Background
Gastric cancer is currently the fourth most common malignancy and the third leading cause of cancer-related deaths worldwide [
1]. The incidence and mortality of gastric cancer are the highest in East Asia (particularly in Korea, Mongolia, Japan, and China), and it has become the second most lethal cancer in China [
2]. The poor prognosis of this cancer resulted from late detection, aggressive characteristics and poor response to available therapies. Although combined chemotherapy pre- and post-operation has increased patient survival rates, the development of drug resistance is still the most significant obstacles to effective chemotherapy [
3]. Cisplatin remains to be a primary chemotherapeutic drug for gastric cancer patients, especially for advanced stage ones. However, resistance often occurs with the mechanisms being not well understood, which results in relapse of cancer and poor survival. The elucidation of molecular mechanisms to cisplatin resistance is important for improving gastric cancer survival.
It is well known that the tumor microenvironment comprises a variety of nonmalignant stromal cells that evolves with and provides support to tumor cells during the tumor progression [
4,
5]. Among them, tumor-associated macrophages (TAMs) are the major components and play a pivotal role in tumor growth, angiogenesis, metastasis and therapy resistance [
6‐
8]. Macrophages are heterogeneous cells that undergo different functional reprogramming in response to various stimulating signals. M1- and M2-polarized macrophages, activated by IFNγ with LPS and IL-4 with IL-13 respectively, are extremes of a broad range of functional states [
9‐
11]. In most solid tumor, TAMs are typically a macrophage subpopulation with M2 phenotype and a positive correlation between TAM density and poor prognosis has been proved in several types of cancer [
7,
12], including gastric cancer [
13,
14]. Increasing evidence has shown that TAM regulates therapeutic responses of cancer cell and immunotherapy targeting TAM maybe an innovative combination therapy designed to cure cancer [
15,
16]. Nevertheless, the detailed interaction between anticancer therapies with TAM remains unclear.
More recent studies have demonstrated that cells can communicate with neighboring or distant cells through the secretion of exosomes. Exosomes are generated from multivesicular bodies (MVBs) and are secreted into the extracellular space through fuse with the plasma membrane. These vesicles range in size from 50 to 100 nm containing proteins, lipids, mRNA, and are enriched with miRNA [
17‐
19]. Several studies have shown that many types of cells can release exosomes and exosomal transmission among tumor microenvironment cells modulates therapeutic resistance of cancer cells [
20‐
22]. MicroRNAs are small, noncoding RNAs that control the expression of multiple target genes at the posttranscriptional level. Interestingly, exosomal miRNAs are more stable and the transfer of miRNA by exosomes contributes to the development of chemoresistance in multiple tumourtypes [
23,
24]. However, the miRNA signatures of TAM-derived exosomes have not been identified and whether these exosomal miRNAs are involved in chemoresistance in gastric cancer remain unknown.
In this study, we first construct the TAM-like M2 polarized macrophages activated by IL-4 with IL-13 and show that macrophage-derived exosomes can be ingested by gastric cancer cells, reducing the chemotherapy sensitivity to cisplatin. MicroRNA expression profiles using miRNA array reveals that miR-21a-5p is the most abundant in M2 macrophage-derived exosomes. Further investigation demonstrates that miR-21 can be directly transferred, through exosomes, from TAM to gastric cancer cells, and regulates the chemotherapy resistance of these cells. Our studies not only reveal a novel communication mechanism between TAM and gastric cancer cell, but also may provide a promising new therapeutic target for gastric cancer patients.
Methods
Cell culture and treatment
The gastric cancer cell line MFC,MGC-803 were purchased from the Chinese Academy of Sciences Cell Bank of Type Culture Collection. Murine bone marrow–derived macrophages (BMDM) were isolated and activated as previously described [
25]. Briefly, bone marrow cells from femur of C57BL/6 male mice were isolated and cultured for 7 days in DMEM:F12 (Gibco, Life technologies, USA) supplemented with 10% FBS (Gibco, USA) and 50 ng/ml M-CSF (R&D Systems, USA). Media was changed every 3 days and contaminating nonadherent cells are eliminated and adherent cells are harvested for further stimulated. The cells were incubated for 48 h with 20 ng/ml IL-4 plus 20 ng/ml IL-13 (PeproTech, USA) to achieve the M2 polarized macrophages. For in vitro differentiation of human monocytes into macrophages, monocytes were isolated by negative selection from PBMCs using magnetic beads (MiltenyiBiotec), then isolated cells were subsequently cultured in in RPMI1640 supplemented with 10% FBS (Gibco) and 100 IU/ml rhM-CSF for 7 days. The polarization of the resulting monocyte-derived macrophages was obtained as above described. The other cells were cultured at 37 °C with 5% CO2 in DMEM containing 10% FBS supplemented with 100 U/mL penicillin and 100 μg/ml streptomycin (Gibco). For the co-culture experiment, Macrophage were grown on the 0.4um pore size transwell insert (Corning) and the GC cells were grown in the bottom well of the transwell chamber.
