Skip to main content
Erschienen in: Virology Journal 1/2020

Open Access 01.12.2020 | Short report

Fifteen new nucleotide substitutions in variants of human papillomavirus 18 in Korea

Korean HPV18 variants and clinical manifestation

verfasst von: Namhee Kim, Jeong Su Park, Ji Eun Kim, Jae Hyeon Park, Hyunwoong Park, Eun Youn Roh, Jong Hyun Yoon, Sue Shin

Erschienen in: Virology Journal | Ausgabe 1/2020

Abstract

High-risk human papillomavirus (HPV) infection is an essential factor for the development of cervical cancer. HPV18 is the second most common carcinogenic HPV type following HPV16, but the lineages of HPV18 have been less well studied than those of HPV 16. The purpose of this study was to analyze the nucleotide variants in the E6, E7, and L1 genes of HPV18, to assess the prevalence of HPV18 variants in Korea and to explore the relationship between HPV18 genetic variants and the risk for cervical cancer.
A total of 170 DNA samples from HPV18-positive cervical specimens were collected from women admitted to a secondary referral hospital located in Seoul. Among them, the lineages of the 97 samples could be successfully determined by historical nomenclature.
All the studied HPV 18 variants were lineage A. Sublineages A1 and A4 comprised 91.7% (89/97) and 1.0% (1/97), respectively. Sublineages other than A1 or A4 comprised 7.2% (7/97). We identified 15 new nucleotide substitutions among 44 nucleotide substitutions: C158T, T317G, T443G, A560G, A5467G, A5560C, A5678C, A6155G, G6462A, T6650G, G6701A, T6809C, A6823G, T6941C and T6953C. Among them, 6 substitutions at positions 317, 443, 5467, 5560, 6462, and 6823 resulted in amino acid changes (E6: F71L and N113K; L1: H13R, H44P, A345T, and N465S, respectively). The pathologic results were classified as normal in 25.8% (25/97) of the women, atypical squamous cells of undermined significance (ASCUS) in 7.2% (7/97), cervical intraepithelial neoplasia (CIN) 1 in 36.1% (35/97), CIN2/3 in 19.6% (18/97), and carcinoma in 12.4% (12/97). There was no significant association between the HPV18 sublineages and the severity of pathologic lesion or the disease progression.
This study is the first to analyze the distribution of HPV18 variants in Korean and to associate the results with pathologic findings. Although the HPV18 variants had no significant effect on the degree and progression of the disease, the newly discovered nonsynonymous mutation in L1 might serve as a database to determine vaccine efficacy in Korean women.
Hinweise

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
AA
Asian-Amerindian
AAHS
Aluminum hydroxyphosphate sulfate
AFR
African
ASCUS
Atypical squamous cells of undermined significance
CIN
Cervical intraepithelial neoplasia
E
European
E
Early gene
HPV
Human papillomavirus
HSIL
High-grade squamous intraepithelial lesion
IARC
International Agency for Research on Cancer
LSIL
Low-grade squamous intraepithelial lesion
L
Late gene
LCR
Long control region
NGS
Next-generation sequencing
SNP
Single-nucleotide polymorphism
VLP
Virus-like protein
WGS
Whole-genome sequencing
WHO
World Health Organization

Introduction

Cervical cancer is the fourth most common cancer among all malignancies in females worldwide and the seventh most common cancer in Korea. According to the World Health Organization’s (WHO’s) GLOBOCAN project in 2018, 569,847 new cases occur and 311,365 people die annually due to cervical cancer worldwide. In Korea, cervical cancer is the seventh most common cancer, with the development of 3348 new cases and 1029 deaths reported annually [1]. Epidemiologic, genetic, immunological and environmental factors are involved in carcinogenesis, and persistent and high-risk human papillomavirus (HPV) infection is an essential factor for the development of cervical cancer. The most deleterious type is HPV16, and the second is HPV18; these two infections are associated with approximately 70% of cervical cancers [2, 3].
HPV is a small double-stranded DNA virus with an 8-kb genome containing early expressed genes (E1, E2, E4, E5, E6, and E7), late genes (L1 and L2) and a long control region (LCR) [4]. The capsid proteins L1 and L2 play critical roles in viral structure formation and the infection process. In particular, purified L1, the major capsid protein, can form empty shells that resemble HPV, which are called virus-like particles (VLPs). These VLPs have hypervariable immunodominant loop structures on the surfaces of the virions that induce humoral immunity without oncogenic activity and are thus extensively used in HPV prophylactic vaccines [58]. E6 and E7 are major oncogenes that are highly expressed in tumors and are related to cellular immortalization, malignant transformation, and carcinogenesis. Based on these roles, proteins E6 and E7 are generally regarded as ideal targets for the development of therapeutic HPV vaccines [6, 9].
Over 200 HPV types have been identified based on L1 sequences. HPV18 variants were originally grouped into European (E), Asian-Amerindian (AA) or African (AFR) lineages according to E6-E7, L1, and/or LCR sequences [1014]. This classification has been superseded by a whole viral genome sequencing approach that has defined three major lineages (A, B, and C) and additional sublineages (A1 to A5 and B1 to B3) [15] that can be translated from the historical nomenclature (A1 and A2 are AA, A3 to A5 are E and B/C are AFR) [16, 17]. In addition, a recent study published in China proposed new A6 to A8 sublineages and classified them as the E lineage [18].
HPV genetic variants have been reported to differ in their viral assembly, pathogenic potential, and host immune response depending on geographic and ethnic features [2, 1720]; however, no data on HPV18 variation among strains from Korean women have been reported thus far. Furthermore, there is some debate regarding the carcinogenic properties of HPV18 lineages [1624].

