Skip to main content
main-content

05.05.2021 | Originalien | Ausgabe 3/2021 Open Access

Rechtsmedizin 3/2021

Forensische DNA-Methylierungsanalyse

Zweiter, technischer Ringversuch der Arbeitsgruppe „Molekulare Altersschätzung“ der Deutschen Gesellschaft für Rechtsmedizin

Zeitschrift:
Rechtsmedizin > Ausgabe 3/2021
Autoren:
Jana Naue, Manuel Pfeifer, Christa Augustin, Julia Becker, Jan Fleckhaus, Melanie Grabmüller, Yang Han, Frank Heidorn, Olivia Hollaender, Rachel Klein-Unseld, Galina Kulstein, Julia Lichtenwald, Jacqueline Neubauer, Philippe Suarez, Cordula Haas, Peter M. Schneider, Marielle Vennemann, Petra Böhme, Arbeitsgemeinschaft Molekulare Altersschätzung der Deutschen Gesellschaft für Rechtsmedizin (DGRM)
Wichtige Hinweise
Die Mitglieder der Arbeitsgemeinschaft Molekulare Altersschätzung der Deutschen Gesellschaft für Rechtsmedizin (DGRM) werden am Beitragsende gelistet.

Einleitung

In Deutschland wurde mit der Novellierung des § 81e der Strafprozessordnung (StPO) neben den Bestimmungen der Augen‑, Haar- und Hautfarbe auch die Altersschätzung eines Verursachers einer unbekannten Spur auf Basis molekularer Marker zur forensischen Analytik zugelassen. Auch in der Schweiz ist eine Gesetzesrevision in der Entwicklung. Viele Studien der letzten Jahre zeigten, dass in bestimmten Bereichen des Genoms die DNA-Methylierung (DNAm) mit zunehmendem Alter zu- oder abnimmt und offenbarten damit das Potenzial der DNAm-Analyse für die Altersschätzung [ 5, 9, 13]. Die DNAm ist eine epigenetische Modifizierung der DNA (v. a. von Cytosinen im Cytosin-Phosphat-Guanin[CpG]-Kontext) und ein wichtiges regulatorisches Element für die Zellfunktion [ 7]. In zahlreichen Studien konnten verschiedene altersabhängige DNAm-Marker identifiziert und Altersschätzungsmodelle über die Analyse großer Referenzkollektive entwickelt werden (u. a. [ 13, 16, 20, 21]). Da die DNAm gewebespezifisch ist und potenziell von Umwelt- und Lebensfaktoren beeinflusst werden kann, wurden verschiedene, für bestimmte Gewebetypen und Populationen spezifische Modelle entwickelt, die zudem auf unterschiedlichen Markern sowie deren Kombinationen basieren [ 6]. Abhängig vom Analyseumfang eines Modells, der v. a. auf der Zahl der zu untersuchenden Marker beruht, haben sich verschiedene Methoden zur DNAm-Detektion sowie der mathematischen Modellierung der altersabhängigen DNAm-Änderung (z. B. lineare Regression, „Random-forest“-Regression oder neuronale Netzwerke) etabliert. Für die Anwendung eines Modells, das in einem anderen Labor und ggf. mit einer anderen DNAm-Detektionsmethode erstellt wurde, muss sichergestellt sein, dass die DNAm identisch oder mit einer zu normalisierenden systematischen Abweichung gemessen werden kann. Studien konnten bereits zeigen, dass die Methoden zur DNAm-Detektion zu systematischen Abweichungen der DNAm-Messung führen [ 12, 19]. Die genutzte Methode für die Erstellung der Referenzdaten und auch die Messung der zu untersuchenden Probe muss daher berücksichtigt werden.
Die 2018 gegründete Arbeitsgemeinschaft „Molekulare Altersschätzung“ der Deutschen Gesellschaft für Rechtsmedizin (DGRM) hat in bisher 2 Ringversuchen (RV) mit Teilnehmern aus Deutschland und der Schweiz untersucht, wie vergleichbar die Ergebnisse der DNAm-Analysen zwischen den Teilnehmern und den angewandten Methoden sind. Dazu wurden im 1. RV eine Auswahl etablierter Marker vorgenommen und ein Assay zur Analyse mithilfe der Mini- oder Pyrosequenzierung etabliert [ 11]. Diese Auswahl beinhaltete die Altersmarker EDAR Associated Death Domain (EDARADD), Krüppel-Like Factor 14 (KLF14), Phosphodiesterase 4C (PDE4C) und Somatostatin (SST). Im Rahmen des 2. RV wurden auf Basis der Ergebnisse vom Vorjahr Anpassungen vorgenommen: 1) Die Analyse basiert auf Blutproben und bereits extrahierter DNA, da diese homogener aliquotiert und versendet werden können, 2) kommerzielle Kontroll-DNA wurden mitversendet, 3) der altersabhängige Marker ELOVL Fatty Acid Elongase 2 (ELOVL2) wurde hinzugenommen, 4) 2 Kontrollen für die Bisulfitkonvertierung wurden eingefügt, und 5) die Analyse-Pipeline wurde durch Verwendung der gleichen Reagenzien für die Konvertierung und Polymerase-Kettenreaktion (PCR) angepasst. Der allgemeine Ablauf einer DNAm-Analyse ist in Abb.  1 gezeigt. Wie im 1. RV sollten mit der Versendung einheitlicher Proben an verschiedene Labore die technischen Schwankungen zwischen den Laboren und auch zwischen den Methoden bestimmt werden, wobei die vorgenommenen Anpassungen insbesondere zusätzliche Schwankungen durch Verwendung verschiedener Reagenzien vermindern sollten. Die Teilnehmer setzten sich wieder aus Laboren mit Erfahrung in diesem Bereich und solchen, für die die DNAm-Analyse ein neues Anwendungsgebiet darstellt, zusammen. Vier, selbst in diesem Bereich forschende Labore, haben im 2. RV zudem eigene bzw. aus Forschungskooperationen entsprungene Assays zur Altersschätzung getestet, wodurch u. a. zusätzlich Ergebnisse aus der Analyse mittels Hochdurchsatzsequenzierung (massive parallele Sequenzierung, MPS) erhalten wurden. Das Ziel des RV war v. a. die Untersuchung der Reproduzierbarkeit von DNAm-Werten bzw. deren methodischen und laborbedingten Schwankungen. Zusätzlich bot er die Möglichkeit der Implementierung der DNAm-Analyse in forensische Labore. Der 2. Teil des RV, die Proben mit eigenen Assays zu analysieren und das Alter zu schätzen, sollte zudem zeigen, wie erfolgreich die Methodik in den entsprechenden Laboren bereits angewandt wird.

