Background
Multiple sclerosis (MS) is a chronic disabling central nervous system (CNS) disease, of which inflammation, demyelination, and neurodegeneration are major pathological features [
1]. Myelin regeneration, i.e., remyelination, by oligodendrocyte progenitor cells (OPCs) [
2] is apparent in early stages of MS [
3]. However, remyelination fails in chronic demyelinated lesions, despite a relative excess of OPCs in the majority of MS lesions [
4]. As chronic demyelination leads to neurological disability in MS [
5], promoting endogenous remyelination is an attractive therapeutic strategy for structural and functional recovery of MS lesions. However, successful development of such a strategy will require a detailed insight into the mechanism(s) of remyelination failure.
Innate immune activity is an important feature of MS, as signified by activation of resident microglia and invasion of macrophages from the circulation through the disrupted blood-brain barrier [
6,
7]. It is estimated that 45% of the macrophages in active MS lesions is derived from microglia [
8]. Effector functions of microglia and infiltrated macrophages depend on their phenotype, of which two major utmost categories of a continuum of phenotypes can be discerned. First, the classically activated phenotype is characterized by secretion of reactive oxygen species and pro-inflammatory cytokines, such as tumor necrosis factor-α (TNFα), interleukin-1β (IL-1β), and IL-12. The classically activated phenotype is induced in vitro by stimulation with interferon-γ (IFNγ) or lipopolysaccharide (LPS). Conversely, the alternatively activated regenerative phenotype involves predominantly anti-inflammatory properties, including expression of arginase-1, the mannose receptor, and growth factors such as insulin-like growth factor-1 (IGF-1) and platelet-derived growth factor (PDGF) [
9]. The alternative phenotype results from stimulation with interleukin-4 (IL-4) or IL-13. Although the classical/alternative activation concept was originally defined for macrophages, microglia are capable of adopting similar phenotypes [
10]. Upon demyelination in the CNS, microglia and macrophages acquire a predominantly classical phenotype, which leads to an increase of phagocytosis as well as expression of pro-inflammatory features, among others, TNFα, IL-1β, and inducible nitric oxide synthase (iNOS, [
11‐
13]). However, at later stages of remyelination, oligodendrocyte differentiation benefits from a switch to the alternative regenerative phenotype, characterized by expression of arginase-1 and the mannose receptor [
11‐
13].
Signals from the micro-environment largely determine the nature of the microglia and macrophage adopted phenotype. Demyelination alters the expression and nature of extracellular matrix (ECM) molecules [
14,
15], such as the glycoprotein fibronectin (Fn). Fn is transiently expressed as a dimer in demyelinated lesions, resulting from plasma leakage across the blood-brain barrier, and synthesis by local cells, including astrocytes [
15‐
17]. However, in MS lesions, plasma (pFn) and cell-derived (cFn) assemble into stable aggregates (aFn), which is likely mediated by ongoing inflammation [
16]. Aggregated Fn impairs oligodendrocyte differentiation and remyelination [
16]. Current evidence suggests that soluble dimeric plasma Fn (pFn), which is transiently expressed in demyelinated lesions [
16‐
18], promotes several pro-inflammatory functions of microglia [
19‐
23]. Given that remyelination likely benefits from a switch between a pro-inflammatory phenotype of microglia and macrophages upon demyelination to a regenerative phenotype at later stages of remyelination [
13], we investigated here how aFn, persistently present in MS lesions, affects microglia and macrophage behavior and phenotypes in vitro. Our data revealed that aFn coatings induce a distinct phenotype of bone marrow-derived macrophages (BMDMs) and microglia compared to pFn, supporting several pro-inflammatory classical features such as an amoeboid morphology and nitric oxide (NO) release, and anti-inflammatory features such as increased arginase-1 expression in macrophages. This increased NO-release of aFn coatings appears to be integrin-independent and is likely due to accumulation of other proteins within the aggregates, including heat shock protein 70 (Hsp70) and thrombospondin-1 (TSP1), which use the aggregates as a scaffold. The ability of aFn to induce and likely sustain distinct classical phenotypic features of macrophages and microglia may further contribute to remyelination failure in MS.