Methods

From 2010 to 2017, 7992 women admitted to the Seoul National University Boramae Medical Center were tested for cervical HPV genotype more than once. Among them, 3926 (3926/7992 = 49.1%) were positive for HPV, and 170 (170/3926 = 4.3%) were positive for type 18 and negative for other types. HPV detection and typing were performed using a liquid bead microarray, namely, the GeneFinder HPV PCR Kit (Infopia, Seoul, Korea).
Amplification and sequencing of HPV18 E6, E7, and L1 genes were performed using type-specific primers, which are shown in Table 1 [11, 24, 25]. The cycling conditions were as follows: 5 min at 95 °C for initial denaturation; 45 s at 94 °C, 45 s at 55 °C, and 60 s at 72 °C for 35 cycles; and 10 min at 72 °C for final elongation. Amplicons were visualized on 2.0% agarose gels stained with ethidium bromide under UV transillumination. PCR products were automatically sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. E7 sequencing had a high success rate (165/170), so the sequencing was completed with only 1 primer set (=1 trial). However, E6 and L1 sequencing had low success rates, so we attempted 3 trials each (Table 1). All data were confirmed by repeating the PCR amplification and sequence analysis at least twice.
Table 1
Primers used for PCR amplification and sequence analysis
Gene
Primer
Trial
Primer sequence (5′-3′)
Position
Size
Success rate
Ref
E6
E6-a-F
1
AGAAACACACCACAATACTATGGCG
86
661
86/170
[21]
E6-a-R
GTCGGGCTGGTAAATGTTGAT
746
E6-b-F
2
GGGACCGAAAACGGTGTAT
55
611
11/79
[22]
E6-b-R
GAAGGTCAACCGGAATTTCA
665
E6-c-F
3
GGGACCGAAAACGGTGTAT
55
557
0/68
[22]
E6-c-R
ATGTTGCCTTAGGCTCCATGC
611
E7
E7-a-F
1
CGACAGGAACGACTCCAACGA
540
431
165/170
[21]
E7-a-R
ATAAAACCAGCCGTTACAACCCGTG
970
L1
L1–1-a-F
1
GTAACGGTCCCTTTAACCTCCTC
5402
650
153/170
[21]
L1–1-a-R
CATTGTCCCTAACGTCCTCAG
6051
L1–2-a-F
AAGTTCCCATGCCGCCACGTCTAAT
6002
505
162/170
L1–2-a-R
AGAGCCACTTGGAGAGGGAGAATAC
6506
L1–3-a-F
GCTCTATTGTTACCTCTGACTCC
6502
636
32/170
L1–3-a-R
ATTACTTCCTGGCACGTACACGCAC
7137
L1–3-b-F
2
AGTTATGTATTTTGGGCTGTG
6077
756
0/128
[10]
L1–3-b-R
ACACCAAAGTTCCAATCCTCTAA
6832
L1–3-b’-F
AGTATAGCAGACATGTTGAGGAA
6699
551
0/128
L1–3-b’-R
CATACAACATACAACAACAACCAT
7249
L1–3-c-F
3
TCCCTCTCCAAGTGGCTCTA
6488
601
44/128
[22]
L1–3-c-R
AGTGGCAGATGGAGCAGAAC
7088
Abbreviation: Ref reference
Nucleotide sequences were translated by the translate-tool of ExPASy (http://​web.​expasy.​org/​translate/​) for the determination of amino acid changes. PSIPRED v.4.0 (http://​bioinf.​cs.​ucl.​ac.​uk/​psipred/​) was used for secondary structure prediction, as it provides a simple and accurate secondary structure prediction method.
All sequence data were assembled against the HPV18 reference strain, GenBank sequence NC_001357, using Sequencher version 5.2.3 (Gene Codes Corporation, Ann Arbor, MI, USA). Twenty-eight other sequences were downloaded from GenBank, as in the latest Taizhou area study [18]. The accession numbers used in this analysis were as follows. A1 sublineage: EF202143-EF202145, A2 sublineage: EF202146, A3 sublineage: EF202147-EF202149, A4 sublineage: EF202150-EF202151, A5 sublineage: GQ180787, A6 sublineage: KY457833-KY457836, A7 sublineage: KY45737-KY45840, A8 sublineage: KY457826-KY457827; B1 sublineage: EF202153-EF202155, B2 sublineage: KC470224-KC470225, B3 sublineage: EF202152; and C lineage: KC470229-KC470230. Evolutionary analyses were conducted in MEGA X (http://​megasoftware.​net) [22, 23].
Based on cytological and histological evaluations of fresh specimens, the cervical lesions were graded according to their severity as follows: normal, atypical squamous cells of undetermined significance (ASCUS), low-grade squamous intraepithelial lesion (LSIL), high-grade squamous intraepithelial lesion (HSIL), cervical intraepithelial neoplasia grade 1, 2 or 3 (CIN1, 2 or 3) and cervical cancer. The histological diagnosis of each case was reviewed by an experienced pathologist who was unaware of the HPV testing results.
Mann-Whitney, Fisher exact and linear by linear association tests were used for comparisons between AA and E lineages. Variables affecting cervical cancer risk were analyzed by a logistic regression model. All statistical analyses were carried out with SPSS, version 22.0 (IBM, Armonk, NY, USA).