Material und Methoden

Probenmaterial und Vorbereitung für die Labore

Von 3 freiwilligen Probanden aus Deutschland (chronologisches Alter: 23,49 Jahre [weiblich]; 43,99 Jahre [männlich] und 44,87 Jahre [weiblich]) wurde Blut in Ethylendiamintetraessigsäure(EDTA)-Röhrchen entnommen. Die Studie wurde von der Ethik-Kommission der Albert-Ludwigs-Universität Freiburg genehmigt (Nr. 394/19) und mit dem schriftlichen Einverständnis der Probanden durchgeführt. Unmittelbar nach der Blutentnahme wurde für jedes der teilnehmenden Labore je ein Tupfer (Fa. Sarstedt, Nümbrecht) mit 100 µl Blut des jeweiligen Probanden angefertigt. Zudem wurden 2 ml EDTA-Blut/Proband direkt mit einem modifizierten Protokoll des QIAamp® DNA Mini Kit (Fa. Qiagen, Hilden, Deutschland) extrahiert und jedem Labor 100 µl DNA-Extrakt zur Verfügung gestellt. Die Methode zur DNA-Extraktion aus den Wattetupfern und zur Quantifizierung innerhalb der Labore wurde nicht vorgegeben und konnte individuell gewählt werden. Neben den Personenproben erhielten die Labore aus methylierten und unmethylierten DNA-Standards (Fa. Zymo Research Europe, Freiburg, Deutschland) hergestellte Kontroll-DNA-Mischungen (10 % DNAm, 50 % DNAm, 90 % DNAm). Die DNA-Konvertierung erfolgte mithilfe des EpiTect Fast Bisulfite Conversion Kit (Fa. Qiagen) laut Herstellerangaben (Ausnahme in einem Labor: EZ DNA Methylation Kit; Fa. Zymo Research). Die Tupfer, die bereits extrahierte DNA sowie die benötigten Primer und Protokolle wurden an alle Labore gleichzeitig versendet. Zusätzlich erhielten die Labore ein Auswerteformular, um neben den gemessenen DNAm-Werten Informationen zum Versuchsablauf (z. B. eingesetzte Tupfermenge) festzuhalten und damit mögliche Schwankungen besser identifizieren zu können.

Polymerase-Kettenreaktion und Sequenzierung

Mithilfe des Assays wurden 5 altersabhängige CpG-Positionen analysiert, wobei das Assay und 4 der 5 Positionen vom 1. RV übernommen wurden [ 11, 18]. Der aktuelle RV wurde um den Marker ELOVL2 erweitert und das Reaktionsvolumen der Multiplex-PCR im Vergleich zum 1. RV halbiert. Die PCR- und der Minisequenzierung-Primer von ELOVL2 wurden der Literatur entnommen [ 3], wobei der (TG)-Primer-Überhang am 5′-Ende beim Minisequenzier-Primer für das Assay in der Länge angepasst wurde ([TG] 7). Für die Pyrosequenzierung wurden neue Primer erstellt und am „reverse PCR primer“ ein Biotin angehängt (Tab.  1). Durch das finale Assay werden folgende altersabhängige CpG-Positionen (GRCh38.p12) untersucht: PDE4C (chr 19: 18233128), EDARADD (chr 1: 236394371), SST (chr 3: 187669863), KLF14 (chr 7: 130734356), ELOVL2 (chr 6: 11044628). Mit Ausnahme von ELOVL2 handelt es sich hierbei um das Cytosin vom Antisense-DNA-Strang. Sowohl die Singleplex-PCR für die Pyrosequenzierung als auch die Multiplex-PCR für die Minisequenzierung wurden mit dem PyroMark PCR Master Mix (Fa. Qiagen) durchgeführt. Für die Minisequenzierung wurden die PCR-Produkte mithilfe von ExoSAP-IT™ PCR Product Cleanup Reagent (Fa. Thermo Fisher Scientific [TFS], Waltham, MA, USA) oder der rAPid Alkaline Phosphatase (1 U/µl; Fa. Roche, Basel, Schweiz) in Verbindung mit der Exonuclease I (20 U/µl; Fa. New England Biolabs, Ipswich, MA, USA) enzymatisch aufgereinigt. Die „Single-base-extension“-Reaktion wurde in einem Ansatz von 5,5 µl mit dem SNaPshot™ Multiplex Kit (Fa. TFS) mit 25 Zyklen (10 s bei 96 °C, 5 s bei 55 °C, 30 s bei 60 °C und anschließend 10 min bei 60 °C) durchgeführt und das Sequenzierprodukt mit der rAPid oder Shrimp Alkaline Phosphatase (Fa. TFS) aufgereinigt. Die Sequenzierung erfolgte auf dem 3130/3130 xl oder 3500/3500 xl Genetic Analyzer (Längenstandard: GeneScan™ 120 LIZ™; Fa. TFS). Die Pyrosequenzierung erfolgte laut Herstellerprotokoll entsprechend dem verwendeten Gerät (PyroMark Q24/Q24 Advanced, PyroMark Q48; alle Fa. Qiagen).
Tab. 1
Positionen der analysierten CpG-Positionen und verwendete Primer
Locus
Position GRCh38.p12 (CpG)
PCR-Primer
Sequenzier-Primer
PDE4C
chr 19: 18233128 a
F: GGTAGAGGTTTGTAGTAGGTT c
PS: GGTTTGTAGTAGGTTGAG c
R b: ACCACCTACCCCCTACAAAAAAA c
MS: (TG) 12TTCRAAACTCTAATCATACTATAAC c
MS-konv: (TG) 4TACTTCRAAACTCTAATCATACTAT
EDARADD
chr 1: 236394371 a
F: TTGGTGATTAGGAGTTTTAGTGTTTT c
PS: TGTTATGGAAGAAGTAATAGA c
R b: CCTACAAATTCCCCAAAAAACTT c
MS: (TG) 18TTAACTCTAACCAAACAACCAAC c
MS-konv: (TG) 3AATTTAACTCTAACCAAACAACC
SST
chr 3: 187669863 a
F: AGGTGAGTTTTTATTTGGTATTTAAGAAA c
PS: AATTTGGGTAGTTGTTTG c
R b: CTTTAAATTACCCCTTTACCCTAATC c
MS: (TG) 23CCAAAATCAACACCAAAAATAAAC c
KLF14
chr 7: 130734356 a
F: GGGAGAGGTTGTTGTAATTTAGAAGT c
PS: GGTTGTTGTAATTTAGAAGTT c
R b: ACCCCCCCACTAAATCATATTTAACAA c
MS: (TG) 25TTAACAACCTCAAAAATTATCTTATCTCC c
ELOVL2
chr 6:11044628
F: GGGGYGTAGGGTAAGTGAG d
PS: GGGYGGYGATTTGTAGGTTT
R b: CAACRAATAAATATTCCTAAAACTCC d
MS: (TG) 7GGGAGGAGATTTGTAGGTTTAGT d
Im Ringversuch wurden 5 altersabhängige CpG-Positionen analysiert (4 identisch zum ersten Ringversuch [ 11]). Zusätzlich wurden bei der Minisequenzierung 2 Nicht-CpG-Positionen zur Überprüfung der Konvertierungseffizienz eingebaut (konv)
CpG Cytosin-Phosphat-Guanin, EDARADD EDAR Associated Death Domain, ELOVL2 ELOVL Fatty Acid Elongase 2, F/R „forward bzw. reverse primer“, KLF14 Krüppel-Like Factor 14, MS Minisequenzierung, PDE4C Phosphodiesterase 4C, PS Pyrosequenzierung, SST Somatostatin
a„C“ vom reversen DNA-Strang
bBei Pyrosequenzierung am 5′-Ende biotinyliert
cÜbernommen aus [ 11]
dÜbernommen von [ 3]
Die DNAm an der jeweiligen Position wurde bei beiden Methoden jeweils aus dem Quotienten der Signale für ursprünglich methylierte und unmethylierte Moleküle berechnet. Die Signale basieren in beiden Fällen auf Fluoreszenzsignalen, wobei es sich bei der Minisequenzierung um relative Fluoreszenzeinheiten („relative fluorescence units“, RFU) der eingebauten farblich markierten Nukleotide handelt und bei der Pyrosequenzierung um quantitative Fluoreszenzsignale, die mit der Menge an freigesetztem Pyrophosphat beim Baseneinbau gekoppelt sind. Bei der Minisequenzierung erfolgt die Berechnung der DNAm manuell und bei der Pyrosequenzierung automatisiert über die Software. Die vollständige Konvertierung aller unmethylierten Cytosine wurde über die Konvertierungseffizienz verschiedener Cytosine außerhalb eines CpG-Kontextes, die unmethyliert vorliegen und somit vollständig konvertiert werden müssten, kontrolliert (Konvertierungseffizienz = 100 % − DNAm%). Da bei der Minisequenzierung nur eine einzelne Basenposition und nicht wie bei der Pyrosequenzierung ein gesamter DNA-Abschnitt sequenziert wird, wurden hier zusätzlich 2 Nicht-CpG-Positionen in den Amplikons von EDARADD und PDE4C analysiert.

