firth AE (2017) A review of Flaviviruses that have no known arthropod vector. Viruses 9(6):154PubMedPubMedCentralCrossRef
7.
Zurück zum Zitat Bolling BG, Weaver SC, Tesh RB, Vasilakis N (2015) Insect-specific virus discovery: significance for the arbovirus community. Viruses 7(9):4911–4928PubMedPubMedCentralCrossRef
8.
Zurück zum Zitat Hoshino K, Isawa H, Tsuda Y, Yano K, Sasaki T, Yuda M et al (2007) Genetic characterization of a new insect flavivirus isolated from Culex pipiens mosquito in Japan. Virology 359(2):405–414PubMedCrossRef
9.
Zurück zum Zitat Guzman H, Contreras-Gutierrez MA, Travassos da Rosa APA, Nunes MRT, Cardoso JF, Popov VL et al (2018) Characterization of three new insect-specific Flaviviruses: their relationship to the mosquito-borne Flavivirus pathogens. Am J Trop Med Hyg 98(2):410–9PubMedCrossRef
10.
Zurück zum Zitat Burns KF, Farinacci CJ (1956) Virus of bats antigenically related to St. Louis encephalitis. Science 123(3189):227PubMedCrossRef
11.
Zurück zum Zitat Johnson HN (1967) Ecological implications of antigenically related mammalian viruses for which arthropod vectors are unknown and avian associated soft tick viruses. Jpn J Med Sci Biol 20(Suppl):160–166PubMed
12.
Zurück zum Zitat Barrows NJ, Campos RK, Liao KC, Prasanth KR, Soto-Acosta R, Yeh SC et al (2018) Biochemistry and molecular biology of Flaviviruses. Chem Rev 118(8):4448–4482PubMedPubMedCentralCrossRef
13.
Zurück zum Zitat Lindenbach BDRG, Bartenschlager R, Rice CM (2020) Flaviviridae: the viruses and their replication. In: Howley PMKDM, Whelan SPJ, (eds) Fields virology. 7th ed: Lippincott Williams & Wilkins, Philadelphia, PA. pp 246-301
14.
Zurück zum Zitat Brinton MA, Basu M (2015) Functions of the 3’ and 5’ genome RNA regions of members of the genus Flavivirus. Virus Res 206:108–119PubMedCrossRef
15.
Zurück zum Zitat van den Elsen K, Quek JP, Luo D (2021) Molecular Insights into the Flavivirus replication complex. Viruses 13(6):956PubMedPubMedCentralCrossRef
16.
Zurück zum Zitat Ng WC, Soto-Acosta R, Bradrick SS, Garcia-Blanco MA, Ooi EE (2017) The 5’ and 3’ untranslated regions of the Flaviviral genome. Viruses 9(6):137PubMedPubMedCentralCrossRef
17.
Zurück zum Zitat Choi KH (2021) The role of the stem-loop A RNA promoter in Flavivirus replication. Viruses 13(6):1107PubMedPubMedCentralCrossRef
18.
Zurück zum Zitat Bujalowski PJ, Bujalowski W, Choi KH (2017) Interactions between the dengue virus polymerase NS5 and stem-loop A. J Virol 91(11):10–1128PubMedPubMedCentralCrossRef
19.
Zurück zum Zitat Lee E, Bujalowski PJ, Teramoto T, Gottipati K, Scott SD, Padmanabhan R et al (2021) Structures of flavivirus RNA promoters suggest two binding modes with NS5 polymerase. Nat Commun 12(1):2530PubMedPubMedCentralCrossRef
20.
Zurück zum Zitat Davidson AD (2009) New insights into Flavivirus nonstructural protein 5. Adv Virus Res 74:41–101PubMedCrossRef
21.
Zurück zum Zitat Villordo SM, Gamarnik AV (2009) Genome cyclization as strategy for flavivirus RNA replication. Virus Res 139(2):230–239PubMedCrossRef
22.
Zurück zum Zitat Filomatori CV, Lodeiro MF, Alvarez DE, Samsa MM, Pietrasanta L, Gamarnik AV (2006) A 5’ RNA element promotes dengue virus RNA synthesis on a circular genome. Genes Dev 20(16):2238–2249PubMedPubMedCentralCrossRef
23.
Zurück zum Zitat Brinton MA, Dispoto JH (1988) Sequence and secondary structure analysis of the 5’-terminal region of flavivirus genome RNA. Virology 162(2):290–299PubMedCrossRef
24.
Zurück zum Zitat Ramos-Lorente S, Romero-Lopez C, Berzal-Herranz A (2021) Information encoded by the Flavivirus genomes beyond the nucleotide sequence. Int J Mol Sci 22(7):3738PubMedPubMedCentralCrossRef
25.
Zurück zum Zitat Samanta B (2021) Structural evolution of SLA promoter in mosquito-borne flaviviruses: a sequence-structure based phylogenetic framework. Virology 562:110–120PubMedCrossRef
26.
Zurück zum Zitat Sun YT, Varani G (2022) Structure of the dengue virus RNA promoter. RNA 28(9):1210–1223PubMedPubMedCentralCrossRef
27.
Zurück zum Zitat Yang J, Jing X, Yi W, Li XD, Yao C, Zhang B et al (2021) Crystal structure of a tick-borne flavivirus RNA-dependent RNA polymerase suggests a host adaptation hotspot in RNA viruses. Nucleic Acids Res 49(3):1567–1580PubMedPubMedCentralCrossRef
28.
Zurück zum Zitat Jia H, Zhong Y, Peng C, Gong P (2022) Crystal structures of Flavivirus NS5 guanylyltransferase reveal a GMP-arginine adduct. J Virol 96(14):e0041822PubMedCrossRef