Results

HPV18 variants

Ninety-seven (97/170 = 57.1%) E6, 165 (165/170 = 97.1%) E7, 74 (74/170 = 43.5%) entire L1 and 90 (90/170 = 52.9%) partial L1 sequences from HPV18 isolates were successfully amplified by PCR and sequenced. In total, only 97 samples (E6-E7-L1 sequences) could be classified as lineages and sublineages according to E6-E7 sequence-based historical nomenclature rules of previous studies [9, 10].
The genetic analysis of the regions of the 97 samples is shown in Fig. 1. They were composed of 26 intact and 10 partial E6-E7-L1 sequences (BRM01 ~ 36 variants). In total, we found 44 nucleotide substitutions. Among them, 29 nucleotide substitutions were already reported: T104C, A171G, T173G, C287G, A482C, T485C, C549A, C554T, C751T, C860T, C5478T, A5497G, G5609A, T5619A, C5701G, C5875A, C5920T, A6059G, T6131G, T6146G, A6401G, A6430C, A6441C, C6460G, C6625G, C6842G, A6970G, and G7032A [1114, 17, 18, 24, 2629], and 15 nucleotide substitutions were newly identified: C158T of BRM05, T317G of BRM07, T443G of BRM08, A560G of BRM10, A5467G of BRM12, A5560C of BRM16, A5678C of BRM17, A6155G of BRM21, G6462A of BRM22, T6650G of BRM23, G6701A of BRM24, T6809C of BRM26, A6823G of BRM27, T6941C of BRM28, and T6953C of BRM36. Among the 15 new nucleotide substitutions, 6 nonsynonymous amino acid substitutions were at positions 317, 443, 5467, 5560, 6462, and 6823 (F71L and N113K in E6; H13R, H44P, A345T, and N465S in L1, respectively). In addition, all the 15 newly identified sequences in this study were submitted to GenBank under the accession numbers MK813921-MK813935 (Fig. 1).
The phylogenetic tree analysis was performed using the E6-E7-L1 genes of the 97 Korean HPV18 isolates and 28 already reported variants (Fig. 2). According to the E6-E7 sequence-based previous nomenclature rule [10, 11], all the previous AA lineages (BRM01 ~ 28, total 89 samples) were matched updated A1 sublineage sequences. However, except for one A4 sublineage (BRM32, 1 sample), the other seven variants (BRM29 ~ 31 and 33 ~ 36, total 8 samples) of the previous E lineage did not match the reported sublineages (Figs. 1, 2).