Ergebnisse

Insgesamt nahmen 14 Labore am Ringversuch teil, von denen 2 Labore die DNAm mit beiden Methoden analysierten. Eine Übersicht zu den eingesetzten Reagenzien befindet sich in Tab.  2. Zwei Labore konnten durch Schwierigkeiten bei der Sequenzierung bzw. DNAm-Detektion, trotz erfolgreicher DNA-Extraktion und Konvertierung, keine DNAm-Ergebnisse generieren. Zum Teil konnten aufgrund technischer Probleme nicht für alle Marker und Proben Ergebnisse übermittelt werden. Vier Labore schätzen zudem das Alter der RV-Proben über eigene Modelle und mit z. T. abweichenden Markern auf Basis der Pyrosequenzierung oder der massiven parallelen Sequenzierung (MPS).
Tab. 2
Verwendete Reagenzien/Kits der Teilnehmer
Methodik
Kit/Reagenzienname
Anzahl ( n) der Labore
DNA-Extraktion
Säulenbasiert
QiaAmp® Mini Kit (Fa. Qiagen, Hilden, Deutschland)
4
PrepFiler™ (Fa. Thermo Fisher Scientific [TFS], Waltham, MA, USA)
1
PrepFiler Express BTA™ Forensic DNA Extraction Kit (Fa. TFS)
1
„Beads“
EZ1 DNA Investigator Kit (Fa. Qiagen)
2
DNA IQ™ Casework Pro for Maxwell® Kit (Fa. Promega, Madison, WI, USA)
5
Maxwell® 16 LEV Blood DNA Kit (Fa. Promega)
1
DNA-Quantifizierung
Quantitative PCR (Real-Time-PCR)
PowerQuant® (Fa. Promega)
6
Investigator Quantiplex Pro (Fa. Qiagen)
3
Quantifiler™ Trio (Fa. TFS)
2
Fluoro- oder fotometrisch
Qubit™ dsDNA HS Assay Kit/Qubit® für Fluorometer (Fa. TFS)
1
QuantiFluor® ONE dsDNA System/Quantus™ Fluorometer (Fa. Promega)
1
NanoDrop (Fa. TFS)
1
Bisulfitkonvertierung
Chemisch mithilfe von Bisulfit
EpiTect Fast Bisulfite Conversion Kit (Fa. Qiagen)
13
EZ DNA Methylation Kit (Fa. Zymo Research)
1
DNA-Quantifizierung
Nachweis konvertierter DNA (ssDNA)
Qubit™ dsDNA ssDNA Assay Kit/Qubit® Fluorometer (Fa. TFS)
2
NanoDrop (Fa. TFS)
1
Nachweis unkonvertierter Rest-DNA (dsDNA)
Qubit™ dsDNA BR Assay Kit/Qubit® Fluorometer und Quantifiler Trio (Fa. TFS)
1
PowerQuant® (Fa. Promega)
3
DNAm-Analyse (nur erfolgreiche Analysen)
Minisequenzierung
Genetic Analyzer 3130/3130 xl-POP4™ (Fa. TFS)
4
Genetic Analyzer 3130/3130 xl-POP6™ (Fa. TFS)
1
Genetic Analyzer 3130/3130 xl-POP7™ (Fa. TFS)
1
Genetic Analyzer 3500/3500 xl-POP4™ (Fa. TFS)
2
Pyrosequenzierung
PyroMark Q48 (Fa. Qiagen)
4
PyroMark Q24/Q24 Advanced (Fa. Qiagen)
2
Die verschiedenen Materialien und Methoden sind mit Angabe der Anzahl der Teilnehmer für die einzelnen Schritte im Versuchsablauf aufgeführt
dsDNA „double-stranded DNA“, DNAm DNA-Methylierung, PCR Polymerase-Kettenreaktion, ssDNA „single-stranded DNA“

Extraktion und Quantifizierung der erhaltenen Blutproben

Die Extraktion der DNA vom gesamten oder von einem Teil des Tupfers erfolgte in allen Laboren mit kommerziellen Kits, die auf der Säulen- oder „Bead“-Extraktion basieren (Tab.  2). Die DNA-Ausbeute aus den Tupfern zeigte große Schwankungen, wobei mehr DNA aus den auf „magnetic beads“ basierenden Methoden erhalten wurde (Abb.  2a), unabhängig vom Anteil des eingesetzten Tupfers (Abb.  2b). Die direkt versendete DNA wies ebenfalls in den Quantifizierungen Differenzen auf (Mittelwerte mit Standardabweichung: DNA-Extrakt 1: 22,29 ± 8,42 ng/µl, DNA-Extrakt 2: 16,15 ± 5,16 ng/µl, DNA-Extrakt 3: 34,09 ± 12,74 ng/µl), sodass ein Teil der beobachteten Schwankungen bei der DNA-Ausbeute auch auf technische Variationen bei der Quantifizierung zurückzuführen ist. Die Auswertung zeigt zudem, dass Proband 3 bei der Blutabnahme die höchste Anzahl kernhaltiger Leukozyten besaß, da sowohl im versendeten DNA-Extrakt 3 als auch in den DNA-Extraktionen aus Tupfer 3 meist die höchste DNA-Menge erhalten wurde (Abb.  2b).

Bisulfitkonvertierung und anschließende Quantifizierung

Der Erfolg der Bisulfitkonvertierung bzw. die „recovery“, also die Menge an erhaltener konvertierter DNA nach der Bisulfitbehandlung, wurde in 7 Laboren untersucht. Dabei maßen 3 Labore die erhaltene einzelsträngige DNA (ssDNA) mithilfe fotometrischer oder fluorometrischer Verfahren. Vier Labore quantifizierten die noch verbliebene doppelsträngige DNA (dsDNA), deren Vorhandensein auf eine unvollständige Konvertierung hinweist, da die DNA nach der Bisulfitkonvertierung einzelsträngig vorliegt. Von keinem der Labore wurden Hinweise auf eine fehlgeschlagene Konvertierung gefunden, jedoch wurde bei der Messung der ssDNA mithilfe des Qubit® (Fa. TFS) in einem Labor im Anschluss der Bisulfitkonvertierung eine höhere DNA-Menge gemessen, als ursprünglich für die Konvertierung genutzt wurde (s. Abschn. „Diskussion“).
Die Überprüfung der Bisulfitkonvertierung anhand der Kontrollmarker in der Minisequenzierung zeigte keine systematischen Probleme bei der Konvertierung selbst. Zwar detektierten 2 Labore an den Kontrollpositionen Nachweis-Peaks für unkonvertierte DNA, diese konnten jedoch als hohe Hintergrundfluoreszenz (Peaks nicht gut von der Basislinie abgrenzbar) bzw. Geräteartefakt (kein Peak bei Wiederholung auf anderem Gerät) identifiziert werden. Bei der Pyrosequenzierung führt die Software die Kontrolle der vollständigen Konvertierung auf Basis voreingestellter Schwellenwerte automatisch durch und gibt dem Anwender auf dieser Basis einen qualitativen Hinweis zum Erfolg der Konvertierung. Manuell kann man zudem die Peak-Höhen im Pyrogramm auswerten, um die Konvertierungseffizienz zu bestimmen.
Anhand der berechneten Konvertierungseffizienz konnte qualitativ kein Unterschied zwischen den verschiedenen Extraktionsverfahren beobachtet werden. Alle Methoden generierten „saubere“ DNA ohne Inhibition für die Bisulfitkonvertierung. Ebenfalls konnten keine Unterschiede zwischen den Ergebnissen der identisch extrahierten Blutproben (DNA-Extrakte 1, 2, 3) und individuell extrahierten Blutproben (Blute 1, 2, 3) festgestellt werden.

