Introduction
Endothelins (EDNs) are widely expressed cytokines in a variety of human tissues, including brain, skeletal muscle, pancreas, small intestine, testis and colon [
1]. They constitute a family of small, vasoactive, 21-amino acid peptides referred to as EDN1, EDN2 and EDN3 [
2]. EDNs are synthesised as large precursor proteins that are post-translationally cleaved to the biologically active 21-amino acid form [
3]. They are involved in fundamental cellular networks like cell proliferation, migration and differentiation processes [
4,
5] by interacting with their corresponding cell surface-bound EDN-A (EDNRA) and EDN-B (EDNRB) receptors in an autocrine and also a paracrine manner [
6‐
8]. A balanced regulation of this EDNRA/EDNRB interplay – also referred to as the endothelin axis (ET-axis)- is essential for, for example, homing processes to tissue destinations, where cells differentiate into numerous lineages such as the peripheral nervous system, structural and connective tissue components, cardiac cells or pigment-producing melanocytes [
9].
There is now compelling evidence that imbalanced regulation of the ET-axis is implicated in human carcinogenesis, tumour progression and neo-angiogenesis [
8,
10‐
12]. During malignant cell transformation, the basic tissue architecture, which is maintained by basement membrane delineation, becomes disrupted [
8]. This indicates the presence of crucial mediators that trigger the exchange of growth factors between the participating cells at the tumour invasion field. Essentially, such growth factor release is thought to enhance invasiveness, stimulate cell migration and promote neo-vascularisation [
8]. Multiple signal transduction pathways are affected downstream from EDNRA/B. In the case of interaction of EDNs with EDNRA, a pertussis toxin-insensitive G protein becomes activated and promotes stimulation of phospholipase C, resulting in the transactivation of the mitogen-activated protein kinase pathway [
13]. Second, EDN1 and EDN2 binding to EDNRA can activate p125 focal adhesion kinase and paxillin, both of which have been associated with increased tumour cell invasion. Moreover, EDNs are able to transduce the activation of anti-apoptotic signals through phosphatidylinositol-3-kinase and to stimulate neo-angiogenesis through vascular endothelial growth factor signalling [
14]. These multiple ET-axis pathway implications may explain its various impairments of normal cellular integrity in case of an aberrant shift from balanced to imbalanced EDN signalling.
Previously, EDN1 and EDN2 were found to be commonly overexpressed in a broad range of human tumour entities [
8,
11,
12]. So far, most reports have focused on the role of EDN1 binding to EDNRA and its effects on tumour growth and neo-angiogenesis [
8,
11,
13,
15]. A role similar to that of EDN1 has been described for EDN2 in human breast cancer. Increased expression of EDN1 and EDN2, but not of EDN3, induced chemotaxis of breast cancer cells and increased tumour cell invasion through the basement membrane [
4], although conflicting results have been reported by others [
16]. In line with this, previous reports described a compensatory effect of EDN3 by negatively modulating the effects transduced by EDN1 [
17] and demonstrated that downregulation of EDN3 is associated with upregulation of EDN1 in human tissues [
18].
However, a comprehensive analysis of EDN3 expression in normal and cancerous breast tissues and its potential implication in human breast cancer has not been published so far. In our study, we investigated for the first time EDN3 mRNA and protein expression in a large number of primary breast tissues and breast cell lines. Furthermore, we identified the molecular mechanism by which EDN3 expression is deregulated in breast carcinomas.
Materials and methods
Cryo-conserved clinical patient material
Cryo-conserved clinical samples were obtained from breast cancer patients treated by primary surgery at the University Hospitals of Aachen, Düsseldorf and Regensburg. Patients receiving neo-adjuvant chemotherapy and patients with recurrent breast cancer were excluded. Resected tissue was snap-frozen in liquid nitrogen immediately after surgery. Only samples containing more than 70% of tumourous cells in haematoxylin/eosin-stained control sections were further processed (n = 128). For 17 samples, macroscopically normal breast tissues containing at least 30% of epithelial cells were available. In all cases, two board-certified pathologists agreed on the diagnosis of breast cancer. Tumour histology was determined according to the criteria of the World Health Organization (2003), whereas disease stage was assessed according to the UICC (Union Internationale contre le Cancer) [
19]. Tumours were graded according to Bloom and Richardson, as modified by Elston and Ellis [
20]. All patients gave informed consent for retention and analysis of their tissue for research purposes, and the institutional review boards of the participating centres approved the study. For 98 patients, follow-up data were available with a median time of 63 months (range 1 to 124 months). Patient characteristics of this cohort are summarised in Table
1.