Flow cytometry
The M2 polarized macrophage were trypsinized and washed twice in 1 × PBS, after resuspended in 100ul 1 × PBS, fluorochrome-conjugated antibodies against F4/80, CD11b, CD206, CD86, CD163, CD68, CD80 or their respective isotype controls were added and stained for 30 min at 4 °C. Following washed twice in 1 × PBS, labeled cells were analyzed by flow cytometry on a FACS Canto II flow cytometer (BD Biosciences) and analyzed with FlowJo software (Tree Star). All antibodies used for FACS are listed in (Additional file
1: Table S1).
Apoptosis assay
Apoptosis was measured using the FITC Annexin V Apoptosis Detection Kit I (BD Pharmagen, USA) following the manufacturer’s protocol. In brief, cells were washed twice with cold PBS and then resuspended in 100 μl of 1X Binding Buffer, then add 5 μl of FITC Annexin V and 5 μlpropidium iodide (PI) for 15 min at room temperature in the dark. After incubation 400 μl of 1X Binding Buffer were added to each tube and analyzed by FACS Canto II flow cytometry (BD Biosciences).
Exosome isolation and analysis
Macrophages were incubated for 48 h in DMEM:F12 medium with 10% exosome-free FBS. This conditioned medium was collected and exosomes were isolated using Exosome Precipitation Solution (System Biosciences, USA). Identification of exosomes was processed according to the protocol described in Exosome Antibody Array (System Biosciences).
For exosome uptake experiments, exosome preparations were labeled with PKH67 Fluorescent Cell Linker Kits (Sigma-Aldrich) according to the manufacturer’s instructions, followed by washing through Exosome Spin Columns (MW3000) (Invitrogen, USA) to remove excess dye. Next, exosomes were incubated with gastric cancer cells and examined under a SP5 confocal microscope (Leica, USA).
Transmission electron microscopy (TEM)
For TEM, 10 μl of exosome suspension were absorbed onto carbon-coated cooper grids (200 mesh) for 1 min. Samples were washed with double-distilled water and negatively stained with 2% uranyl acetate solution for 1 min. After air dry, the samples were visualized at 87000x in a Phillips Tecnai transmission electron microscope at 80 kV.
MicroRNA microarray
Exosome pellets from 10 ml supernatant of M2 polarized macrophages were collected and homogenized in Trizol (Invitrogen). Total RNA was quantified with a NanoDrop 2000c spectrophotometer (Thermo Scientific, USA) and its quality was assessed by capillary electrophoresis on an Agilent 2100 Bioanalyzer (Agilent Technologies, CA). The miRNA microarray analysis was performed by Shanghai Biotechnology Corporation
Transfection of miRNA mimics and negative control
For in vitro transfection of miRNA, Cy3-labeled miR-21 mimics and negative control (GenePharma, China) were transfected using Lipofectamine 3000 (Life Technologies), according to the manufacturer’s instructions. After 24 h of transfection cells were collected and used for further analysis
In vitro detection of miR-21 transfer
To further observe the transfer of miRNA, Exosomes prepared from M2 macrophages transfected with Cy3-labelled miR-21 or without transfection (ctrl) were added to MFC cell cultures. MFC cells were were fixed in 4% PFA, treated with 0.3% Triton X-100, blocked with 3% BSA at 37 °C. After being washed with PBS, Cellular F-actin was visualized by staining with Alexa 488 phalloidin (LifeTechnologies, USA) according to the manufacturer’s guidelines. Cells were mounted with ProLong® Gold antifade Reagent with DAPI (LifeTechnologies, USA). Images were captured using Leica SP5 Laser scanning confocal microscope.