Sequenzierung zur DNA-Methylierungsanalyse

Minisequenzierung

Vier der altersabhängigen CpG-Positionen ( EDARADD, SST, PDE4C, KLF14) sowie die Nicht-CpG-Kontrollen werden über blaue (methyliertes Cytosin) bzw. grüne Fluoreszenzfarbstoffe (unmethyliertes Cytosin) detektiert. Bei ELOVL2 wird hingegen ein gelber (schwarz im Elektropherogramm) (methyliertes Cytosin) bzw. roter (unmethyliertes Cytosin) Fluoreszenzfarbstoff detektiert. Die Position im Elektropherogramm wird über die Länge des Primers bestimmt (einschließlich Überhang; Abb.  3).
Eine erfolgreiche Minisequenzierung wurde in 8 Laboren mit dem Genetic Analyzer 3130/3130 xl oder 3500/3500 xl durchgeführt (Tab.  1). Die Ergebnisse der Minisequenzierungen wiesen große Unterschiede der Signalintensitäten zwischen den Markern und Farbkanälen auf, die die Analyse vor allen Dingen bei geringer Signalintensität erschweren. Bereits im 1. RV zeigten sich diese Probleme für PDE4C und KLF14. Da die Imbalancen zwischen den Markern aus einer ungleichmäßigen Amplifikation während der Multiplex-PCR resultieren, muss der PCR-Ansatz für diese Markerkombination für zukünftige Anwendungen optimiert werden. Für die Analysen mussten in einigen Laboren die Analyseparameter der Kapillarelektrophorese (z. B. die Injektionszeit) angepasst werden, um ausreichende, aber nicht zu schwache oder starke Fluoreszenzsignale aller Marker zu erhalten.
Die mithilfe der Minisequenzierung gemessenen DNAm-Werte zeigten zwischen den Laboren für PDE4C und EDARADD die größten absoluten Abweichungen zwischen den gemessenen DNAm-Werten, während die Ergebnisse insbesondere für KLF14 weniger abwichen (z. B. bei Blut der Person 1 mit einer Spannbreite bei EDARADD von 22,9 DNAm% und bei KLF14 mit 5,55 DNAm%). Zwischen den versendeten DNA-Extrakten und der selbst extrahierten DNA aus den Tupfern fand sich kein systematischer Unterschied der DNAm Werte (Abb.  4). Im 1. RV waren bei EDARADD die geringsten Schwankungen zu verzeichnen. Dies steht jedoch nicht im Gegensatz zu den hier präsentierten Ergebnissen, sondern kommt durch die geringeren gemessenen Schwankungen bei den anderen Markern im 2. RV gegenüber dem 1. RV zustande.

Pyrosequenzierung

Die DNAm wurde in 6 Laboren mit dem PyroMark Q48 (4-mal) oder dem PyroMark Q24/Q24 Advanced (2-mal) bestimmt (Tab.  2, Beispiel in Abb.  5).
Die Ergebnisse für die versendete DNA und die selbst extrahierte DNA aus den Tupfern mit Blut sind in Abb.  6 dargestellt.

Vergleich der Methoden und Geräte

Die verwendeten Methoden und Geräte werden im Folgenden am Beispiel der versendeten DNA-Extrakte und nicht der Blutproben verglichen, um den potenziellen Einfluss der abweichenden Extraktionsmethodik auszuschließen. Die Ergebnisse der Minisequenzierung zeigten v. a. bei PDE4C und EDARADD größere Schwankungen im Vergleich zu der Pyrosequenzierung (Abb.  7).
Geräteabhängig (3130 vs. 3500 und Q48 vs. Q24/Q24 Advanced) zeigten sich sowohl in der Mini- als auch der Pyrosequenzierung v. a. in EDARADD Unterschiede; diese waren z. T. in den anderen Markern nur als Tendenz zu beobachten: Die Ergebnisse vom Genetic Analyzer 3500/3500 xl lagen im niedrigeren Bereich der mithilfe der Minisequenzierung gemessenen DNAm-Werte. Die PyroMark-Q24/Q24-Advanced-Werte befanden sich eher im oberen Spektrum im Vergleich zu den DNAm-Werten des PyroMark Q48. Ob dies tatsächlich gerätespezifische Effekte sind, lässt sich bei je nur 2 Laboren, die einen Genetic Analyzer 3500/3500 xl bzw. PyroMark Q24/Q24Advanced verwendeten haben, nicht feststellen.

Einzelbeobachtungen aus Replikatanalysen

Replikatanalysen wurden vereinzelt durchgeführt. Duplikatwerte der DNAm-Analyse wurden für die Minisequenzierung von 3 (Blutproben) bzw. 4 (DNA-Extrakte) Laboren eingereicht und für die Pyrosequenzierung von 4 (Blutproben) bzw. 5 (DNA-Extrakte) Laboren. Es fanden sich laborabhängig verschieden starke Schwankungen in den DNAm-Werten für die Replikate und somit Reproduzierbarkeit der DNAm-Werte. Es wurden sowohl für die Minisequenzierung also auch für die Pyrosequenzierung Schwankungen bis zu 8 DNAm% gemessen. Wie bereits erwähnt, wurde zusätzlich aufgrund einer sehr geringen DNA-Menge in der Zweitanalyse in einem Fall eine Schwankung von 21 DNAm% (Minisequenzierung) festgestellt. Bei den Replikaten der DNA-Extrakte blieben mit einigen Ausnahmen die Schwankungen fast immer unter 5 DNAm%. So wurde bei der Minisequenzierung eine Schwankung von 6 DNAm% ( PDE4C) bzw. der Pyrosequenzierung insgesamt 3‑mal ein Unterschied von mehr als 5 DNAm% (9 und 8 % in ELOVL2, 6 % in PDE4C) gemessen. Hierbei scheint es sich jedoch eher um Ausreißer zu handeln.
Ein Labor, das den Tupfer geteilt und daher 2 unabhängige Extraktionen derselben Probe durchgeführt hatte, erhielt im ersten Extrakt 4,4 ng/µl (ein Drittel des Tupfers) und im zweiten 0,4 ng/µl (zwei Drittel des Tupfers) DNA. Beide Extrakte wurden unabhängig voneinander analysiert und daher einmal 88 ng und einmal nur rund 2,7 ng DNA konvertiert und in beiden Fällen 1 µl in die anschließende PCR eingesetzt. Abweichungen der DNAm-Werte zwischen den beiden Analysen bis zu 21 % ( ELOVL2 43 % vs. 64 %) waren zu beobachten, wobei die DNAm-Werte von Extrakt 1 vergleichbar mit den Werten der anderen Labore waren. Dies kann auf stochastische Effekte bei zu wenig eingesetzter DNA hinweisen (s. Abschn. „Diskussion“).