Table 1
Clinicopathological parameters of cryo-conserved breast cancer specimens (n = 128)
Clinicopathological factors | | |
Age at diagnosisb | | |
< 58 years | 64 | 50.0 |
≥ 58 years | 64 | 50.0 |
Tumour sizec | | |
pT1 | 44 | 34.4 |
pT2 | 55 | 43.0 |
pT3 | 6 | 4.7 |
pT4 | 11 | 8.6 |
pTx | 12 | 9.4 |
Lymph node statusc | | |
pN0 | 57 | 44.5 |
pN1–3 | 51 | 39.8 |
pNx | 20 | 15.6 |
Histological grade | | |
G1 | 10 | 7.8 |
G2 | 58 | 45.3 |
G3 | 49 | 38.3 |
NA | 11 | 8.6 |
Histological type | | |
Ductal | 103 | 80.5 |
Lobular | 15 | 11.7 |
Other | 6 | 4.7 |
NA | 4 | 3.1 |
Immunohistochemistry | | |
Oestrogen receptor | | |
Negative (IRSd ≤ 2) | 33 | 25.8 |
Positive (IRS > 2) | 85 | 66.4 |
NA | 10 | 7.8 |
Progesterone receptor | | |
Negative (IRSd ≤ 2) | 33 | 25.8 |
Positive (IRS > 2) | 85 | 66.4 |
NA | 10 | 7.8 |
A tissue microarray (TMA) was created as described previously by Bubendorf and colleagues [
21]. The formalin-fixed paraffin-embedded (FFPE) tissue sections were obtained from the archive of the Institute of Pathology, University of Regensburg, Germany. In all cases, two board-certified pathologists agreed on the diagnosis of breast cancer. Patients receiving neo-adjuvant chemotherapy and patients with recurrent breast cancer were excluded. All patients gave informed consent for retention and analysis of their tissues for research purposes, and the institutional review board of the participating centre approved the study. The TMA consisted of 150 primary tumours from malignant breast tissue and 44 normal breast specimens. Follow-up data were available for 146 patients with a median time of 77 months (range 1 to 148 months). Detailed tumour characteristics of this cohort are listed in Table
2.
Table 2
Clinicopathological parameters of formalin-fixed paraffin-embedded breast cancer specimens (n = 150)
Clinicopathological factors | | |
Age at diagnosisb | | |
≤ 59 years | 83 | 55.3 |
> 59 years | 67 | 44.7 |
Tumour sizec | | |
pT1 | 48 | 32.0 |
pT2 | 71 | 47.3 |
pT3 | 9 | 6.0 |
pT4 | 20 | 13.3 |
pTx | 2 | 1.3 |
Lymph node statusc | | |
pN0 | 67 | 44.7 |
pN1 | 35 | 23.3 |
pN2 | 25 | 16.7 |
pN3 | 20 | 13.3 |
pNx | 3 | 2.0 |
Histological grade | | |
G1 | 13 | 8.7 |
G2 | 70 | 46.7 |
G3 | 66 | 44.0 |
NA | 1 | 0.7 |
Histological type | | |
Ductal | 122 | 81.3 |
Lobular | 12 | 18.0 |
Other | 16 | 10.7 |
Tumour focality | | |
Unifocal | 130 | 86.7 |
Multifocal | 19 | 12.7 |
NA | 1 | 0.7 |
Immunohistochemistry | | |
Oestrogen receptor | | |
Negative (IRSd ≤ 2) | 38 | 25.3 |
Positive (IRS > 2) | 83 | 55.3 |
NA | 29 | 19.3 |
Progesterone receptor | | |
Negative (IRSd ≤ 2) | 85 | 56.7 |
Positive (IRS > 2) | 40 | 26.7 |
NA | 25 | 16.7 |
Her2 status | | |
Negative (DAKO score 0; 1+) | 105 | 70.0 |
Positive (DAKO score 2+; 3+) | 23 | 15.3 |
NA | 22 | 14.7 |
Breast cell lines
The non-cancerous breast cell lines MCF10A and MCF12A as well as the cancerous breast cell lines MCF7, SKBR3, MDA-MB231 and BT20 were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured as recommended by the vendor.