Methods
MS tissue
Brain tissues were obtained from the Netherlands Brain Bank. Studies were performed on nine control white matter (CWM, healthy subjects), eight chronic (active) MS lesions [c(a)MS], and nine chronic inactive MS lesions (ciMS). Characteristics and selection of the tissues are described previously [
24,
25]. For Western blot analysis, mirrored frozen tissues were homogenized and extracted for protein as described [
16,
24].
Cell culture
Microglia
Mixed glial cultures were derived from the cerebrum of newborn Wistar rats (P0-P2) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) containing 10% fetal bovine serum (FBS, Bodinco) and antibiotics (Life Technologies) for 10–12 days as described [
26]. Microglia were shaken off mechanically on an orbital shaker (Innova 4000) for 1 h at 150 rpm and cultured in DMEM containing 10% Fn-free FBS, antibiotics, and rat recombinant macrophage colony-stimulating factor (M-CSF; 10 ng/mL, Peprotech) to ensure maturation of the immature neonatal microglia [
27]. Fn was eliminated from the serum by means of a Gelatin Sepharose 4B column (GE Healthcare). Shake-off microglia were cultured for 4 days at 37 °C on 10-cm dishes (1.5–2.0 × 10
6 cells/dish, Corning). Subsequently, mixed glial culture flasks were shaken overnight at 240 rpm. Floating OPCs were purified by differential adhesion, with the cells adhering to the bottom of the dish being in vast majority microglia. These differential adhesion microglia were cultured in microglia medium for 3 days at 37 °C. Both microglia cultures, obtained from shake-off and differential adhesion, were pooled at the start of the experiments. At this stage, microglia cultures were typically 95% pure, with approximately 4% astrocytes and 1% oligodendrocyte lineage cells as assessed by cell-specific immunocytochemistry (see below) for ionized calcium-binding adaptor molecule-1 (Iba1; Abcam; microglia), aldehyde dehydrogenase 1, member L1 (Aldh1L1; Neuromab; astrocytes), and Olig2 (Millipore; oligodendrocytes), respectively.
Astrocytes
The remaining astrocyte monolayer of the mixed glial culture flasks was trypsinized and passaged once before experimental use. Regular immunocytochemistry for glial fibrillary acidic protein (GFAP; Millipore) was performed to assure sufficient purity of the astrocyte cultures (> 97%).
Macrophages
The hind legs of newborn Wistar rats (P0-P2) were dissected, and the bone marrow cavity of femora and tibiae was flushed with BMDM medium, containing RPMI-1640 medium (Life Technologies), 10% Fn-free FBS, 1% sodium pyruvate (Life Technologies), and antibiotics. To differentiate myeloid progenitor cells towards macrophages, resuspended BMDMs were incubated for 7–8 days in a medium containing M-CSF (10 ng/mL; Peprotech) on 10-cm dishes (2.0 × 10
6 cells/dish) [
28,
29]. Typical BMDM cultures contained > 95% macrophages, as assessed by immunocytochemistry (see below) for isolectin-B4 (IB4; Invitrogen).
Stimulation
Microglia or BMDMs were gently scraped in appropriate medium without M-CSF and plated for experiments on 24-well plates (Nunc; 50,000/well in 500 μL of appropriate medium for 24 h), 8-well Permanox chamber-slides (Nunc; 30,000/well in 400 μL of appropriate medium for 24 h, except NO assays: 100,000/well in 300 μL of appropriate medium for 24 h), or 6-well plates (Corning; 1.0 106/well in 2 mL for 6 h). Wells were pre-coated with pFn, aFn (see below), or TSP1 (20 μg/mL; R&D systems), and after 1 h at 37 °C, cells in uncoated wells were stimulated with either rat recombinant IFNγ (5 U/μL; Peprotech), rat recombinant IL-4 (10 μg/mL; Peprotech), rat recombinant Hsp70/Hsp72 (10 ng/mL; Enzo Life Sciences), or left unstimulated. For the integrin blocking experiments, cells were incubated with anti-integrin β1 (CD29; HA2/5; BD Biosciences), anti-integrin β3 (CD61; F11; BD Biosciences) or anti-integrin β5 (P1F6; Millipore) 30 min (adhesion assay) or 24 h (NO release) prior to the analysis.