Berechnung des Alters auf Basis der Mini- und Pyrosequenzierung

Das Ziel des RV war, wie im 1. RV, die Untersuchung der technischen Schwankungen bei Verwendung verschiedener Geräte und Methoden. Daher wurden für den RV bereits in verschiedenen Laboren und Studien etablierte altersabhängige DNAm-Marker ausgewählt. Die dadurch erhaltene Kombination der analysierten Positionen wurde bisher nicht in einem Modell für die Altersschätzung berücksichtigt. Um einen Einblick zu erhalten, welchen Effekt die Schwankungen bei den Messungen im 2. RV auf eine Altersschätzung haben könnten, wurde auf Basis von noch nicht publizierten Blut-DNAm-Daten (MPS-Daten auf Basis von 4 der 5 CpG-Positionen sowie bei PDE4C eine Nachbarposition [chr 19: 18233105], wie auch in der Studie von Weidner et al. 2014 [ 20]) verwendet und damit ein vorläufiges Modell unter Verwendung der „Random-forest“-Regression erstellt. Es ist zu berücksichtigen, dass das Modell auf einer sehr geringen Zahl von Trainingsdaten basiert und nur einen Probanden jünger als Person 2 beinhaltet (16 Probanden zwischen 21 und 60 Jahren). Da alle Labore dieselben Proben analysierten, können die erhaltenen Abweichungen zwischen den Laboren jedoch alleinig auf technische Unterschiede zurückgeführt werden und sind unabhängig von der Genauigkeit des Modells. Da die Altersschätzung unter Nutzung dieses Modells nur einen Einblick über die zu erwartenden Schwankungen bei der Altersschätzung auf Basis der in dem RV erhaltenen DNAm-Werte und der Messschwankungen geben soll, wurde zur Bewertung nicht die mittlere absolute Abweichung zum realen Alter gemessen, sondern die mittlere absolute Abweichung („median absolute deviation“, MAD) zum Mittelwert der Altersschätzungen. Eine Altersschätzung war nur möglich, wenn ein Labor zu einer Probe alle 5 DNAm-Werte detektieren konnte. Wie bereits an den DNAm-Werten erkennbar, ergab sich kein systematischer Unterschied zwischen der Verwendung von Blut oder bereits extrahierter DNA aus Blut (Abb.  8). Zudem zeigte sich, dass mit beiden Detektionsmethoden gute Schätzungen erhalten werden können und technisch bedingte Abweichungen sowohl mit der Pyro- als auch der Minisequenzierung auftreten (Tab.  3).
Tab. 3
Im Mittel errechnete Altersschätzungen und Schwankungen für die einzelnen Proben und in Abhängigkeit von der Detektionsmethode
Probe
Minisequenzierung
Pyrosequenzierung
MW, geschätztes Alter (Jahre)
MAD zum MW (Jahre)
MW, geschätztes Alter (Jahre)
MAD zum MW (Jahre)
Person 1
DNA-Extrakt
46,15
1,88
46
3,63
Blut-Tupfer
44,86
0,63
47,37
1,64
Person 2
DNA-Extrakt
37,14
3,65
33
1,18
Blut-Tupfer
36,6
4,61
36,67
5,19
Person 3
DNA-Extrakt
48
1,09
48,87
1,26
Blut-Tupfer
47,84
1,5
48,32
0,6
Aus den Altersschätzungen pro Labor wurde der Mittelwert ( MW) gebildet und die mittlere absolute Abweichung („median absolute deviation“, MAD) von diesem berechnet. Es wurde unterschieden, ob der DNA-Methylierung(DNAm)-Wert aus dem versendeten Tupfer oder der bereits extrahierten DNA erhalten wurde. Die Werte beschreiben die Schwankung der Altersschätzung zwischen den Laboren, bedingt durch die DNAm-Detektion, unabhängig vom Berechnungsmodell und dem eigentlichen chronologischen Alter

Ergebnisse der Altersschätzung mit frei gewählten Markern und Modellen

Vier Labore führten zusätzlich Altersschätzungen mit eigenen Assays und Modellen durch, wobei 2 Labore die Technik der MPS und 2 Labore die Pyrosequenzierung nutzten. Die Modelle für die Altersschätzungen unterschieden sich in den 4 Laboren in Bezug auf die Auswahl und Kombination der Marker sowie Umfang und Auswahl der Probenkollektive für die Ermittlung der Referenzdaten ([ 8, 10, 16, 17]; Tab.  4). Jeweils mit dem entsprechenden Modell konnte Labor 5 mithilfe der MPS alle Proben und Labor 9 mithilfe der Pyrosequenzierung 5 der 6 Proben innerhalb eines Fehlerbereiches von ± 5 Jahren schätzen. Die Altersschätzung von Labor 4 mithilfe der MPS führte zu einer Überschätzung des Alters aller Proben. Labor 4 verwendete den von Heidegger et al. [ 10] geschilderten Assay-Prototyp sowie das dort beschriebene statistische Modell in Kombination mit einer laboreigenen, im Vergleich zu Heidegger et al. [ 10] abgewandelten, Probenaufbereitung. Da ein Einfluss einer methodeninduzierten Verzerrung, insbesondere durch die Bisulfitkonvertierung, noch nicht umfassend evaluiert wurde, wird an dieser Stelle die Wichtigkeit der Überprüfung des statistischen Modells in Bezug auf die laborinternen Abläufe sowie eine ggf. erforderliche Anpassung des Modells hervorgehoben. Dies ist derzeit u. a. Forschungsgegenstand im assoziierten Konsortium. Die Altersschätzungen in Labor 12 wichen z. T. sehr stark vom tatsächlichen Alter ab. Dabei konnte keine Systematik der Abweichung in Bezug auf den untersuchten Probanden oder das Probenmaterial (Extrakt oder Blut) festgestellt werden.
Tab. 4
Von den Laboren mit eigenem Assay geschätzte Alter und Abweichungen zum wahren Alter der Probanden
Probe
Probandenalter (Jahre)
Geschätzte Alter
Labor 4
Labor 5
Labor 9
Labor 12
DNA 1
44,87
49,81
49,5
52
54
+4,94
+4,83
+7,13
+9,13
Blut 1
44,87
48,81
43,88
45
43
+3,94
−0,9
+0,13
−1,8
DNA 2
23,49
27,19
21,33
21
24
+3,7
−2,18
−2,49
+0,51
Blut 2
23,49
29,38
28,35
19
38
+5,89
+4,86
−4,49
+14,51
DNA 3
43,99
52,11
45,44
46
49
+8,12
+1,45
+2,01
+5,01
Blut 3
43,99
50,14
43,51
47
44
+6,15
−0,48
+3,01
+0,01
Anzahl der CpG, Methode, ggf. Referenz
5 CpG, MPS-Assay-Prototyp [ 10, 21]
10 CpG, selektiert aus [ 16], MPS
3 CpG, Pyrosequenzierung [ 8]
5 CpG, Pyrosequenzierung [ 17]
Es sind die Alter der Probanden und auch die berechneten Werte/Abweichungen in Jahren angegeben. DNA 1, 2 und 3 entstammen aus denselben Proben wie die verteilten Bluttupfer
CpG Cytosin-Phosphat-Guanin, MPS massive parallele Sequenzierung

Diskussion

Von 14 teilnehmenden Laboren konnte die DNAm-Analyse in 12 Laboren erfolgreich durchgeführt werden. Probleme bei den Analysen, von in diesem Bereich weniger routinierten Teilnehmern, konnten zumeist durch gemeinsames Troubleshooting und Wiederholungen gelöst werden, oder die betreffenden Teilergebnisse wurden bei der Auswertung des RV ausgeschlossen. Es ist aber davon auszugehen, dass eine Optimierung der Methodik und zunehmender Erfahrungsgewinn dazu führen, dass bisherige technische Probleme gelöst werden. Dies zeigt, wie auch im 1. RV, dass Erfahrungen gesammelt werden müssen. In dieser Form war der RV ein gutes Training für „Anfänger“ in diesem Bereich und konnte deutlich aufzeigen, welche Informationen und Hilfestellungen die Implementierung erleichtern. Zudem findet sich im Vergleich der absoluten Schwankungsbereite der Messewerte eine Verbesserung im Vergleich zum 1. RV, die neben der vereinheitlichen Nutzung von Reagenzien wohl auch auf einen Lerneffekt zurückzuführen ist.