Cell viability and adhesion-dependent colony formation assay
Gastric cancer cells were seeded in 96-well plate at 1500–3000 cells per well and incubated with DDP for 24–72 h, cell viability was detected with the Cell counting Kit-8 (Dojindo Laboratories, Japan). The optical density at 450 nm was measured on a multiwall plate reader (FLX800, Bio-TEK). Transfected gastric cancer cells were plated in 60-mm dishes at a density of 2 × 103 cells per well for adhesion-dependent colony formation assay. DDP was added to the culture medium at a final concentration of 5uM. Culture medium that contained DDP was changed every 3–4 days. Then, 3–4 weeks later, the remaining colonies were fixed with 4% paraformaldehyde and dyed with crystal violet. The colonies were counted according to the defined colony size.
RNA extraction and quantitative real-time PCR
Total RNA was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. The concentration and quality of the total RNA were assessed with Nanodrop Spectrophotometer (Thermo Fisher Scientific, USA). For the mRNA expression analysis, reverse transcription was performed using PrimeScript RT master mix (TaKaRa, Japan). For miRNA expression analysis, total RNA was first reverse transcribed using Mir-X™ miRNA First-Strand Synthesis Kit (TaKaRa, Japan). Quantitative real-time PCR analysis was performed in triplicate on 7900 HT Real-Time PCR System (Applied Biosystems, USA) using SYBR Premix Ex Taq (TaKaRa, Japan) and the expression levels of GAPDH or U6 was used as endogenous control. The 5′primer used for miR-21 is TAGCTTATCAGACTGATGTTGA, the mRQ3′ primer and U6 primers are supplied with the kit. Results were analyzed using the 2
–ΔΔct calculation method. Other primers sequences of mentioned genes are described in (Additional file
2: Table S2).
Western blot
The cells were lysed in equal volumes of ice cold lysis buffer and a protease inhibitor cocktail. Cell lysate were separated by SDS-PAGE and then transferred to a 0.2-μm PVDF membrane (Bio- Rad, USA). After blocking with Odyssey Blocking Buffer (Li-COR Biosciences, USA), the membrane was incubated with primary antibody (1:1000) at 4 °C overnight, followed by incubation with IRDye 800CW or 680 secondary antibodies (1:5000, LI-COR Biosciences, USA). GAPDH was used as endogenous control. The Odyssey Infrared Imaging System was used to visualize targeted protein bands. All antibodies used for western blot are listed in (Additional file
1: Table S1).
In vivo xenograft and treatment experiments
For in vivo studies, 4–6 week old male athymicC57 nude mice were purchased from Shanghai Laboratory Animal Center of China. MFC cells (3× 105 cells in 200ul PBS) pretreated with or without M2-Exos were subcutaneously injected into the nude mice to establish tumors. Another group received subcutaneous injections of the same MFC cells transfected with miR-21 or miR-NC. After 10 days, 10 mg/kg DDP or PBSwas injected intraperitoneally. M2-Exos or miR-21 were injected twice intratumorally before the start of DDP treatment. The mice were examined every 2 days and sacrificed 6–7 days after DDP treatment. The tumor sizes were measured using digital caliper and tumor volume was calculated with the following formula: volume = 0.5 × width2 × length. All animal procedures were carried out with the approval of the Institutional Committee of Shanghai Jiao Tong University School of Medicine for Animal Research.
Statistical analysis
Statistical significance between groups was determined by a two-tailed Student’s t-test and a one-way ANOVA test. Differences were considered to be significant when P < 0.05. All statistical data were displayed as means ± standard deviation (SD) and analyzed for statistical significance with GraphPad Prism 5.0 for Windows (GraphPad Software, USA).
Discussion
Cisplatin-based chemotherapy is now the most commonly used chemotherapeutic criterion in gastric cancer. Unfortunately, advanced GC patients who develop resistance to cisplatin have limited therapeutic options in the clinic at present [
3]. Besides genetic changes of tumor cells themselves causing increased drug efflux or enhanced anti-apoptosis, drug resistance can result from the tumor microenvironment protecting tumor cells against treatment [
28]. In the present study, we showed that exosomes derived from M2 macrophages express higher levels of miR-21 compared to unactivated macrophages, and that the exosomal transfer of miR-21 from M2 macrophages to gastric cancer cells could confer DDP resistance in these cells. The exosome-shuttled miR-21 promoted DDP resistance through the downregulation of PTEN, leading to a more active signaling through the PI3K/AKT pathway. In addition, M2-exos protected gastric cancer cells from chemotherapy induced apoptosis through the regulation of anti-apoptosis protein Bcl-2.
