Extensive genetic diversity of Plasmodium vivax dbp-II in Rio de Janeiro Atlantic Forest and Brazilian Amazon Basin: evidence of positive selection

Brazil, a country of continental proportions, has three malaria transmission profiles. The first and most important occurs inside the Brazilian Amazon Basin (BA), where more than 99% of malaria cases were recorded; the second one involves imported malaria cases, which corresponds to infections that are acquired in Brazilian endemic areas different from where the individual lives or the diagnosis has been done, or from other endemic countries. The third type of transmission represents around 0.05% of all malaria cases in Brazil and corresponds to autochthonous malaria in the Atlantic Forest (AF), located primarily along the south-eastern Atlantic Coast [9].

The polymorphisms in pvdbp-II were investigated in samples representing these three malaria profiles observed in Brazil. 227 P. vivax samples diagnosed by thin and thick blood smear and PCR were collected [13]. Two groups of patients were analysed. One group of 177 individuals (95 from BA and 82 from AF) who attended to the Reference Centre for Malaria Diagnosis CPD-Mal/Fiocruz in Rio de Janeiro (S 22° 54′ W 43° 12′) from January 2011 to March 2018; the other group of 50 individuals who sought for diagnosis at the Unit Health of Tucuruí (S 3º 46′ W 49º 40′), a municipality from Pará State, located in the Brazilian Amazon region during 2011. The samples were separated according to the state of infection (Fig. 1) and the year of blood collection (Table 1). The study was approved by the Ethics Research Committee of Instituto Oswaldo Cruz, Fiocruz, Brazil (69256317.3.0000.5248). All volunteers’ patients signed a written informed consent before collection of 4 mL of venous blood. The DNA from 1 mL blood samples was extracted using QIAamp™ DNA Blood Midi Kit (QIAGEN), according to the manufacturer’s instructions.

The PCR reaction to amplify a fragment of 675 bp of the DBP-II-encoding gene (amino acids from 290 to 515) was carried out with the primers 5′ ATGTATGAAGGAACTTACGAAT 3′ (forward) and 5′ ACCTGCCGTCTGAACCTTTT 3′ (reverse), as previously described [8]. The 20 μL of reaction mixture contained 2 μL (100–200 ng) of DNA, 1 μM primers (forward and reverse) and 5 × HOT FIREPol™ Blend Master Mix (Solis Biodyne), as a source of DNA polymerase, 1 mM of dNTP, 12.5 mM of MgCl₂ and enzyme buffer (saline solution), including dyes to increase sample density during the agarose gel electrophoresis. The amplification cycles comprised: 95 ℃ for 12 min, 30 cycles of 95 ℃ for 30 s, 54 ℃ for 45 s and 72 ℃ for 2 min, followed by an extension cycle of 72 ℃ for 10 min. PCR products were purified using the kit Wizard™ SV Gel and PCR Clean-Up System (Promega), following the manufacturer’s procedure. Then, the purified forward and reverse strands were subjected to cycle sequencing with the Big Dye™ Terminator Cycle Sequencing Ready Reaction version 3.1 (Applied Biosystems) using the PCR primers at a concentration of 3.2 μM. The DNA sequencing was performed in ABI Prism DNA Analyzer™ 3730 (Applied Biosystems) with the support of Fiocruz Genomic Platform RPT01A. The sequenced reads were first analysed using NovoSNP software to investigate polymorphisms; the cutoff of electropherogram quality score was 10 to avoid losing some variations. Also, sequences were analysed in BioEdit sequence alignment editor to better-visualized SNP positions, employing ClustalW multiple sequence aligner. The Salvador 1 (Sal-1) strain was used as a reference sequence (PVX_110810, from PlasmoDB: http://​www.​plasmoDB.​org). Sequences displaying singleton mutations and/or overlapped peaks after chromatogram inspection were re-sequenced. A single infection or the predominant variant was considered when only one nucleotide peak (allele), at any polymorphic locus of the sequence, was observed.

Genetic diversity of pvdbp-II sequences was analysed using the DnaSP 6.11 software [10] to estimate within-population diversity based on the number of segregating sites (S) and nucleotide (π) and haplotype (Hd) diversities. Wright’s fixation statistics (F) determined the degree of differentiation between-populations [11]. Evolutionary analyses were conducted with MEGA7 v7.0 software [12]. The neutrality test of evolution was calculated by Z-test using the Nei-Gojobori method [13], in which the rate of the average number of non-synonymous (dN) and synonymous (dS) SNPs define if the selective pressure is positive (dN > dS), negative (dN < dS) or neutral (dN = dS). Variance differences, in both AF and BA sequence datasets, were computed using the bootstrap method (1000 replicates). Evolutionary distances were calculated using the p-distance method [14], and the pvdbp-II SNP-based tree was reconstructed using the Neighbour-joining method [15] and bootstrap analysis (500 replicates) to measure accuracy. Graphs were building using GraphPad Prism software 8.1.2.

Among the 216 Brazilian isolates, only 11 (5%) have sequences identical to Sal-1 type (NRILKNRDEKRSTKNILWQQI): one sample from AF and ten from BA. The allele’s pattern comprised 90 haplotypes, and 59 of them (66%) were detected in one single parasite isolate each. The most polymorphic haplotypes had 15 SNPs and were only detected in AF isolates (4/6%).

DB01 (nine SNPs) and DB02 (three SNPs) were the more frequent haplotypes: DB01 was found exclusively in AF (16/20%) and DB02 exclusively in BA (16/12%) (Fig. 3), (Additional file 3). In AF, 36 haplotypes were found, and in BA 60. Of the haplotypes found in AF samples, 30 were exclusive of this area, and of the haplotypes found in BA, 54 were exclusive of this region.

The levels of haplotype diversity (Hd) were quite similar in AF (0.94) and BA (0.97).

The phylogenetic tree based on pvdbp-II SNPs revealed that parasites of the same geographic region shared similar profiles with few exceptions (Fig. 4). As expected, the AF samples due to its restrict geographic area were more clustering than BA. The AF samples were more distant to the Sal-1 reference strain than the BA samples. A significant degree of genetic differentiation (Fst = 0.36) was verified between AF and BA isolates.