Facile whole mitochondrial genome resequencing from nipple aspirate fluid using MitoChip v2.0
- Open Access
- 01.12.2008
- Research article
Abstract
Background
Methods
Study Subjects
Samples
Mitochondrial genome amplification
Method used at Genesis Genomics Inc
Primer name | Mtgenome location | Primer sequence 5' – 3' |
|---|---|---|
Mt12s long R | 1135 | ccagaacactacgagccacag |
Mt12s long F | 1076 | gtgttatcccagtttgggtcttagcta |
617F | 617 | gtttagacgggctcacatcacc |
6027R | 6027 | cagctcggctcgaataaggag |
5819F | 5819 | tcggagctggtaaaaagaggcctaac |
11783R | 11783 | gatgcgactgtgagtgcgttcgtag |
11268F | 11268 | ccctaggctcactaaacattctac |
731R | 731 | tagagggtgaactcactggaa |
Method used at NIST
PCR Cleanup: MitoChip
CE-based Fluorescent Sequencing
Resequencing: MitoChip protocol
MitoChip Sequence Interpretation
Short Tandem Repeat (STR) Genotyping
Results and Discussion
Quality assurance
Sequencing of whole mtgenome from NAF samples
Patient ID | Age (years) | Family history of breast cancer | Breast findings at examination |
|---|---|---|---|
1059 | 42 | Right breast cyst; Aspiration biopsy | |
1069 | 51 | Normal | |
1070 | 59 | Normal | |
1071 | 61 | Aunt | Nipple discharge; Mastitis |
1086 | 50 | Large cyst | |
1087 | 51 | Aunt | Small solid hypoechoic nodule |
1126 | 44 | Grandmother | Bilateral dense/nodular breast; Cyst in left breast |
1135 | 40 | Cystic breast masses | |
1139 | 39 | Normal | |
1140 | 56 | Cyst | |
1165 | 53 | Two aunts | Normal |
1178 | 35 | Galactocele | |
1179 | 36 | Mother | Normal |
1180* | 56 | Normal | |
1181 | 36 | Mother and grandmother | Benign lump |
1182 | 43 | Normal | |
1184 | 53 | Mother | Right breast mass; FNA negative for malignancy |
1185 | 50 | Fibrocystic lesions; Previous breast biopsy | |
1192 | 48 | Mother and aunt | Normal |
1193 | 41 | Microcalcification |
Number of call differences between all samples | Concordance (%) | Sequence Identity (%) |
|---|---|---|
7 total | 98.592 | 99.999 |
3/7 associated with problematic features: 9179, 9914, and 11719 | 99.190 | 99.999 |
4/7 heteroplasmic | 100.000 | 100.000 |
Cross validation of MCv2
Elevated somatic mtDNA mutations in benign breast disease
Sample | Pathology | Mutation in NAF | Locus |
|---|---|---|---|
1069 | Normal | C516Y | C/R D-loop |
1086 | Large cyst | A4188G | ND1 |
1135 | Cystic masses | T6776C | COI |
1139 | Normal | G1320R | 12S rRNA |