Northern blot expression analysis
Expression of EDN3 mRNA in various human tissues was tested using the commercial multiple-tissue Northern (MTN) blots I and II (Clontech, Heidelberg, Germany), containing 2 μg of poly A+ RNA per lane from 16 different human tissues (that is, blot I: heart, whole brain, placenta, lung, liver, skeletal muscle, kidney and pancreas; blot II: spleen, thymus, prostate, testis, ovary, small intestine, colon [no mucosa] and peripheral blood lymphocytes). Hybridisation was performed using 25 ng of an EDN3-specific 722-base pair (bp) polymerase chain reaction (PCR) product derived from (GenBank accession number NM_000114.2) (position: 968 to 1,707), which was verified by sequence analysis. 32P-labelling of the DNA probe was achieved using the Megaprime DNA Labeling System (Amersham Biosciences, now part of GE Healthcare, Little Chalfont, Buckinghamshire, UK), and hybridisation was performed in accordance with the recommendation the manufacturer. The cancer profiling array (CPA) I (Clontech) is a matched tumour/normal expression array consisting of cDNA synthesised from 50 breast carcinomas, 50 normal breast tissues and 3 breast cancer lymph node metastasis specimens. Hybridisation was performed in accordance with the recommendations the manufacturer as described above for the MTN blots. Hybridisation signals of both, MTN blots and the CPA, were evaluated by use of a STORM-860 phosphoimager (Molecular Dynamics, now part of GE Healthcare). Intensity ratios were calculated after normalising signals against the background.
Frozen tissue samples and cell line pellets were dissolved in lysis buffer for subsequent DNA isolation using the QIAmp DNA Mini kit (Qiagen, Hilden, Germany) or for total RNA isolation by using TRIzol reagent (Invitrogen Corporation, Carlsbad, CA, USA) in accordance with the protocol supplied by the manufacturers.
Reverse transcription of RNA
Of the extracted total RNA, 1 μg was reverse-transcribed using the Reverse Transcription System (Promega Corporation, Madison, WI, USA) by applying a mix of oligo-dT and pdN
(6)-hexamer primers (1:2). The obtained cDNA was diluted (20 ng/μL) and test-amplified using intron-spanning primers for glyceraldehyde-3-phosphate-dehydrogenase (
GAPDH). Primer sequences are provided in Table
3. PCRs were initiated as 'Hot Start' PCR at 95°C for 5 minutes and a hold at 80°C before the addition of 1 unit of Go
Taq DNA polymerase (Promega Corporation). Cycle conditions were 95°C for 5 minutes, 35 cycles of 95°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute and a final extension at 72°C for 10 minutes. PCR analyses were carried out in a PTC-200 cycler (Bio-Rad Laboratories, Inc., formerly MJ Research, Hercules, CA, USA). Amplificates were evaluated under ultraviolet light after 2% agarose gel electrophoresis containing ethidium bromide. Only samples yielding a specific 510-bp amplificate were further subjected to real-time PCR.
Table 3
Oligonucleotide primers used in this study
RT-PCR | | | | |
GAPDH | | | | |
| Forward: TGGTCACCAGGGCTGCTT | 60 | 35 | 510 |
| Reverse: GTCTTCTGGGTGGCAGTGAT | | | |
Real-time PCR | | | | |
GAPDH | | | | |
| Forward: GAAGGTGAAGGTCGGAGTCA | 58 | 40 | 108 |
| Reverse: TGGACTCCACGACGTACTCA | | | |
EDN1 | | | | |
| Forward: GCTCGTCCCTGATGGATAAA | 58 | 40 | 216 |
| Reverse: TTCCTGCTTGGCAAAAATTC | | | |
EDN2 | | | | |
| Forward: TTGGACATCATCTGGGTGAA | 58 | 40 | 229 |
| Reverse: CTGTAGTGGCCCCTGTCTTG | | | |
EDN3 | | | | |
| Forward: ATTGCCACCTGGACATCATT | 58 | 40 | 179 |
| Reverse: GCAGGCCTTGTCATATCTCC | | | |
Methylation-specific PCR | | | | |
EDN3-U | | | | |
| Forward: TTTGGGAGGTGATTTTTAGTGTGTTT | 60 | 35 | 144 |
| Reverse: ACCCATCCCTACACAAAACTAACCA | | | |
EDN3-M | | | | |
| Forward: TGGGAGGCGATTTTTAGTGCGTTC | 60 | 35 | 140 |
| Reverse: CCATCCCTACGCGAAACTAACCG | | | |
Semi-quantitative real-time polymerase chain reaction
The Roche LightCycler system was used for semi-quantitative light cycler analysis in combination with the LightCycler DNA Master SYBR Green I Kit (Roche, Mannheim, Germany) as previously described [
22]. Gene expression was quantified by the comparative cycle threshold (C
T) method, normalising C
T values to the housekeeping gene
GAPDH and calculating relative expression values [
23]. A commercially available normal breast cDNA pool (Clontech) was used as a breast reference standard. Primer sequences are listed in Table
3.