29.
Zurück zum Zitat Lu G, Gong P (2013) Crystal Structure of the full-length Japanese encephalitis virus NS5 reveals a conserved methyltransferase-polymerase interface. PLoS Pathog 9(8):e1003549PubMedPubMedCentralCrossRef
30.
Zurück zum Zitat Upadhyay AK, Cyr M, Longenecker K, Tripathi R, Sun C, Kempf DJ (2017) Crystal structure of full-length Zika virus NS5 protein reveals a conformation similar to Japanese encephalitis virus NS5. Acta Crystallogr F Struct Biol Commun 73(Pt 3):116–122PubMedPubMedCentralCrossRef
31.
Zurück zum Zitat Assenberg R, Ren J, Verma A, Walter TS, Alderton D, Hurrelbrink RJ et al (2007) Crystal structure of the Murray Valley encephalitis virus NS5 methyltransferase domain in complex with cap analogues. J Gen Virol 88(Pt 8):2228–2236PubMedCrossRef
32.
Zurück zum Zitat Duan W, Song H, Wang H, Chai Y, Su C, Qi J et al (2017) The crystal structure of Zika virus NS5 reveals conserved drug targets. EMBO J 36(7):919–933PubMedPubMedCentralCrossRef
33.
Zurück zum Zitat Godoy AS, Lima GM, Oliveira KI, Torres NU, Maluf FV, Guido RV et al (2017) Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase. Nat Commun 8:14764PubMedPubMedCentralCrossRef
34.
Zurück zum Zitat Lim SP, Koh JH, Seh CC, Liew CW, Davidson AD, Chua LS et al (2013) A crystal structure of the dengue virus non-structural protein 5 (NS5) polymerase delineates interdomain amino acid residues that enhance its thermostability and de novo initiation activities. J Biol Chem 288(43):31105–31114PubMedPubMedCentralCrossRef
35.
Zurück zum Zitat Malet H, Egloff MP, Selisko B, Butcher RE, Wright PJ, Roberts M et al (2007) Crystal structure of the RNA polymerase domain of the West Nile virus non-structural protein 5. J Biol Chem 282(14):10678–10689PubMedCrossRef
36.
Zurück zum Zitat Zhao Y, Soh TS, Zheng J, Chan KW, Phoo WW, Lee CC et al (2015) A crystal structure of the dengue virus NS5 protein reveals a novel inter-domain interface essential for protein flexibility and virus replication. PLoS Pathog 11(3):e1004682PubMedPubMedCentralCrossRef
37.
Zurück zum Zitat Lodeiro MF, Filomatori CV, Gamarnik AV (2009) Structural and functional studies of the promoter element for dengue virus RNA replication. J Virol 83(2):993–1008PubMedCrossRef
38.
Zurück zum Zitat Yu L, Nomaguchi M, Padmanabhan R, Markoff L (2008) Specific requirements for elements of the 5’ and 3’ terminal regions in flavivirus RNA synthesis and viral replication. Virology 374(1):170–185PubMedCrossRef
39.
Zurück zum Zitat Brillet K, Janczuk-Richter M, Poon A, Laukart-Bradley J, Ennifar E, Lebars I (2024) Characterization of SLA RNA promoter from dengue virus and its interaction with the viral non-structural NS5 protein. Biochimie 222:87–100PubMedCrossRef
40.
Zurück zum Zitat Zhang Y, Liang D, Yuan F, Yan Y, Wang Z, Liu P et al (2022) Replication is the key barrier during the dual-host adaptation of mosquito-borne flaviviruses. Proc Natl Acad Sci U S A 119(12):e2110491119PubMedPubMedCentralCrossRef
41.
Zurück zum Zitat Tangudu CS, Hargett AM, Blitvich BJ (2022) Evidence that untranslated genomic sequences are key determinants of insect-specific flavivirus host restriction. Virology 574:102–114PubMedCrossRef
42.
Zurück zum Zitat Gruber AR, Lorenz R, Bernhart SH, Neubock R, Hofacker IL (2008) The vienna RNA websuite. Nucleic Acids Res 36(Web Server issue):W70-4PubMedPubMedCentralCrossRef
43.
Zurück zum Zitat Li H, Huang E, Zhang Y, Huang SY, Xiao Y (2022) HDOCK update for modeling protein-RNA/DNA complex structures. Protein Sci 31(11):e4441PubMedPubMedCentralCrossRef
44.
Zurück zum Zitat Yan Y, Tao H, He J, Huang SY (2020) The HDOCK server for integrated protein-protein docking. Nat Protoc 15(5):1829–1852PubMedCrossRef
45.
Zurück zum Zitat Yan Y, Zhang D, Zhou P, Li B, Huang SY (2017) HDOCK: a web server for protein-protein and protein-DNA/RNA docking based on a hybrid strategy. Nucleic Acids Res 45(W1):W365–W373PubMedPubMedCentralCrossRef
46.
Zurück zum Zitat Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A et al (2024) Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630(8016):493–500PubMedPubMedCentralCrossRef
47.
Zurück zum Zitat Tangudu CS, Charles J, Nunez-Avellaneda D, Hargett AM, Brault AC, Blitvich BJ (2021) Chimeric Zika viruses containing structural protein genes of insect-specific flaviviruses cannot replicate in vertebrate cells due to entry and post-translational restrictions. Virology 559:30–39PubMedCrossRef
48.