Deoxycholate-insoluble fibronectin aggregates
Deoxycholate (DOC)-insoluble aFn was prepared from primary rat astrocytes stimulated with polyinosinic to polycytidylic acid (50 μg/mL, GE Healthcare) for 2 days or brain tissue, as described [
16]. Tissue and ECM deposits were suspended in DOC buffer and incubated on ice for 30 min. Pellets were washed three times in phosphate-buffered saline (PBS) followed by resuspension in PBS using a syringe and 25-gauge needle. Protein concentration was determined by Bradford’s protein assay (BioRad) using bovine serum albumin (BSA) as a standard. Presence of aggregates was confirmed by Western blot. To coat wells, either bovine pFn (Sigma-Aldrich) or astrocyte-derived DOC-insoluble aFn were applied for 3 h at 37 °C, using 5 μg on 8-well Permanox chamber slides wells (Nunc) and 96 well plates, and 50 μg on 6-wells plate wells (Corning). For Western blot analysis, pellets were resuspended in non-reducing sample buffer, while supernatants were first concentrated by TCA precipitation.
Immunocytochemistry
Cells were fixed with 4% paraformaldehyde (PFA) for 20 min. After a 30-min block with 4% BSA in PBS containing 0.1% Triton X-100 (Sigma-Aldrich), cells were incubated for 60 min with Alexa Fluor© 546-conjugated IB4 (Invitrogen; 1:500) or primary antibodies in 4% BSA. Primary antibodies used were against Iba1 (1:500), Aldh1L1 (1:50), Olig2 (1:1000), and GFAP (1:500; Millipore). Cells were washed three times with PBS and incubated for 25 min with appropriate Alexa Fluor©-conjugated secondary antibodies (1:500; Invitrogen). Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1 mg/mL; Sigma), and fluorescence mounting medium (Dako) was added to prevent image fading. Images were analyzed using an Olympus Provis AX70 fluorescent microscope or a Leica TCS SP8 Confocal Laser Scanning Microscope.
BrdU incorporation assay
Cells were allowed to incorporate 5-bromo-2-deoxyuridine (BrdU) (10 μM; Roche) for 24 h. Cells were fixed in PFA for 20 min and additionally fixed in 5% acetic acid in ethanol for 20 min. BrdU was detected using reagents from the BrdU Labelling and Detection Kit I (Roche) according to the manufacturer’s instructions. The numbers of BrdU-positive nuclei were blindly counted relative to the Iba1- or IB4-positive cells (at least 150 cells per condition).
Phagocytosis assay
Cells were cultured for 24 h, after which fluorescein isothiocyanate (FITC)-labeled latex beads (1 μm; Polyscience) were added at a dilution of 10:1 beads to cells. Phagocytosis of the beads was allowed to proceed for 1 h, after which cells were fixed in 4% PFA. Cells were incubated with DAPI (1 μg/mL) and Alexa Fluor 568-conjugated IB4 in 4% BSA for 2 h. In a blinded manner, the numbers of phagocytosed beads per cell were counted for 100 cells per condition, taking also into account their morphology.
Nitric oxide assay
Cells were cultured for 24 h, after which the medium was added to a reagent of 0.01% N-(1-Naphthyl)-ethylenediamine dihydrochloride (Fluka Analytical) and 0.001% sulfanilamide (Sigma-Aldrich) in 2 M HCl. The absorbance was measured at 550 nm and the NO concentration determined using a standard curve of sodium nitrite (Fluka Analytical).
Adhesion assay
Cells were pre-incubated with vehicle or anti-integrin antibodies for 30 min at 37 °C and plated at a density of 100,000 cells per well in 96-well plates pre-coated with pFn or aFn. Cells were left to adhere for 1 h at 37 °C. Adherent cells were fixed with ice-cold methanol for 15 min and stained with a 20 mg/mL crystal violet solution (Sigma-Aldrich) for 10 min. After washing, the retained crystal violet was dissolved in 1% SDS followed by measuring the optical density at 570 nm. One hundred thousand cells in a 1.5-mL reaction vial underwent the same steps as the cells that were plated (100% control).
Arginase assay
Arginase activity was assessed with an arginase assay kit (Abnova) using an adapted protocol based on the manufacturer’s instructions. Briefly, cell pellets were lysed in 100 μL (10 mM Tris-HCl; pH 7.4) supplemented with protease inhibitor without EDTA (Complete; Roche) and 0.1% Triton X-100. After 30 min of gentle agitation at RT, 5 μL MnCl2 was added to half of each sample followed by 10 min incubation at 55 °C. MnCl2 was subsequently added to the control samples. Arginine substrate buffer was added to the MnCl2-primed samples. After incubation for 2 h at 37 °C, substrate buffer was added to the control samples and urea production was measured by reading the optical density at 430 nm.