The role of exosomes in cancer as mediators of cell-cell communication within the microenvironment has gained increasing attention. Several studies have described the intriguing roles of exosomes in cancer progression through transfer a variety of proteins, DNA, and RNA [
29]. Importantly, exosomes have been proved to be critically involved in the development of chemoresistance. Sousa et al. have demonstrated that exosomes from drug-resistant cancer cells can transfer the resistant phenotype to drug-sensitive cells, mainly through transferring of drug-efflux pumps and miRNAs [
30]. Qu L et al. have also suggested that lncRNAs embedded in exosomes derived from sunitinib-resistant cells could confer the resistant phenotype to recipient RCC cells [
31].
Apart from tumor cells, exosomes from tumor stromal cells also contribute to the acquisition of a resistant phenotype in cancer cells. Boelens et al. demonstrated that stromal cells orchestrate an intricate crosstalk with breast cancer cells by utilizing exosomes to regulate therapy resistance pathways [
20]. Exosomes from cancer-associated fibroblast have been shown to promote proliferation and drug resistance of pancreatic cancer cells through transfer of chemoresistance-inducing factor snail [
32]. A recent study reported that exosomal miR-21 can confer chemoresistance and an aggressive phenotype in ovarian cancer cells through its transfer from cancer-associated adipocytes and fibroblasts [
24]. Similar to the above researches, here we demonstrated that exosomes from M2 polarized macrophages was sufficient to confer DDP resistance in gastric cancer cells both in vivo and in vitro; suggesting that tumor associated macrophages may support gastric cancer aggressiveness by secreting exosomes besides physical contact in the tumor microenvironment.
In recent years, it has become increasingly clear that miRNAs play an important role in the resistance of gastric cancer cells to chemotherapeutics [
33,
34]. Importantly, exosome-mediated transfer of miRNAs within the tumor microenvironment has also been indicated as a significant mechanism for dissemination of drug resistance [
23]. In this study, using miRNA microarray in M2 macrophage-derived exosomes, we found that miR-21 was the most abundant miRNA among the identified miRNAs. Furthermore, significantly higher miR-21 expression levels were detected in both M2 polarized macrophages and M2-exos than in unactivated macrophages by a qRT-PCR analysis. Next, we incubated gastric cancer cells with purified exosomes from M2 macrophages transfected with Cy3-labelled miR-21, and the transfer of miR-21 was confirmed by the detection of fluorescent signal in the gastric cancer cells using confocal microscopy.
Additionally, we explored the possible mechanism by which miR-21 may promote the DDP resistance in gastric cancer cells. Our data showed that miR-21 overexpression had no effect on ABC transporter genes in gastric cancer cells, one of the main mechanisms for chemoresistance. Previous studies have revealed that miR-21 expression was associated with resistance to a variety of chemotherapeutic agents in both solid and haematologic tumors. miR-21 promotes cell survival and confers resistance to cancer cells by regulating a set of tumor suppressor genes and apoptosis-associated genes [
24,
35,
36]. Among these genes, PTEN/PI3K/AKT signaling pathway, which involved in cancer pathology and chemoresistance, has been shown to be managed by miR-21 in several types of cancer [
37,
38]. Consistent with these findings, we demonstrated here that exosomal transfer of miR-21 led to down-regulation of PTEN and increased activation of AKT, resulting in more survival and less apoptosis in gastric cancer cells when treated with DDP. In addition, one important apoptosis-associated gene Bcl-2 was also elevated along with miR-21 overexpression, though the exact mechanism was not documented in our data. Moreover, the other potential miR-21 target genes may also be responsible for the effects of M2-exos on gastric cancer chemoresistance, which need further in-depth study.
Conclusions
In summary, we demonstrate that M2 polarized macrophages confer DDP resistance in gastric cancer cells through exosomal transfer of functional miR-21. Our findings suggest that TAM derived exosomes are an important mediator for the reciprocity between TAM and gastric cancer cells, Moreover, we provide evidence to show that targeting exosomal miR-21 from TAM maybe a promising adjuvant therapeutic strategy for gastric cancer patients, especially cisplatin-resistant GC patients.
Acknowledgements
We thank our colleagues in the department of laboratory medicine for helpful discussions and valuable assistance.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.