Zurück zum Zitat Piyasena TBH, Setoh YX, Hobson-Peters J, Newton ND, Bielefeldt-Ohmann H, McLean BJ et al (2017) Infectious DNAs derived from insect-specific flavivirus genomes enable identification of pre- and post-entry host restrictions in vertebrate cells. Sci Rep 7(1):2940PubMedPubMedCentralCrossRef
49.
Zurück zum Zitat Hobson-Peters J, Harrison JJ, Watterson D, Hazlewood JE, Vet LJ, Newton ND et al (2019) A recombinant platform for flavivirus vaccines and diagnostics using chimeras of a new insect-specific virus. Sci Transl Med 11(522):eaax7888PubMedCrossRef
50.
Zurück zum Zitat Dong HL, He MJ, Wang QY, Cui JZ, Chen ZL, Xiong XH et al (2023) Rapid generation of recombinant Flaviviruses using circular polymerase extension reaction. Vaccines (Basel) 11(7):1250PubMedCrossRef
51.
Zurück zum Zitat Varnavski AN, Young PR, Khromykh AA (2000) Stable high-level expression of heterologous genes in vitro and in vivo by noncytopathic DNA-based Kunjin virus replicon vectors. J Virol 74(9):4394–4403PubMedPubMedCentralCrossRef
52.
Zurück zum Zitat Aubry F, Nougairede A, de Fabritus L, Querat G, Gould EA, de Lamballerie X (2014) Single-stranded positive-sense RNA viruses generated in days using infectious subgenomic amplicons. J Gen Virol 95(Pt 11):2462–2467PubMedPubMedCentralCrossRef
53.
Zurück zum Zitat Carugo O, Pongor S (2001) A normalized root-mean-square distance for comparing protein three-dimensional structures. Protein Sci 10(7):1470–1473PubMedPubMedCentralCrossRef
54.
Zurück zum Zitat Bujalowski PJ, Bujalowski W, Choi KH (2020) Identification of the viral RNA promoter stem loop A (SLA)-binding site on Zika virus polymerase NS5. Sci Rep 10(1):13306PubMedPubMedCentralCrossRef
55.
Zurück zum Zitat Li XD, Deng CL, Yuan ZM, Ye HQ, Zhang B (2020) Different degrees of 5’-to-3’ DAR interactions modulate Zika virus genome cyclization and host-specific replication. J Virol 94(5):10–1128PubMedPubMedCentralCrossRef
56.
Zurück zum Zitat Mishra B, Aduri R (2022) The RNA secondary structure analysis reveals potential for emergence of pathogenic Flaviviruses. Food Environ Virol 14(1):10–29PubMedCrossRef
57.
Zurück zum Zitat Leyssen P, Charlier N, Lemey P, Billoir F, Vandamme AM, De Clercq E et al (2002) Complete genome sequence, taxonomic assignment, and comparative analysis of the untranslated regions of the Modoc virus, a flavivirus with no known vector. Virology 293(1):125–140PubMedCrossRef
58.
Zurück zum Zitat Upstone L, Colley R, Harris M, Goonawardane N (2023) Functional characterization of 5’ untranslated region (UTR) secondary RNA structures in the replication of tick-borne encephalitis virus in mammalian cells. PLoS Negl Trop Dis 17(1):e0011098PubMedPubMedCentralCrossRef
59.
Zurück zum Zitat Villordo SM, Carballeda JM, Filomatori CV, Gamarnik AV (2016) RNA structure duplications and Flavivirus host adaptation. Trends Microbiol 24(4):270–283PubMedPubMedCentralCrossRef
60.
Zurück zum Zitat Tipo J, Gottipati K, Choi KH (2024) High-resolution RNA tertiary structures in Zika virus stem-loop A for the development of inhibitory small molecules. RNA 30(6):609–623PubMedPubMedCentral
61.
Zurück zum Zitat Filomatori CV, Iglesias NG, Villordo SM, Alvarez DE, Gamarnik AV (2011) RNA sequences and structures required for the recruitment and activity of the dengue virus polymerase. J Biol Chem 286(9):6929–6939PubMedCrossRef
62.
Zurück zum Zitat Hodge K, Tunghirun C, Kamkaew M, Limjindaporn T, Yenchitsomanus PT, Chimnaronk S (2016) Identification of a conserved RNA-dependent RNA polymerase (RdRp)-RNA interface required for Flaviviral replication. J Biol Chem 291(33):17437–17449PubMedPubMedCentralCrossRef
63.
Zurück zum Zitat Malhotra Y, John J, Yadav D, Sharma D, Vanshika, Rawal K et al (2025) Advancements in protein structure prediction: a comparative overview of AlphaFold and its derivatives. Comput Biol Med 188:109842PubMedCrossRef
64.
Zurück zum Zitat Szczepski K, Jaremko L (2025) AlphaFold and what is next: bridging functional, systems and structural biology. Expert Rev Proteomics 22(2):45–58PubMedCrossRef
65.
Zurück zum Zitat Terentiev AA, Moldogazieva NT, Shaitan KV (2009) Dynamic proteomics in modeling of the living cell. Protein-protein interactions. Biochemistry (Mosc) 74(13):1586–1607PubMedCrossRef
66.
Zurück zum Zitat Prevost C, Sacquin-Mora S (2021) Moving pictures: reassessing docking experiments with a dynamic view of protein interfaces. Proteins 89(10):1315–1323PubMedCrossRef