Einfluss des Probenmaterials und der Extraktion

Die erhaltenen Ergebnisse des aktuellen RV beziehen sich nur auf Blutproben. Bei einem anderen Probenmaterial wie Speichel oder Wangenschleimhautabrieben könnten aufgrund der Zellzusammensetzung oder der inhomogenen Verteilung des Zellmaterials (Viskosität beim Speichel, ungleiche Materialantragung bei Wangenschleimhautabrieben) bereits durch das Probenmaterial selbst höhere Schwankungen auftreten. Um das Ausgangsmaterial im diesjährigen RV möglichst homogen zu halten, wurde daher Blut, das zudem in ausreichender Menge von den Probanden erhalten werden konnte, für den RV verwendet. Zusätzlich wurde bereits extrahierte DNA (auch aus Blut der 3 Probanden) an alle Labore versendet, um mögliche Unterschiede bei der Schwankungsbreite der gemessenen DNAm-Werte, bedingt durch die Extraktionen in den Laboren, besser zu identifizieren.
Alle Labore verwendeten in der Forensik etablierte kommerzielle Kits zur DNA-Extraktion, die sich neben den einzelnen Reagenzien vor allen Dingen in der Extraktionstechnik (säulenbasiert oder mithilfe von Magnetic beads) unterschieden. Keines der verwendeten Kits hatte einen inhibitorischen Einfluss auf die Bisulfitkonvertierung; alle untersuchten Proben wurden vollständig konvertiert. Eine inkomplette Konvertierung im Bereich der Primer-Bindungsstelle könnte zum Verlust des Nachweises einzelner Moleküle führen, da diese nicht amplifiziert werden würden. Der generelle Erfolg der PCR und damit auch einer erfolgreichen Konvertierung der DNA kann mithilfe der Gelanalyse nach der PCR überprüft werden. Die Verwendung verschiedener Extraktionstechniken kann jedoch zu Unterschieden bei der DNA-Ausbeute führen, da manche Extraktionsprotokolle auf eine möglichst hohe DNA-Ausbeute abzielen, während andere den Schwerpunkt auf eine Extraktion „sauberer“ DNA mit optimaler Entfernung von Inhibitoren setzen und der oft dadurch höhere Verlust an DNA einkalkuliert wird. Grundsätzlich hat die DNA-Menge, die für eine quantitative DNAm-Analyse eingesetzt wird, einen Einfluss auf die Genauigkeit der DNAm-Analyse. Optimalerweise sollten mindestens 10 ng konvertierte DNA eingesetzt werden [ 15]. Im aktuellen RV standen 100 µl Blut zur Verfügung, die ausreichend Material für die geplanten Analysen enthalten sollten. Allerdings zeigten sich bei einigen Laboren sehr schwankende und niedrige Extraktionseffizienzen. Diese Ergebnisse machen deutlich, wie wichtig nicht nur das Wissen über die Ausgangsmenge genomischer DNA, sondern auch über die in die PCR eingesetzte Menge konvertierter DNA ist. Da die Konvertierung jedoch ein maximales Volumen von 40 µl DNA-Extrakt erlaubt, könnte eine Elution in ein kleineres Volumen nach der Extraktion von Vorteil sein. Ein Labor beobachtete jedoch auch, dass die Verwendung einer zu hohen Menge an konvertierter DNA in der anschließenden PCR zu Hemmungen führen kann. Für eine wirklich genaue Quantifizierung bisulfitkonvertierter DNA ist jedoch eine für bisulfitkonvertierte DNA spezifische quantitative (q)PCR nötig, die derzeit nicht kommerziell verfügbar ist. Als Näherungswert kann die einzelsträngige DNA direkt oder indirekt über fotometrische oder fluoreszenzbasierte Verfahren gemessen werden. Dass es sich dabei aber tatsächlich nur um Näherungswerte handelt, zeigen die Ergebnisse der fluorometrischen Analyse eines RV-Teilnehmers, der eine größere Menge an konvertierter DNA maß als ursprünglich in die Konvertierung eingesetzt wurde. Dies kann auf eine Unterschätzung der ursprünglich eingesetzten DNA-Menge zurückzuführen sein, aber auch an Rest-dsDNA liegen, die unspezifisch mitgemessen wurde. Zu bedenken ist außerdem, dass diese Methodik keine Aussage über die Degradierung der DNA durch die Bisulfitkonvertierung ermöglicht. Im direkten Vergleich von extrahierter DNA mit den Blutproben finden sich im Mittel über die 3 Personen und alle Labore Abweichungen zwischen den DNAm-Werten aus dem Blut vs. DNA-Extrakt von ± 2,0 DNAm% (Minisequenzierung) und 2,2 DNAm% (Pyrosequenzierung). Vereinzelte Ausreißer konnten beobachtet werden, im Ganzen weisen die Ergebnisse jedoch eine gute Übereinstimmung zwischen Blut und DNA-Extrakt bei beiden Methoden auf.

Methodenvergleich

Durchführung

Die Minisequenzierung ist eine Standardanwendung in der Forensik zur Bestimmung von „single nucleotide polymorphisms“ (SNP, [ 14]). Da die Detektion, wie bei der STR-Typisierung, über die in allen Laboren verfügbare Kapillarelektrophorese durchgeführt wird, ist kein zusätzliches Gerät notwendig. Die der Minisequenzierung vorgeschaltete PCR konnte in einer Multiplexreaktion durchgeführt werden, wohingegen bei der Pyrosequenzierung Einzelreaktionen nötig waren. Neue Strategien zur PCR-Analyse in einer Multiplexreaktion werden zurzeit entwickelt, wobei die Sequenzierung im Anschluss weiterhin einzeln erfolgt [ 4]. Beim hier durchgeführten RV wurde jedoch durch diesen Unterschied eine größere Menge an DNA für die Pyrosequenzierung benötigt. Ein PCR-Bias innerhalb der Multiplex-PCR bei der Minisequenzierung gegenüber der Singleplex-PCR bei der Pyrosequenzierung kann nicht ausgeschlossen werden. Beide Methoden sind in einfache Assays implementierbar und ohne großen Zeitaufwand durchführbar, wobei Erfahrung mit der Auswertung und Interpretation für die Anwendung zur Altersschätzung bei beiden Methoden relevant ist. Kostentechnisch ist bei der Pyrosequenzierung mit etwas höheren Ausgaben zu rechnen, da spezielle Reagenzien und spezielle Primer, die z. T. biotinyliert sein müssen, benötigt werden.