Immunohistochemistry
Paraffin sections of 2 μm were deparaffinised in xylene followed by rehydration in a decreasing ethanol series. Antigen retrieval was performed by pre-treatment in boiling citrate buffer (pH 6.0) in a microwave oven for 30 minutes (200 W). Immunohistochemistry (IHC) was performed using an NEXES Immuno Stainer (Ventana Medical Systems, Inc., Tucson, AZ, USA) in accordance with the specifications of the manufacturer. A goat polyclonal EDN3-specific antibody (sc-21628; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) was used in a 1:150 dilution by using the ChemMate Envision Kit (DAKO, Hamburg, Germany). Counterstaining was performed by using Mayer's haematoxylin. The incubation with primary antibodies was omitted in negative controls. All analysed samples were stained without the knowledge of histopathological data. Cytoplasmic protein staining was semi-quantitatively scored by an experienced breast pathologist according to the well-established scoring system developed by Remmele and Stegner [
24]. To verify staining specificity, the primary antibody was incubated with a 200 molar excess of blocking peptide (sc-21628 P; Santa Cruz Biotechnology, Inc.) for 2 hours prior to its application on test samples.
CpG island prediction
EDN1,
EDN2 and
EDN3 genomic nucleotide sequences were taken from the Ensembl database and analysed for promoter CpG (cytosine-phosphate-guanine dinucleotide) islands in accordance with the method of Li and Dahiya [
25]. A fragment of 2 kb in size, beginning 1 kb 5'-upstream from the annotated transcription start site (TSS) and ending 1 kb 3'-downstream, was analysed by applying the following criteria: island size of greater than 200 bp, guanine/cytosine content of greater than 60% and observed/expected CpG ratio of greater than 0.6.
Bisulphite modification and methylation-specific polymerase chain reaction
Of the genomic DNA, 1 μg was bisulphite-modified using the EZ DNA Methylation Kit (Zymo Research Corporation, Orange, CA, USA) and eluted in 20 μL of Tris buffer (10 mM). Methylation-specific PCR (MSP) was performed in accordance with the method of Herman and colleagues [
26]. One microlitre of bisulphite-treated DNA was amplified using MSP primers that specifically recognise either the unmethylated or methylated
EDN3 promoter sequence after bisulphite conversion (Table
3). To achieve high accuracy, each primer was designed to cover three CpG sites of template DNA. Commercially available universal poly-methylated DNA and unmethylated DNA (EpiTect Control DNA; Qiagen) were used as positive controls for methylated and unmethylated
EDN3 sequences, respectively. MSP products were visualised under ultraviolet light after 3% low-range ultra agarose gel electrophoresis containing ethidium bromide (Bio-Rad Laboratories, Inc.). Promoter methylation status was interpreted in a binary qualitative fashion.
In vitrodemethylating treatment
Cells were seeded at a density of 3 × 104 cells/cm2 in a six-well plate. The demethylation agent 5-aza-2'-deoxycytidine (DAC) (Sigma-Aldrich, Deisenheim, Germany) was added to a final concentration of 1 μM in fresh medium at days 1, 2 and 3 after seeding. Additionally, cells were exposed to 300 nM trichostatin A (TSA) (Sigma-Aldrich) on day 3 for 24 hours. Control cells without DAC/TSA were supplied with fresh medium on days 1, 2 and 3. DNA and RNA were extracted on day 4 as mentioned above.