Association between HPV18 variants and cervical lesion severity

All 97 of the women underwent pathological examinations, pap smears (cytological) and/or cervical biopsies (histological) after HPV genotyping within 3 months. The cervical pathologic results were classified as normal in 25 women (25/97 = 25.8%); ASCUS in 7 (7/97 = 7.2%); LSIL/CIN 1 in 35 (35/97 = 36.1%); HSIL/CIN2 and 3 in 18 (18/97 = 18.6%); and carcinoma in 12 (12/97 = 12.4%). There was no statistically significant association between HPV18 lineage and cervical lesion severity (Table 2).
Table 2
Distribution and statistical comparison of HPV18 lineages between the AA and E lineages
 
AA(n = 89)
E(n = 8)
P value
Age, years
 
46 (40–54)
58 (47–63)
0.344*
Cervical lesion, n
Grouping
   
 Normal
22 (24.7%)
3 (37.5%)
0.298
 ASCUS
5 (5.6%)
2 (25.0%)
  LSIL/CIN1
34 (38.2%)
1 (12.5%)
 HSIL/CIN2&3
17 (19.1%)
1 (12.5%)
 Cancer
11 (12.4%)
1 (12.5%)
Pathology and treatment, n
 Cancer
11 (12.4%)
1 (12.5%)
1.000
 Non-cancer
① + ② + ③ + ④
78 (87.6%)
7 (87.5%)
 Surgery
④ + ⑤
28 (31.5%)
2 (25.0%)
1.000
 Observation
① + ② + ③
61 (68.5%)
6 (75.0%)
 Definite dysplasia
③ + ④ + ⑤
62 (69.7%)
3 (37.5%)
0.110
 Normal and ASCUS
① + ②
27 (30.3%)
5 (62.5%)
Evidence of co-infection, n
 With other risk type(s)
21 (23.6%)
2 (25.0%)
1.000
 With other high-risk type(s)
16 (18.0%)
1 (12.5%)
1.000
§Serial follow-up testing (n = 54)
Progression (n)
 
n = 50
n = 4
 
  Progression
 
21 (42.0%)
1 (25.0%)
0.773
  No progression
 
29 (58.0%)
3 (75.0%)
* Mann-Whitney test
Linear by linear association
Fisher’s exact test
§ 54 out of 97 patients underwent serial pathological examinations
Grouping: ① Normal, ② ASCUS, ③ LSIL/CIN1, ④ HSIL/CIN2 and 3, ⑤ Cancer
Abbreviation: AA Asian-Amerindian; E European; ASCUS Atypical squamous cells of undetermined significance; LSIL Low-grade squamous intraepithelial lesion; HSIL High-grade squamous intraepithelial lesion; CIN Cervical intraepithelial neoplasia
Most women underwent HPV genotyping several times; 23 were found to have a different types of HPV infection, aside from type 18, in their lifetime. In particular, 17 women had an infectious history of other high-risk HPVs, including types 16, 31, 33, 35, 39, 45, 51, 52, 58, or 59, as diagnosed according to the International Agency for Research on Cancer (IARC) [30]. There was no association between HPV18 lineages and other types of HPV co-infection (Table 2). Additional infections by other types are not related to the development of cancer (data not shown).
Of the 97 women involved in this study, 54 women underwent an additional follow-up pathological evaluation. Twenty-two women had worsening lesions confirmed by serial pathological tests. There was no association between HPV18 lineages and disease progression (P = .773) (Table 2).