TLR4 activation assay
Human endothelial kidney (HEK293) cells were co-transfected with TLR4/MD2/CD14-encoding constructs (InvivoGen) using Polyfect (Qiagen). After selection, TLR-encoding cells were transfected with a reporter vector expressing luciferase under the control of an NF-κB-responsive promoter (pNifty2-luc; InvivoGen). Stably transfected clones were selected and used in bioassays. Cells were plated in pre-coated 96-wells plates at a density of 100,000 cells/well and incubated for 16 h at 37 °C. Cells were lysed in Steady Glo luciferase buffer (Promega), and bioluminescence was measured using a Packard 9600 Topcount Microplate Scintillation & Luminescence Counter (Packard Instrument). As a positive control for NF-κB-mediated activation (i.e., for the presence of the pNifty2-luc vector), 25 ng/ml TNFα (Peprotech) was used (data not shown). LPS (InvivoGen; 1 ng/mL) was used as a positive control for TLR4-mediated activation.
Real-time quantitative polymerase chain reaction (real-time qPCR)
Cells were cultured for 6 h, after which total RNA was extracted using the RNeasy Micro Kit (Qiagen) followed by reverse transcription (reagents from Thermo Fisher Scientific) according to the manufacturer’s instructions. Real-time qPCR was performed using the Applied Biosystems 7900HT Real-Time PCR System using specific primers (Table
1). Gene expression levels were analyzed using the 2
−ΔΔct method, with normalization against hydroxylmethylbilane synthase (HMBS).
Table 1
Primer sequences used for real-time, quantitative PCR
TNFα | ATGGGCTGTACCTTATCTACTC | GTATGAAATGGCAAATCGGCT |
IL-1β | GAAGAATCTATACCTGTCCTGTG | TCTTTGGGTATTGTTTGGGA |
IL-12 | CTTTGAAGAACTCTAGGTGG | CTTGAGGGAGAAGTAGGAATGG |
Arginase-1 | ATATCTGCCAAGGACATCGT | ATCACTTTGCCAATTCCCAG |
HMBS | CCGAGCCAAGCACCAGGAT | CTCCTTCCAGGTGCCTCAGA |
GAPDH | CATCAAGAAGGTGGTGAAGC | ACCACCCTGTTGCTGTAG |
Lactate dehydrogenase and MTT assay
Cells were cultured for 24 h, after which the medium (lactate dehydrogenase (LDH) assay, Roche) and cells (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; MTT assay) were analyzed as described [
16].
Proteomics study
DOC-insoluble Fn aggregates were subjected to SDS-PAGE under reducing conditions. Gel lanes were cut in small pieces followed by in gel trypsin digestion. Peptides were extracted and analyzed by liquid chromatography coupled to a high-resolution LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific) using ESI as an ion source. Peptide identification was performed with PEAKS software (release 8.5). Of the positive hits, only proteins that are known or predicted to be secreted according the protein atlas were taken into account.
Western blot analysis
Cells were sonicated or lysed in lysis buffer containing 150 mM sodium chloride, 50 mM Tris-HCl and 5 mM EDTA supplemented with 1% Triton X-100, and protease inhibitor cocktail. Samples were subjected to SDS-PAGE. After transfer of the proteins to PVDF (Immobilon-FL, Millipore) and blocking with 50% Odyssey blocking buffer in PBS the membranes were incubated overnight at 4 °C with primary antibodies against iNOS (1:250; BD Biosciences), arginase-1 (1:500; BD Biosciences) and actin (1:1000; Sigma). Appropriate secondary IRDye-conjugated antibodies were applied for 1 h followed by detection on the Odyssey Infrared Imaging system (Li-Cor Biosciences). Quantification was performed with Scion Image software.