Statistical evaluations
SPSS version 14.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. All tests were performed two-tailed, and P values of below 0.05 were considered statistically significant. The non-parametric Mann-Whitney U test and the Student t test (paired and unpaired) were used to compare expression results between cancer tissues and normal tissues or between EDN3 mRNA expression and EDN3 methylation status. Contingency table analysis and Fisher exact tests were used to study the statistical association between clinicopathological factors and EDN3 protein expression or EDN3 promoter methylation status. Survival curves comparing patients with or without any of the factors were calculated using the Kaplan-Meier method, with significance evaluated by log-rank statistics. Breast cancer-specific survival (CSS) was measured from the day of surgery until tumour-related death and was censored for patients alive at last contact or in case of death unrelated to the tumour. Disease-free survival (DFS) was measured from surgery until disease relapse and censored for patients alive without evidence of relapse at the last follow-up. For EDN3 protein expression, a multivariate Cox proportional hazard model was employed to assess the relative risks on patient CSS and to test for independent prognostic relevance of clinical/investigational factors. Only patients for whom the status of all selected variables was known were included in the proportional hazard model (n = 121). The limit for reverse-selection procedures was P = 0.2. The proportionality assumption for all variables was assessed with log-negative-log survival distribution functions. For analyses, the following variables were categorised into binary values: small-sized (pT1) versus large-sized (pT2 to pT4), node-negative (pN0) versus node-positive (pN1 to pN3) and low-grade (G1 and G2) versus high-grade (G3) tumours.
Discussion
The involvement of EDNs in tumourigenesis has been described in several reports [
4,
10,
15]. In contrast to the potentially oncogenic role of EDN1 and EDN2, there is still little knowledge about the role of EDN3 in cancer initiation or progression. A recent study demonstrated abundant expression of EDN1 and EDN2 but complete absence of EDN3 expression in a representative set of human breast cancer cell lines [
12]. Because we have previously found that
EDN3 mRNA expression is downregulated in primary breast carcinomas as compared with normal breast tissues [
27,
28], we aimed in this report to provide the first comprehensive analysis of EDN3 expression and its potential implication in human breast cancer.
Initially, we screened various non-malignant epithelial tissues for
EDN3 mRNA expression and also analysed its expression using a breast cancer cDNA dot blot array. Besides abundant expression in several human tissues,
EDN3 was strongly expressed in normal breast samples, providing evidence for a functional role in epithelial tissues such as the mammary gland. In contrast, most matched breast carcinomas showed diminished EDN3 mRNA expression both on the cDNA dot blot array and by real-time PCR analysis. This finding supports the current evidence that EDN3 may exert a functional role divergent to that of EDN1/EDN2 in the human mammary gland [
18]. A further TMA analysis revealed that EDN3 protein is abundantly expressed in normal breast whereas its expression is reduced in a large fraction of breast carcinomas. Frequency differences may arise due to the use of different techniques (real-time PCR versus IHC) on separate tumour cohorts (fresh frozen versus FFPE) and accomplishing different scoring systems. Loss of EDN3 protein expression was not associated with relevant clinicopathological factors. For instance, it occurred with almost equal frequency among all tumour sizes (pT1 to pT4), suggesting that it may be an early event in the development of infiltrating breast carcinoma. Since EDN3 is thought to counterbalance the effects mediated by EDN1 and EDN2 [
4,
18], we propose that loss of EDN3 expression could actively enhance overexpression of the ET-axis. Recently, upregulation of ET-axis members was found to be associated with higher histological grade, lymph node metastasis and lymphovascular invasion in breast cancer [
5] and also with advanced tumour progression in ovarian cancer [
32], prostate cancer [
33], Ewing sarcoma and neuroblastoma [
11]. A systematic expression analysis on larger breast carcinoma cohorts and metastatic deposits is now required, including all three EDNs and EDNRA/EDNRB. This will unravel in detail the inter-relationship between EDN3 expression loss and upregulation of EDN1/2 and EDNRA/B as well as its association with breast tumour progression. In our study, loss of EDN3 expression was associated with adverse patient outcome. So far, overexpressions of EDN1 and EDNRA were already reported as being associated with impaired survival in breast cancer [
5,
34]. Our findings support the view that an imbalanced ET-axis is of pivotal relevance in breast cancer biology and that EDN3, unlike other members of the ET-axis, may represent a novel tumour suppressor gene in the human mammary gland.