Discussion

From 2010 to 2017, almost half (49.1%) of requested cervical HPV genotyping tests were positive for any type of HPV in a secondary referral hospital in Seoul, Korea. Among the positive results, the frequency of HPV 18 single positive was 4.2%. The frequency of the present study was comparable to other reports in Korea (total HPV prevalence was 16.7% ~ 40.7%, and the HPV 18 prevalence among HPV-positive women was 0.5% ~ 3.6%) [3133].
The distributions of HPV variants differ among geographic origins, evolutionary dynamics, and pathogenicity. In our population, 6 substitutions, namely, C287G in E6 and G5503A, C5701G, C6460G, C6625G, and C6842G in L1, were found in all HPV18 variants. These 6 substitutions were also found in all HPV18 isolates in southeastern and northeastern China [11, 18], which Korea is located next to, but found in 40% of HPV 18 in southwest and central China [24]. These findings support the geographical distribution of HPV lineages.
We previously discovered that the HPV 16 variants were composed of A1 ~ 3, A4, C, and D sublineages (54.1, 37.8, 0.7, and 7.4% of samples, respectively) in Korea [21]. Upon comparing HPV 16, little diversity was evident, indicating that previous lineages AA and E comprised 91.7 and 8.3%, respectively, in Korean HPV 18.
Previous studies reported that the risk of developing high-grade CIN is significantly increased with the non-European variants [13, 34]. One study [35] reported that the AA and European variants had significantly higher associations with pre-invasive lesions than the African variants. In contrast, other studies showed that no significant difference in pre-invasive lesion risk was observed between the variant lineages (A, B, and C) [14, 17, 26]. Our results are in line with the latter conclusion; there was no statistically significant association between HPV18 lineages and cervical pathologic lesions in Korea.
In the aspect of public health, many countries have implemented national policies of HPV vaccination. In Korea, HPV vaccination has been free for 12-year-old girls since 2016, and the government intends to expand the vaccination targets. Three prophylactic vaccines have received licensure from Korea Food and Drug Administration: the AS04-adjuvanted bivalent (HPV16/18) vaccine (Cervarix®, GlaxoSmithKline, Belgium), which was licensed in 2008; the aluminum hydroxyphosphate sulfate (AAHS) adjuvant quadrivalent (HPV6/11/16/18) vaccine (Gardasil®, Merck, US), which was licensed in 2007; and the AAHS adjuvant 9-valent (HPV6/11/16/18/31/33/45/52/58) vaccine (Gardasil®9, Merck, US), which was licensed in 2016. These prophylactic HPV vaccines are composed of L1 proteins of multiple HPV combinations [5, 7]. The loop structures of the HPV L1 major capsid protein contribute to the epitopes of vaccine-induced cross-neutralizing antibodies. Therefore, amino acid changes in the L1 loop region could be a critical issue for vaccination development. Our data on the genetic diversity of the HPV18 variants in Korea show two nonsynonymous substitutions in the loop structures, L64M within the BC loop (of BRM34) and T149N within the DE loop (of BRM20, BRM31 ~ 36). It may be helpful to design second-generation prophylactic HPV vaccines and implement feasible nationwide vaccination programs.
With the development of next-generation sequencing (NGS), the whole-genome sequencing (WGS) of 8 kb HPV became easier, making the analysis of lineages and single-nucleotide polymorphisms (SNPs) relatively faster and more accurate. However, WGS analysis pipelines in microbiological fields have not yet been established systematically, and it is difficult to analyze multiple samples with limited resources. In addition, although WGS identifies more variants and contributes to the construction of more accurate phylogenetic trees than partial sequencing, the data composed of E6-E7-L1 sequences over the past 20 years does not have significantly reduced reliability compared to WGS. Thus far, many studies have been selectively conducted on the oncogenic proteins E6 and E7, and the major capsid protein L1 plays an important role in the prophylactic vaccine, as our study suggests.

Conclusions

In summary, this research identified 15 new nucleotide substitutions and is the first to analyze the distribution of HPV18 variants in Korean women and to match the results to pathologic results. Data regarding the geographic/ethnic HPV18 genetic diversity distributions may be helpful for designing diagnostic probes, correlating epidemiologic cervical cancer risks, and analyzing the efficacy of HPV vaccines for targeted populations in Korea.