Kompaktes Leitlinien-Wissen Innere Medizin (Link öffnet in neuem Fenster)

Mit medbee Pocketcards schnell und sicher entscheiden.
Leitlinien-Wissen kostenlos und immer griffbereit auf ihrem Desktop, Handy oder Tablet.

Neu im Fachgebiet Innere Medizin

ICI-induzierte Dermatitis: Upadacitinib als vielversprechende Therapieoption

Immunvermittelte Hautreaktionen gehören zu den häufigsten Nebenwirkungen von Immun‑Checkpoint‑Inhibitoren. Eine offene Phase‑2‑Studie untersuchte den JAK‑1‑Inhibitor Upadacitinib bei schwerer ICI‑assoziierter Dermatitis. Die Hautsymptome gingen rasch zurück, schwerwiegende therapieassoziierte Nebenwirkungen wurden nicht beobachtet.

Extrapulmonale Befunde beim Lungenkrebs-Screening – Krebsverdacht gerechtfertigt?

Der Umgang mit Zufallsentdeckungen ist ein vieldiskutiertes Thema im Zusammenhang mit dem Low-Dose-CT-Screening auf Lungenkrebs. Eine Studie hat sich nun speziell mit inzidentellen Befunden befasst, die auf ein extrapulmonales Malignom verdächtig sind.

KI-Chatbots bieten 24/7-Sprechstunde für Patienten

Medizinischen Rat von Chatbots auf der Basis sogenannter künstlicher Intelligenz haben laut Umfragen bereits knapp die Hälfte aller Erwachsenen schon einmal eingeholt. Welche Chancen und Risiken birgt das?

Wie sicher sind Kalziumpräparate bei kardiovaskulärer Vorerkrankung?

Eine weitere Studie weckt Zweifel an der kardiovaskulären Sicherheit von Kalziumsupplementen: Bei Menschen, die bereits einen Herzinfarkt oder Schlaganfall hinter sich hatten, kam es vermehrt zu weiteren Ereignissen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Bildnachweise
Die Leitlinien für Ärztinnen und Ärzte, Eine Person kratzt sich am Rücken über der Schulter/© ryanking999 / stock.adobe.com (Symbolbild mit Fotomodell), Mann erhält einen CT-Scan /© Mark Kostich / stock.adobe.com (Symbolbild mit Fotomodell)