Auswertung der Sequenzierung

Die DNAm-Analyse mithilfe der Minisequenzierung setzte in einigen Laboren voraus, dass die verwendeten Einstellungen des Kapillarelektrophoresegerätes für die Analyse von SNP im jeweiligen Labor optimiert wurden. Auch wenn die Analyse mithilfe der Minisequenzierung eine verbreitete Methodik in forensischen Laboren darstellt, wird sie seltener in der aktuellen Fallarbeit eingesetzt. Es zeigte sich bei den Teilnehmern, dass insbesondere eine gute Matrix und an das Gerät angepasste Injektionszeiten extrem wichtig waren, um qualitativ hochwertige Ergebnisse zu erhalten. Erhöhter Hintergrund, in andere Kanäle durchschlagende Peaks oder aber geringe Peak-Höhen, die zu Problemen mit dem Schwellenwert führen, erschwerten die Analyse. Der Wissenschaftler bzw. die Wissenschaftlerin muss nach der Analyse selbst die Entscheidung treffen, ob und welcher Peak gewertet wird. Im Gegensatz zur „klassischen“ SNP-Analyse, bei der nur homo-/heterozygote Genotypen nachgewiesen werden (also das Vorhandensein von einem Peak oder 2 Peaks), müssen bei der DNAm-Analyse kontinuierliche Höhenveränderungen gemessen werden, was gerade bei sehr niedrigen und sehr hohen Werten dazu führte, dass Peaks „übersehen“ werden bzw. nicht klar dargestellt sind (z. B. als „split peak“). Die Erfahrungen aus der „Short-tandem-repeat“(STR)-Analyse können jedoch helfen, die erhaltenen Elektropherogramme zu beurteilen. Zu beachten ist, dass bei der Minisequenzierung die relative Fluoreszenzintensität, wie auch bei der STR-Analyse, abhängig vom Farbkanal und von dem Gerät ist und es sich daher im Gegensatz zur Pyrosequenzierung um eine semiquantitative Analyse handelt.
Bei der Pyrosequenzierung übernimmt die PyroMark-Software viele Beurteilungen der Qualität automatisiert und unterstützt den Anwender in der Auswertung. Die Software hat ein spezielles Analyse-Tool für die DNAm-Analyse. Jedoch hat sich gezeigt, dass eine zusätzliche Beurteilung durch den Wissenschaftler nötig ist, um bei einigen durch die Software angezeigten Problemen dennoch eine Verwendung der gemessenen DNAm-Werte zu ermöglichen. Die gute Optimierung des finalen Assays ist jedoch notwendig, um verlässliche Ergebnisse für alle Marker zu erhalten. Da die Pyrosequenzierung bisher im forensischen Bereich in vielen Laboren noch nicht zur Anwendung kam, muss mehr Erfahrung gewonnen werden, um die Qualität der Ergebnisse und mögliche Probleme besser einschätzen zu können. Das Pyrogramm gibt die DNAm-Werte ohne Nachkommastellen aus. Dies kann bei Markern wie KLF14 mit einer zwar starken Alterskorrelation, aber generell geringen DNAm und einem geringen Anstieg der DNAm/Jahr zu stärkeren Schwankungen führen (z. B. 1,49 % als 1 % DNAm und 1,51 als 2 % DNAm). Es ist jedoch möglich, die „Rohwerte“ mit den Nachkommastellen zu exportieren. Dies wurde im diesjährigen RV jedoch nur von einem Labor gemacht, sodass sich hierdurch auch geringe Schwankungen in diesem RV erklären lassen.

Schwankungen der DNA-Methylierungswerte

Schwankungen zwischen erhaltenen DNAm-Werten können durch Messschwankungen bei wiederholter Analyse, die Analyse in unterschiedlichen Laboren mit verschiedenen Geräten und durch methodische Unterschiede entstehen. Schwankungen zwischen den Laboren und den Methoden haben sich auch im 1. RV gezeigt [ 11]. Eine Analyse von Replikaten, die die Messgenauigkeit innerhalb eines Labors widerspiegelt, erfolgte nur von einigen Laboren. Die erhaltenen Ergebnisse stellen somit vorerst Einzelbeobachtungen dar und müssen verstärkt untersucht werden. Im aktuellen RV wurde zuvor nicht festgelegt, ab welchem Schritt das Replikat durchgeführt werden muss. Bei einer Wiederholung ab der Extraktion ist mit einer größeren Schwankung als bei einer Wiederholung der PCR und Sequenzierung zu rechnen. Zudem wären Triplikate von Vorteil, um Ausreißer von technischen Schwankungen zu unterscheiden. Innerhalb einer Validierung im Labor ist jedoch ein systematischer Vergleich von Mehrfachreplikaten zu verschiedenen Zeitpunkten aus komplett neuen Analysen notwendig, um die im Labor zu erwartenden Schwankungen zu bestimmen.
Bei der Minisequenzierung zeigten sich insbesondere bei PDE4C, EDARADD (Personen 1 und 2) sowie bei ELOVL2 (Personen 1 und 3) höhere absolute DNAm-Schwankungen als bei SST und KLF14 sowie bei Person 2 in ELOVL2 und bei Person 3 in EDARADD mit einem niedrigeren DNAm-Wert. Mit abnehmender Ausgangsmenge an DNA und bei Markern mit einer DNAm um 50 % ist jedoch aus stochastischen Gründen (Binomialverteilung) immer mit höheren Schwankungen zu rechnen [ 15]. Diese Unterschiede sind auch, jedoch weniger stark ausgeprägt, bei der Pyrosequenzierung zu beobachten. Bei DNAm-Werten im mittlerem Bereich (25–75 %) zeigt sich jedoch, dass die Minisequenzierung gegenüber der Pyrosequenzierung bei ELOVL2 eher einen geringeren DNAm-Wert misst, aber bei den Markern PDE4C und EDARADD mit DNAm-Werten über 25 % einen höheren Wert erreicht (Abb.  7). Dieser Effekt kann durch eine stärkere RFU des roten (unmethyliert bei ELOVL2) im Vergleich zum gelben, und des blauen (methyliert bei PDE4C und EDARADD) im Vergleich zum grünen Farbkanal begründet sein.
Im Vergleich zum 1. RV war bei der Minisequenzierung insgesamt eine geringere Variabilität bei allen Markern festzustellen. Neben dem Erfahrungsgewinn aus dem 1. RV könnte dies v. a. an der Verwendung der gleichen Reagenzien liegen. Bei der Pyrosequenzierung wiesen die Schwankungen keine solche Veränderung auf, was auch daran liegen könnte, dass die Labore, die die Pyrosequenzierung nutzen, bereits im 1. RV identische Reagenzien für die PCR verwendet haben.
Eine Normalisierung der gemessenen DNAm-Werte war mit der gewählten Kontroll-DNA nicht möglich, da die verwendeten DNAm-Kontrollstandards nicht über die gesamte DNA den von der Firma angegebenen Werten (0 und 100 % methyliert) entsprachen. Es sollte getestet werden, ob die Normalisierung auf den Wert eines Labors zu demselben Abweichungsquotienten führt. Dies war jedoch nicht möglich, und eine systematische Verschiebung um den gleichen DNAm-Wert zwischen den Laboren war ebenfalls nicht nachzuweisen, da die Abweichung zwischen gegebener und gemessener DNAm zwischen 0 und 100 % nicht gleich war. Ein Normalisierungsfaktor konnte daher nicht ermittelt werden. Das Gleiche zeigte sich für die Ergebnisse der Pyrosequenzierung, sodass auch hier keine Normalisierung zwischen den Laboren möglich war. Jedoch muss berücksichtigt werden, dass generell mit technischen Schwankungen zu rechnen und der beobachtete Unterschied z. T. auch innerhalb eines Labors bei der Untersuchung vieler Replikate aufgetreten ist. Jedes Labor muss daher auch die Spannbreite der eigenen technischen Replikate kennen. Der Einfluss der Schwankungen auf die Altersschätzung ist letztlich auch vom verwendeten Vorhersagemodell und den Markern abhängig. Geringe Unterschiede (wie z. B. in KLF14) können bei der Berechnung des Alters eine größere Bedeutung haben, wenn die Zunahme der DNAm mit dem Alter sehr gering ist.