Acknowledgments

Not applicable.
This study was approved by the Institutional Review Board of Seoul National University Boramae hospital (30–2018-40).
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
2.
Zurück zum Zitat Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, Winer R, et al. Human papillomavirus type distribution in invasive cervical cancer and high-grade cervical lesions: a meta-analysis update. Int J Cancer. 2007;121(3):621–32.CrossRef Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, Winer R, et al. Human papillomavirus type distribution in invasive cervical cancer and high-grade cervical lesions: a meta-analysis update. Int J Cancer. 2007;121(3):621–32.CrossRef
3.
Zurück zum Zitat Munoz N, Bosch FX, Castellsague X, Diaz M, de Sanjose S, Hammouda D, et al. Against which human papillomavirus types shall we vaccinate and screen? The international perspective. Int J Cancer. 2004;111(2):278–85.CrossRef Munoz N, Bosch FX, Castellsague X, Diaz M, de Sanjose S, Hammouda D, et al. Against which human papillomavirus types shall we vaccinate and screen? The international perspective. Int J Cancer. 2004;111(2):278–85.CrossRef
4.
Zurück zum Zitat Bernard HU. Taxonomy and phylogeny of papillomaviruses: an overview and recent developments. Infect Genet Evol. 2013;18:357–61.CrossRef Bernard HU. Taxonomy and phylogeny of papillomaviruses: an overview and recent developments. Infect Genet Evol. 2013;18:357–61.CrossRef
5.
Zurück zum Zitat Kirnbauer R, Booy F, Cheng N, Lowy DR, Schiller JT. Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc Natl Acad Sci. 1992;89(24):12180–4.CrossRef Kirnbauer R, Booy F, Cheng N, Lowy DR, Schiller JT. Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc Natl Acad Sci. 1992;89(24):12180–4.CrossRef
6.
Zurück zum Zitat Doorbar J, Quint W, Banks L, Bravo IG, Stoler M, Broker TR, et al. The biology and life-cycle of human papillomaviruses. Vaccine. 2012;30(Suppl 5):F55–70.CrossRef Doorbar J, Quint W, Banks L, Bravo IG, Stoler M, Broker TR, et al. The biology and life-cycle of human papillomaviruses. Vaccine. 2012;30(Suppl 5):F55–70.CrossRef
7.
Zurück zum Zitat Bissett SL, Godi A, Beddows S. The DE and FG loops of the HPV major capsid protein contribute to the epitopes of vaccine-induced cross-neutralising antibodies. Sci Rep. 2016;6:39730.CrossRef Bissett SL, Godi A, Beddows S. The DE and FG loops of the HPV major capsid protein contribute to the epitopes of vaccine-induced cross-neutralising antibodies. Sci Rep. 2016;6:39730.CrossRef
8.
Zurück zum Zitat Shen-Gunther J, Cai H, Zhang H, Wang Y. Abundance of HPV L1 Intra-Genotype Variants With Capsid Epitopic Modifications Found Within Low- and High-Grade Pap Smears With Potential Implications for Vaccinology. Front Genet. 2019;10:489.CrossRef Shen-Gunther J, Cai H, Zhang H, Wang Y. Abundance of HPV L1 Intra-Genotype Variants With Capsid Epitopic Modifications Found Within Low- and High-Grade Pap Smears With Potential Implications for Vaccinology. Front Genet. 2019;10:489.CrossRef
9.
Zurück zum Zitat Chabeda A, Yanez RJR, Lamprecht R, Meyers AE, Rybicki EP, Hitzeroth II. Therapeutic vaccines for high-risk HPV-associated diseases. Papillomavirus Res(Amsterdam, Netherlands). 2018;5:46–58.CrossRef Chabeda A, Yanez RJR, Lamprecht R, Meyers AE, Rybicki EP, Hitzeroth II. Therapeutic vaccines for high-risk HPV-associated diseases. Papillomavirus Res(Amsterdam, Netherlands). 2018;5:46–58.CrossRef
10.
Zurück zum Zitat Ong CK, Chan SY, Campo MS, Fujinaga K, Mavromara-Nazos P, Labropoulou V, et al. Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J Virol. 1993;67(11):6424–31.CrossRef Ong CK, Chan SY, Campo MS, Fujinaga K, Mavromara-Nazos P, Labropoulou V, et al. Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J Virol. 1993;67(11):6424–31.CrossRef
11.
Zurück zum Zitat Sun Z, Liu J, Wang G, Zhou W, Liu C, Ruan Q. Variant lineages of human papillomavirus type 18 in Northeast China populations characterized by sequence analysis of E6, E7, and L1 regions. Int J Gynecol Cancer. 2012;22(6):930–6.CrossRef Sun Z, Liu J, Wang G, Zhou W, Liu C, Ruan Q. Variant lineages of human papillomavirus type 18 in Northeast China populations characterized by sequence analysis of E6, E7, and L1 regions. Int J Gynecol Cancer. 2012;22(6):930–6.CrossRef
12.