Statistical analysis
Data were analyzed using SPSS and GraphPad Prism and are reported as mean ± standard error of the mean (SEM) of 2–12 experiments. Results of the morphology, Western blot, NO release, arginase activity, real-time qPCR, LDH, and MTT analyses are presented as a relative to the unstimulated cells (ctrl, set to 100% or 1 in each independent experiment). Statistical analysis was performed with a one sample t test when the relative values of the conditions were calculated. When values of two means were compared, statistical significance was calculated by a Student t test, and when more than two means were compared, by one-way analysis of variance (ANOVA), followed by Newman-Keuls Multiple Comparison Test post-test. For categorical variables (morphology), logistic regression was performed to compare proportions between the different conditions. p values lower than 0.05 were considered statistically significant.
Discussion
In this study, we characterized phenotypes of microglia and BMDMs cultured on coatings of structural variants of Fn, an ECM protein that aggregates in MS lesions, thereby inhibiting remyelination [
16]. Our data revealed that several microglia- and macrophage-related pro-inflammatory features were induced to a similar extent by both pFn and aFn, including a predominantly amoeboid morphology of microglia and BMDMs, increased proliferation of microglia, and enhanced phagocytosis by BMDMs. Therefore, aggregation of Fn, which results from strong, non-covalent protein-protein interactions and is defined by DOC-insolubility [
45], may particularly represent a continuous state of pFn signaling, which activates several properties of microglia and macrophages. However, the aFn matrix also expressed an additional effect compared to pFn, in that it caused a stimulation of NO release by microglia and BMDMs, and an enhanced arginase-1 expression and activity by BMDMs. Accordingly, our data indicate that aFn promotes a distinct phenotype of macrophages, and likely also of microglia, displaying features of both the classically and alternatively activated phenotype.
Initially, we hypothesized that this additional effect of aFn may be related to the potential presence of
cellular Fn in aFn, which contains the alternatively spliced EIIIA and EIIIB domains that are absent from plasma-derived pFn [
41]. The EIIIA domain is a ligand for the α9β1 receptor, and activation of this receptor promotes NO production in a human colon adenocarcinoma cell line [
46]. Also, Fn fragments that contain the EIIIA domain stimulate TLR4 [
40], known to promote pro-inflammatory polarization of microglia and macrophages [
47]. Hence, these previous findings suggest a potential underlying mechanism for the aFn-mediated increase in NO levels. However, aFn coatings hardly, if at all activated TLR4, and the effect of aFn coatings on NO release was integrin β1-independent. Rather, as revealed by proteomic analysis, the data indicate that the distinct effect of aFn compared to pFn coatings is mediated by proteins, such as Hsp70 and TSP1, that may exploit aFn as a scaffold. In fact, our findings demonstrate that the expression of TSP1 is increased in chronic (active) MS lesions and tightly associated with aFn. TSP1 harbors an Fn binding site [
44], and its receptors, CD36 and CD47, are functionally expressed on microglia and macrophages and may have opposing effect on macrophage polarization [
48‐
51]. Our findings showed that TSP1 coatings promoted arginase-1, but not iNOS expression by macrophages, which is consistent with its suggested role in limiting pro-inflammatory effects [
48]. On the other hand, the function of TSP1 is highly dependent on its expression levels and on which domain is functional in a given biological setting. At low levels, TSP1 may only interact with CD47 and promote alternative activation in macrophages by inhibiting the production of pro-inflammatory features, including the production of NO, IL-12, and IL-1, while at high levels, TSP1 may also bind to CD36, resulting in the release of IL-1 and IL-6 [
48‐
50], but also of the anti-inflammatory marker IL10 [
51]. Extracellular Hsp70 is suggested to act as an endogenous agonist of TLR2, TLR4, and CD40 [
42,
43] and, with its confirmed presence in the DOC-insoluble MS lesion-derived aFn fraction, may add to the mixed phenotype features, promoted by aFn coatings, while its action via TLR4 is excluded. Indeed, similar to aFn, Hsp70 treatment enhanced both iNOS and arginase-1 expression by BMDMs. Whether other identified aFn-associated proteins, i.e., tenascin C and connective tissue growth factor, both known to bind to Fn [
52,
53], affect microglia and BMDM activation remains to be determined. Hence, by acting as scaffold for several proteins that are ligands for receptors present on microglia and macrophages, pro-inflammatory and/or anti-inflammatory features may be induced by aFn.