Fazit

  • Der Ringversuch (RV) verdeutlichte eine gute Integration der DNA-Methylierung(DNAm)-Analyse mithilfe der Bisulfitkonvertierung und der Sequenzierung auf Basis der Mini- oder der Pyrosequenzierung.
  • Die Teilnahme mithilfe der Pyrosequenzierung war auf Labore beschränkt, die selbst ein Gerät oder Zugang zu einem Gerät haben, da der Pyrosequenzer kein Standardgerät in forensischen Laboren ist. Daher wurden insgesamt mehr Daten für die Minisequenzierung erhalten.
  • Bei der Bisulfitkonvertierung zeigten die Ergebnisse im Einklang mit dem 1. RV, dass die Implementierung und Bearbeitung laut Protokoll gut möglich waren. Dies war auch generell bei der Polymerase-Kettenreaktion (PCR) und Sequenzierung der Fall.
  • Bei der Minisequenzierung muss bezüglich der Kapillarelektrophorese eine Anpassung im Labor durchgeführt werden, um die optimale Signalstärke zu erhalten. Es fanden sich bei der Minisequenzierung z. T. stärkere Schwankungen als in der Pyrosequenzierung, wobei dies in Teilen auf die Verwendung eines anderes Gerätetyps zurückzuführen sein könnte (Genetic Analyzer 3130 vs. 3500).
  • Die Teilnehmerzahl von insgesamt 14 Laboren und erfolgreiche Ergebnisse aus 12 Laboren (8-mal Minisequenzierung, 6‑mal Pyrosequenzierung) sind für einen RV gut, jedoch lassen sich Ausreißer und wiederkehrende Schwankungen nur schwer beurteilen, da hierfür mehr Proben, Replikate und in jedem Labor Optimierungen für das Gerät nötig sind (z. B. Injektionszeit). Dies war im Rahmen dieses RV jedoch noch nicht möglich.
  • Die Ergebnisse des RV bestätigen jedoch die Wichtigkeit von laborübergreifenden RV und die Notwendigkeit weiterer RV zur Etablierung und zur Optimierung der Altersschätzung auf Basis der DNA-Methylierung für die forensische Arbeit.

Mitglieder der Arbeitsgemeinschaft Molekulare Altersschätzung der Deutschen Gesellschaft für Rechtsmedizin (DGRM) (alphabetisch)

Christa Augustin (Institut für Rechtsmedizin im Universitätsklinikum Hamburg-Eppendorf, Hamburg); Julia Becker (Institut für Rechtsmedizin des Universitätsklinikums Düsseldorf); Petra Böhme (Institut für Rechtsmedizin des Universitätsklinikums Düsseldorf); Jan Fleckhaus (Institut für Rechtsmedizin, Medizinische Fakultät, Universitätsklinikum Köln); Melanie Grabmüller (Institut für Rechtsmedizin, Universitätsklinikum Bonn); Cordula Haas (Institut für Rechtsmedizin, Forensische Genetik, Universität Zürich); Frank Heidorn (Institut für Rechtsmedizin der Justus-Liebig-Universität Gießen); Galina Kulstein (Bundeskriminalamt, Wiesbaden); Jana Naue (Institut für Rechtsmedizin, Universitätsklinikum Freiburg, Medizinische Fakultät, Albert-Ludwigs-Universität Freiburg); Jacqueline Neubauer (Institut für Rechtsmedizin, Forensische Genetik, Universität Zürich); Manuel Pfeifer (Institut für Rechtsmedizin der Medizinischen Fakultät, Technische Universität Dresden, Institut für Rechtsmedizin des Universitätsklinikums Essen); Peter M. Schneider (Institut für Rechtsmedizin, Medizinische Fakultät, Universitätsklinikum Köln); Marielle Vennemann (Institut für Rechtsmedizin, Universität Münster)

Danksagung

Ein Dankeschön geht an Wolfgang Wagner (Universität Aachen), Christian Gehrig (Universität Lausanne), Stefanie Ritz-Timme (Universität Düsseldorf), Kristina Schwender (Universität München) sowie Angelika Minawi und Martina Unterländer (beide BKA) für die Unterstützung des Ringversuches und Kommentierung des Manuskriptes. Vielen Dank auch an Qiagen für einen Rabatt auf Reagenzien der Firma für alle Teilnehmer. Qiagen hatte keinen Einfluss auf Design, Durchführung oder Analyse der Ergebnisse. Y. H. wird durch die Deutsche Forschungsgesellschaft innerhalb des Projektes „Human Epigenetics and Bioinformatics for Forensic Age Estimation“ (RI 704/4‑1, WA 1706/8-1) finanziert.

Einhaltung ethischer Richtlinien

Interessenkonflikt

Y. Han arbeitet bei Cygenia GmbH, die einen Service für die Analyse von epigenetischen Alterssignaturen für andere Forscher anbietet. J. Naue, M. Pfeifer, C. Augustin, J. Becker, J. Fleckhaus, M. Grabmüller, F. Heidorn, O. Hollaender, R. Klein-Unseld, G. Kulstein, J. Lichtenwald, J. Neubauer, P. Suarez, C. Haas, P.M. Schneider, M. Vennemann und P. Böhme geben an, dass kein Interessenkonflikt besteht.
Die Probenerhebung sowie die Analyse der molekularen Marker wurden mit Zustimmung der zuständigen Ethik-Kommission, im Einklang mit nationalem Recht sowie gemäß der Deklaration von Helsinki von 1975 (in der aktuellen, überarbeiteten Fassung) durchgeführt.
Open Access Dieser Artikel wird unter der Creative Commons Namensnennung 4.0 International Lizenz veröffentlicht, welche die Nutzung, Vervielfältigung, Bearbeitung, Verbreitung und Wiedergabe in jeglichem Medium und Format erlaubt, sofern Sie den/die ursprünglichen Autor(en) und die Quelle ordnungsgemäß nennen, einen Link zur Creative Commons Lizenz beifügen und angeben, ob Änderungen vorgenommen wurden.
Die in diesem Artikel enthaltenen Bilder und sonstiges Drittmaterial unterliegen ebenfalls der genannten Creative Commons Lizenz, sofern sich aus der Abbildungslegende nichts anderes ergibt. Sofern das betreffende Material nicht unter der genannten Creative Commons Lizenz steht und die betreffende Handlung nicht nach gesetzlichen Vorschriften erlaubt ist, ist für die oben aufgeführten Weiterverwendungen des Materials die Einwilligung des jeweiligen Rechteinhabers einzuholen.
Weitere Details zur Lizenz entnehmen Sie bitte der Lizenzinformation auf http://​creativecommons.​org/​licenses/​by/​4.​0/​deed.​de.

Unsere Produktempfehlungen

Rechtsmedizin

Print-Titel

• Einzige deutschsprachige Zeitschrift für Rechtsmediziner

• Ausgewählte Übersichtsbeiträge zu aktuellen Themenschwerpunkten

e.Med Interdisziplinär

Kombi-Abonnement

Für Ihren Erfolg in Klinik und Praxis - Die beste Hilfe in Ihrem Arbeitsalltag als Mediziner

Mit e.Med Interdisziplinär erhalten Sie Zugang zu allen CME-Fortbildungen und Fachzeitschriften auf SpringerMedizin.de.

Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 3/2021

Rechtsmedizin 3/2021 Zur Ausgabe

Neu im Fachgebiet Rechtsmedizin

18.05.2021 | Originalien | Ausgabe 3/2021 Open Access

Nutzung von Altersinformationen aus posttranslationalen Proteinmodifikationen und DNA-Methylierung zur postmortalen Lebensaltersschätzung

Konzept und Ergebnisse einer Pilotstudie

07.05.2021 | Originalien | Ausgabe 3/2021 Open Access

Forensische DNA-Methylierungsanalyse

Erster, technischer Ringversuch der Arbeitsgruppe „Molekulare Altersschätzung“ der Deutschen Gesellschaft für Rechtsmedizin

05.05.2021 | Originalien | Ausgabe 3/2021 Open Access

Forensische DNA-Methylierungsanalyse

Zweiter, technischer Ringversuch der Arbeitsgruppe „Molekulare Altersschätzung“ der Deutschen Gesellschaft für Rechtsmedizin