Zurück zum Zitat Schlecht NF, Burk RD, Palefsky JM, Minkoff H, Xue X, Massad LS, et al. Variants of human papillomaviruses 16 and 18 and their natural history in human immunodeficiency virus-positive women. J Gen Virol. 2005;86(10):2709–20.CrossRef Schlecht NF, Burk RD, Palefsky JM, Minkoff H, Xue X, Massad LS, et al. Variants of human papillomaviruses 16 and 18 and their natural history in human immunodeficiency virus-positive women. J Gen Virol. 2005;86(10):2709–20.CrossRef
13.
Zurück zum Zitat Arroyo SL, Basaras M, Arrese E, Hernáez S, Andía D, Esteban V, et al. Human papillomavirus (HPV) genotype 18 variants in patients with clinical manifestations of HPV related infections in Bilbao, Spain. Virology J. 2012;9:258.CrossRef Arroyo SL, Basaras M, Arrese E, Hernáez S, Andía D, Esteban V, et al. Human papillomavirus (HPV) genotype 18 variants in patients with clinical manifestations of HPV related infections in Bilbao, Spain. Virology J. 2012;9:258.CrossRef
14.
Zurück zum Zitat Chen AA, Gheit T, Franceschi S, Tommasino M, Clifford GM. Human papillomavirus 18 genetic variation and cervical cancer risk worldwide. J Virol. 2015;89(20):10680–7.CrossRef Chen AA, Gheit T, Franceschi S, Tommasino M, Clifford GM. Human papillomavirus 18 genetic variation and cervical cancer risk worldwide. J Virol. 2015;89(20):10680–7.CrossRef
15.
Zurück zum Zitat Chen Z, Schiffman M, Herrero R, DeSalle R, Anastos K, Segondy M, et al. Evolution and taxonomic classification of alphapapillomavirus 7 complete genomes: HPV18, HPV39, HPV45, HPV59, HPV68 and HPV70. PLoS One. 2013;8(8):e72565.CrossRef Chen Z, Schiffman M, Herrero R, DeSalle R, Anastos K, Segondy M, et al. Evolution and taxonomic classification of alphapapillomavirus 7 complete genomes: HPV18, HPV39, HPV45, HPV59, HPV68 and HPV70. PLoS One. 2013;8(8):e72565.CrossRef
16.
Zurück zum Zitat Burk RD, Harari A, Chen Z. Human papillomavirus genome variants. Virology. 2013;445(1–2):232–43.CrossRef Burk RD, Harari A, Chen Z. Human papillomavirus genome variants. Virology. 2013;445(1–2):232–43.CrossRef
17.
Zurück zum Zitat Chen Z, DeSalle R, Schiffman M, Herrero R, Burk RD. Evolutionary dynamics of variant genomes of human papillomavirus types 18, 45, and 97. J Virol. 2009;83(3):1443–55.CrossRef Chen Z, DeSalle R, Schiffman M, Herrero R, Burk RD. Evolutionary dynamics of variant genomes of human papillomavirus types 18, 45, and 97. J Virol. 2009;83(3):1443–55.CrossRef
18.
Zurück zum Zitat Xu HH, Zheng LZ, Lin AF, Dong SS, Chai ZY, Yan WH. Human papillomavirus (HPV) 18 genetic variants and cervical cancer risk in Taizhou area. China Gene. 2018;647:192–7.CrossRef Xu HH, Zheng LZ, Lin AF, Dong SS, Chai ZY, Yan WH. Human papillomavirus (HPV) 18 genetic variants and cervical cancer risk in Taizhou area. China Gene. 2018;647:192–7.CrossRef
19.
Zurück zum Zitat Sait K, Turki R, Abuzenadah AM, Jiffiri OH, Bohmaidah A, Sohrab SS. Genetic diversity and phylogenetic analysis of HPV 16 & 18 variants isolated from cervical specimens of women in Saudi Arabia. Saudi J Biol Sci. 2019;26(2):317–24.CrossRef Sait K, Turki R, Abuzenadah AM, Jiffiri OH, Bohmaidah A, Sohrab SS. Genetic diversity and phylogenetic analysis of HPV 16 & 18 variants isolated from cervical specimens of women in Saudi Arabia. Saudi J Biol Sci. 2019;26(2):317–24.CrossRef
20.
Zurück zum Zitat Frati E, Bianchi S, Amendola A, Colzani D, Petrelli F, Zehender G, et al. Genetic characterization of variants of HPV-16, HPV-18 and HPV-52 circulating in Italy among general and high-risk populations. Mol Med Rep. 2019;21:894.PubMed Frati E, Bianchi S, Amendola A, Colzani D, Petrelli F, Zehender G, et al. Genetic characterization of variants of HPV-16, HPV-18 and HPV-52 circulating in Italy among general and high-risk populations. Mol Med Rep. 2019;21:894.PubMed
21.
Zurück zum Zitat Park JS, Shin S, Kim EC, Kim JE, Kim YB, Oh S, et al. Association of human papillomavirus type 16 and its genetic variants with cervical lesion in Korea. APMIS. 2016;124(11):950–7.CrossRef Park JS, Shin S, Kim EC, Kim JE, Kim YB, Oh S, et al. Association of human papillomavirus type 16 and its genetic variants with cervical lesion in Korea. APMIS. 2016;124(11):950–7.CrossRef
22.
Zurück zum Zitat Hall BG. Building phylogenetic trees from molecular data with MEGA. Mol Biol Evol. 2013;30(5):1229–35.CrossRef Hall BG. Building phylogenetic trees from molecular data with MEGA. Mol Biol Evol. 2013;30(5):1229–35.CrossRef
23.
Zurück zum Zitat Kumar S, Stecher G, Li M, Knyaz C, Tamura K, MEGA X. Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547–9.CrossRef Kumar S, Stecher G, Li M, Knyaz C, Tamura K, MEGA X. Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547–9.CrossRef
24.