Next to using aFn as a scaffold and their interference with glial cell behavior, the identified proteins in the DOC-insoluble Fn aggregates may play a role in aggregation per se. For example, vitronectin inhibits Fn matrix assembly via its heparin-binding domain [
54]. Also of interest in this respect is the aFn-association of Hsp70, Hsp47, and Hsp90β, which are found extracellular and are linked to ECM remodeling. Thus, Hsp70 increases collagen and Fn expression via transforming growth factor-β1 (TGF-β1) signaling [
55], Hsp47 act as a receptor for collagen fibrillogenesis [
56], and extracellular Hsp90β binds directly to Fn and increases the formation a DOC-insoluble Fn matrix [
57]. Of interest, Hsp70 and Hsp90β are associated with MS pathology [
58,
59]. A role of these Hsps in Fn aggregation in MS lesions remains to be determined.
Previous studies showed that soluble pFn may also promote NO synthesis [
21], as well as synthesis of pro-inflammatory cytokines, such as TNFα [
21,
22]. Our seemingly opposing findings, which revealed that pFn coatings, in contrast to soluble pFn [
21], do not promote NO release and that both pFn and aFn coatings do not induce mRNA expression of pro-inflammatory cytokines, can likely be attributed to the different signaling properties of Fn coatings, as opposed to those of soluble Fn. Immobilized Fn coatings, which probably better than soluble Fn mimic the deposited Fn matrix in MS lesions, enforce clustering of integrin receptors, and may also bind to different receptors, i.e., both integrins and others [
60]. Indeed, the upregulation of, among others, TNFα by soluble pFn is mediated via TLR4, whereas the present results demonstrated that coatings of pFn and aFn do not activate TLR4. This may also explain why pFn did not markedly enhance phagocytosis by microglia in our studies, which is considered to be mediated by TLR4 [
22]. Furthermore, we investigated relatively naïve microglia and BMDMs, whereas priming of microglia and BMDMs may enhance their responsiveness to Fn. For instance, LPS-primed microglia respond to soluble pFn by additionally increasing IL-1β production [
23].
Microglia and BMDMs are distinct cell types [
61], and recent evidence indicates that their effector functions in MS may be different [
62‐
64]. To clarify whether both cell types respond similarly to aFn, we directly compared activation profiles from microglia and BMDMs, obtained in parallel from the same pool of neonatal rats. Although microglia and BMDMs respond similarly with respect to morphology, NO release, and cytokine gene expression, several differences were also apparent. First, microglia expressed a more prominent potential of phagocytosis than BMDMs, in line with previous reports [
10,
37]. This likely sustains the notion that phagocytosis by microglia occurs without priming in CNS physiology [
65,
66]. In addition, BMDMs enhanced pro-inflammatory cytokine gene expression more readily upon IFNγ treatment than microglia, whereas microglia responded to IL-4 with a much greater increase of arginase mRNA expression, the latter not being reflected at the protein level. Thus, together with a more pronounced NO release by BMDMs upon IFNγ treatment, and arginase-1 expression and activity upon exposure to IL-4 and on aFn coatings, these findings support the concept that macrophages are immune mediators per se, whereas microglia display more plasticity, with diverse, non-immunological roles in the healthy brain [
61‐
63].
The overall effects of microglia and macrophage activation by aFn on remyelination remain to be determined. Phagocytosis of myelin debris by macrophages is thought to promote remyelination [
67,
68], but phagocytosis of neuronal debris can also enhance myelin and axonal destruction by the adaptive immune system [
69]. Similarly, NO has favorable effects on immune activation in MS, but also mediates oligodendrocyte and myelin injury [
38]. In general, however, the early phase of remyelination benefits from a classically activated microglia and macrophage phenotype, whereas oligodendrocyte differentiation and myelin production are promoted by a switch to the alternatively activated phenotype during later stages [
13]. Hence, transient Fn expression upon demyelination [
15‐
17] likely contributes to the temporal classical phenotype of microglia and macrophages, whereas in MS lesions Fn persists as aggregates, and as a consequence, microglia and macrophages may retain and/or gain some pro-inflammatory features that may interfere with the regenerative alternatively activated phenotype that is required for remyelination [
13]. Indeed, in active MS lesions, a major subset of macrophages display classically and alternatively activated markers, indicating an intermediate activation status [
70]. Hence, in addition to directly inhibiting OPC differentiation, unfavorable microglia and macrophage polarization may represent an indirect mechanism underlying aFn-mediated impairment of remyelination.