Addressing the molecular cause by which EDN3 expression becomes abrogated, we found that the
EDN3 gene promoter, unlike
EDN1 and
EDN2, contains a CpG island as a potential substrate to aberrant hypermethylation and consequently gene inactivation. Indeed, we detected
EDN3 promoter methylation in cancerous breast cell lines in functional association with loss of
EDN3 mRNA expression. Moreover, a hypermethylated
EDN3 promoter was also detected in 70% of breast carcinoma specimens in significant association with loss of
EDN3 expression. We therefore conclude that aberrant
EDN3 methylation is a tumour-specific event and the predominant mechanism leading to EDN3 expression loss in breast cancer. However, it remains elusive why patient survival was not associated with
EDN3 methylation as it was with loss of EDN3 protein expression. In fact, only very few studies detected such outcome association on both molecular levels (for example, for SFRP1 [
22,
35] or ITIH5 [
36]), probably due to considerable sensitivity differences of the available detection techniques as well as further genetic or epigenetic alterations contributing to the loss of a gene's expression. Interestingly,
EDNRB was previously described to be methylated in numerous tumour entities, such as lung, colon, prostate, bladder, kidney, liver, oesophageal, nasopharyngeal cancer and leukemia [
37‐
45], but to the authors' knowledge, never in gynaecological tumours. So far, there has been no evidence that
EDNRB becomes methylated in breast carcinomas since a previous study demonstrated strong EDNRB expression in all invasive ductal carcinoma samples and in all analysed cancerous breast cell lines [
4]. Notably, an ET-axis expression pattern similar to that of breast cancer was recently found in cervical cancer; that is, upregulation of EDN1, EDN2, EDNRA and EDNRB expression was accompanied by downregulation of EDN3 expression in cancerous cervix as compared with normal cervical epithelium [
46]. This suggests that a decrease of EDN3 expression accompanied by an increase of EDNRB expression may be a particular feature of gynaecological tumour entities.
Since the ET-axis represents crucial decisive elements for the direction of tumour growth, invasion and neo-angiogenesis, it provides a promising intervention point for molecular targeted therapies. EDNR antagonists have been proven as potent and specific ET-axis inhibitors that block cellular pathways implicated in tumour growth. The drug bosentan, which targets both EDNRA and EDNRB, inhibits tumour growth, vascularisation and bone metastasis in breast cancer [
47]. Atrasenatan, targeting EDNRA, is capable of inhibiting proliferation and cancer growth-promoting processes [
48,
49]. In addition, blockers of EDNRA resensitised cancer cells to paclitaxel-induced apoptosis, as observed in ovarian, prostatic, cervical and nasopharyngeal cancer cell lines [
49‐
51] as well as in primary ovarian and breast cancer [
5,
52]. Our study adds a novel aspect to therapeutically targeting the ET-axis in breast cancer. Since the epigenetic lock of the
EDN3 gene is potentially reversible by DNA methyltransferase (DNMT) or histone acetyltransferase (HDAC) inhibitors or both, these drug classes may provide a future option in a combined treatment consisting of a decrease in EDN1/2 signalling by blocking EDNRs together with the reactivation of EDN3 expression by DNMT and HDAC inhibitors. Apparently, molecular rebalancing of the ET-axis in cancerous cells may be most efficiently achieved by targeting all deregulated axis molecules.
Acknowledgements
The excellent technical assistance from Sonja von Serényi, Sevim Alkaya and Inge Losen is greatly appreciated. We thank Dieter Niederacher (Heinrich-Heine University, Düsseldorf, Germany) and Matthias Dürst (Friedrich-Schiller University, Jena, Germany) for kindly providing patient samples. We thank Monika Klinkhammer-Schalke and Felicitas Horn (Tumour Registry, Regensburg, Germany) for continuous help in obtaining clinical patient information and follow-up data. Immunohistochemical scoring was kindly performed by Nuran Bektas (Institute of Pathology, University Hospital of the RWTH, Aachen, Germany). HMEC DNA was a generous gift by Bernhard Lüscher (Institute of Biochemistry, University Hospital of the RWTH, Aachen, Germany). This work is a research project within the German Human Genome Project and was supported by a grant from the Bundesministerium für Bildung und Forschung (BMBF) to ED (01KW040-1).
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
FW participated in the conception and design of the study and carried out the gene expression analyses, immunohistochemical studies and methylation experiments. JV performed statistical evaluations, participated in data interpretation and wrote the manuscript. OG provided expertise in DNA methylation analysis and critically revised the manuscript. AH provided clinical samples and clinicopathological data, performed data interpretation and critically revised the manuscript. ME participated in data interpretation and critically revised the manuscript. RK participated in the design and coordination of the study and critically revised the manuscript. ED planned and coordinated the study and critically revised the manuscript. All authors read and approved the final manuscript.