Zurück zum Zitat Shen M, Ding X, Li T, Chen G, Zhou X. Sequence variation analysis of HPV-18 isolates in southwest China. PloS one. 2013;8(2):e56614.CrossRef Shen M, Ding X, Li T, Chen G, Zhou X. Sequence variation analysis of HPV-18 isolates in southwest China. PloS one. 2013;8(2):e56614.CrossRef
26.
Zurück zum Zitat Arias-Pulido H, Peyton CL, Torrez-Martinez N, Anderson DN, Wheeler CM. Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions. Virology. 2005;338(1):22–34.CrossRef Arias-Pulido H, Peyton CL, Torrez-Martinez N, Anderson DN, Wheeler CM. Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions. Virology. 2005;338(1):22–34.CrossRef
27.
Zurück zum Zitat Sichero L, Ferreira S, Trottier H, Duarte-Franco E, Ferenczy A, Franco EL, et al. High grade cervical lesions are caused preferentially by non-European variants of HPVs 16 and 18. Int J Cancer. 2007;120(8):1763–8.CrossRef Sichero L, Ferreira S, Trottier H, Duarte-Franco E, Ferenczy A, Franco EL, et al. High grade cervical lesions are caused preferentially by non-European variants of HPVs 16 and 18. Int J Cancer. 2007;120(8):1763–8.CrossRef
28.
Zurück zum Zitat Liu Y, Pan Y, Gao W, Ke Y, Lu Z. Whole-genome analysis of human papillomavirus types 16, 18, and 58 isolated from cervical Precancer and Cancer samples in Chinese women. Sci Rep. 2017;7(1):263.CrossRef Liu Y, Pan Y, Gao W, Ke Y, Lu Z. Whole-genome analysis of human papillomavirus types 16, 18, and 58 isolated from cervical Precancer and Cancer samples in Chinese women. Sci Rep. 2017;7(1):263.CrossRef
29.
Zurück zum Zitat van der Weele P, Meijer CJLM, King AJ. High whole-genome sequence diversity of human papillomavirus type 18 isolates. Viruses. 2018;10(2):68.CrossRef van der Weele P, Meijer CJLM, King AJ. High whole-genome sequence diversity of human papillomavirus type 18 isolates. Viruses. 2018;10(2):68.CrossRef
31.
Zurück zum Zitat So KA, Hong JH, Lee JK. Human papillomavirus prevalence and type distribution among 968 women in South Korea. J Cancer Prev. 2016;21(2):104–9.CrossRef So KA, Hong JH, Lee JK. Human papillomavirus prevalence and type distribution among 968 women in South Korea. J Cancer Prev. 2016;21(2):104–9.CrossRef
32.
Zurück zum Zitat Lee EH, Um TH, Chi H-S, Hong Y-J, Cha YJ. Prevalence and distribution of human papillomavirus infection in Korean women as determined by restriction fragment mass polymorphism assay. J Korean Med Sci. 2012;27(9):1091–7.CrossRef Lee EH, Um TH, Chi H-S, Hong Y-J, Cha YJ. Prevalence and distribution of human papillomavirus infection in Korean women as determined by restriction fragment mass polymorphism assay. J Korean Med Sci. 2012;27(9):1091–7.CrossRef
33.
Zurück zum Zitat Nah EH, Cho S, Kim S, Cho HI. Human papillomavirus genotype distribution among 18,815 women in 13 Korean cities and relationship with cervical cytology findings. Ann Laboratory Med. 2017;37(5):426–33.CrossRef Nah EH, Cho S, Kim S, Cho HI. Human papillomavirus genotype distribution among 18,815 women in 13 Korean cities and relationship with cervical cytology findings. Ann Laboratory Med. 2017;37(5):426–33.CrossRef
34.
Zurück zum Zitat Villa LL, Sichero L, Rahal P, Caballero O, Ferenczy A, Rohan T, et al. Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasia. J General Virol. 2000;81(Pt 12):2959–68.CrossRef Villa LL, Sichero L, Rahal P, Caballero O, Ferenczy A, Rohan T, et al. Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasia. J General Virol. 2000;81(Pt 12):2959–68.CrossRef
35.
Zurück zum Zitat Xi LF, Koutsky LA, Hildesheim A, Galloway DA, Wheeler CM, Winer RL, et al. Risk for high-grade cervical intraepithelial neoplasia associated with variants of human papillomavirus types 16 and 18. Cancer Epidemiol Biomarkers Prev. 2007;16(1):4–10.CrossRef Xi LF, Koutsky LA, Hildesheim A, Galloway DA, Wheeler CM, Winer RL, et al. Risk for high-grade cervical intraepithelial neoplasia associated with variants of human papillomavirus types 16 and 18. Cancer Epidemiol Biomarkers Prev. 2007;16(1):4–10.CrossRef
Metadaten
Titel
Fifteen new nucleotide substitutions in variants of human papillomavirus 18 in Korea
Korean HPV18 variants and clinical manifestation
verfasst von
Namhee Kim
Jeong Su Park
Ji Eun Kim
Jae Hyeon Park
Hyunwoong Park
Eun Youn Roh
Jong Hyun Yoon
Sue Shin
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2020
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-020-01337-7

Weitere Artikel der Ausgabe 1/2020

Virology Journal 1/2020 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.