Skip to main content
Erschienen in: BMC Infectious Diseases 1/2017

Open Access 01.12.2017 | Research article

G allele at −924 A > G position of FoxP3 gene promoter as a risk factor for tuberculosis

verfasst von: Elham Beiranvand, Saeid Abediankenari, Soghra Khani, Hamideh Mahmoodzadeh Hosseini, Sirous Zeinali, Behnoush Beiranvand, Mehdi Goudarzi, Sima Sadat Seyedjavadi

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2017

Abstract

Background

Forkhead box protein 3 (FoxP3) is an important factor for development and function of Regulatory T cells (Treg). Studies have found an association between common gene polymorphisms in FoxP3 and some infectious diseases. The aim of this study was to evaluate possible associations between two Single nucleotide polymorphisms (SNPs) in the promoter of the FoxP3 gene to susceptibility to tuberculosis (TB) and the alteration of Foxp3 gene expression.

Methods

The pattern distribution of genotype at two position, −3279 A > C (rs3761548) and −924 A > G (rs2232365) on the promoter of FoxP3 gene was evaluated using polymerase chain reaction-single specific primer (PCR-SSP) method in 183 tuberculosis patients and 183 healthy control. In addition the quantity of FoxP3 gene expression at mRNA level was identified by the real-time PCR.

Results

The frequency of G allele at −924 A > G was significantly higher was higher in TB patients (59.5%) than control group (39.5%) (P ≤ 0.05). In addition, our data viewed approximately 5- folds more FoxP3 gene expression in female patients with GG genotype in comparison to female healthy cases with the same genotype (P ≤ 0.001). There was no statistically significant differences between the distribution pattern of −3279 A > C polymorphism in patients and healthy individuals along with it effect on the FoxP3 gene expression among both groups (P > 0.05).

Conclusions

Our outcome suggests that the −924 A > G polymorphism leads to enhance FoxP3 gene expression and susceptibility to tuberculosis in the sex dependent manner. This event may rise the count of Treg cells and modulate the immune response against tuberculosis.
Abkürzungen
CI
Confidence interval
CMI
Cell-mediated immunity
FoxP3
Forkhead box protein 3
M. tuberculosis
Mycobacterium tuberculosis
PCR-SSP
Polymerase chain reaction-single specific primer
SNPs
Single nucleotide polymorphisms
TB
Tuberculosis
TGF-β
Transforming Growth Factors-β
Treg
Regulatory T cells
WHO
World Health Organization

Background

TB is a chronic infectious disease that remains a major global health problem, responsible for ill health among millions of people each year [1]. In 2013, there were an estimated 9 million new cases of TB that 1.5 million of them died and an estimated 1.1 million (13%) of the 9 million people who developed TB in 2013, were HIV-positive [2].
Mycobacterium tuberculosis (M. tuberculosis), which breaks the physical barriers of respiratory tract and reach the lung, are immediately phagocytized by alveolar macrophages and dendritic cells and it is the first event in the host-pathogen relationship. The immune response to M. tuberculosis is complex. Studies have shown that a wide variety of cell types, cell surface molecules and cytokines are involved in the regulation of the immune response to tuberculosis [3]. Cell-mediated immunity (CMI) has an important role in the protective response against M. tuberculosis [46]. Recently, it was identified that a subset of CD4 T cells expressing the transcription factor Foxp3, called Treg cells, play a critical role in the regulation of the immune response by secretion of anti-inflammatory cytokines such as IL-10 and Transforming Growth Factors-β (TGF-β) that decreased CD4 T cells and memory T cells activity [79]. Some studies have shown that Treg cells expressing FoxP3 are expanded in blood and disease sites in TB patients [7, 10]. Also some studies have shown that Treg cells have a key role in expansion of TB by suppression of effector T-cells [11, 12]. FoxP3 belongs to the family of transcription factors that play a role in various cellular processes and is essential factor for development and function of Treg cells [1315]. Previous studies have demonstrated that FoxP3 gene polymorphisms associated with human diseases such as malaria, hepatitis B-related hepatocellular carcinoma, autoimmune diseases, IPEX syndrome, preeclampsia, abortion and cancer [1623]. However, little information exists on the relationship between FoxP3 gene polymorphisms and expression with the susceptibility to infectious disease especially tuberculosis. According to what was said, we hypothesized two SNP in promoter of FoxP3 gene is related to an increase in FoxP3 gene expression and result in susceptibility to tuberculosis in our target population [24].

Methods

Study population

The current study was cross-sectional, case-control study, carrying out in the Mazandaran Health Center in north Iran. Total 183 HIV-free TB patients (including 99 males and 84 females; mean age 46.8 ± 20.4 years). In addition, 183 control subjects (112 males and 71 females; mean age 44.1 ± 23.1) without any clinical features and family history of TB were recruited to study matching based on age, gender, and ethnicity with TB cases. All TB patients were diagnosed according to the World Health Organization (WHO) criteria: hilar adenopathy on chest X-ray, an infiltrate, histological evidence of TB, positive smear and culture [3]. All participants were evaluated for HIV by serological tests, and HIV cases were excluded from study. The local ethics committee approved the study, and informed consent was obtained from all participants.

Sample collection, RNA and DNA extraction

Ten ml of heparinized Blood specimen was drawn from each patient and control case, separately. To isolate Peripheral mononuclear cells, blood samples were centrifuged using Ficoll–Hypaque gradient density and Their DNA was extracted utilizing DNA extraction kit (Roche, Germany) in accordance with the manufacturer’s instruction. The DNA samples were stored at -80̊C for further investigation. Furthermore, to obtain RNA from Peripheral mononuclear cells, RNA extraction kit (Fermentase, Italy) was utilized. Then, the quantity and quality of purified DNA and RNA were assessed by spectrophotometer (Picodrop, UK) and gel electrophoresis, respectively.

Polymorphism detection

In order to find desired SNPs, HapMap database (http://​www.​hapmap.​org) was used [25]. Two SNPs, rs3761548 and rs2232365 located in promoter regions of the FoxP3 gene were selected and their genotypes were assessed by the PCR-SSP method. PCR primer sequences for genotyping are outlined in Table 1. Human epidermal growth factor receptor [26] gene was used as an internal control. Briefly, PCR reaction in volume of 25 μl, we used, 50 ng DNA template, 200 μM of each dNTP (mixture of dATP, dTTP, dCTP, dGTP), 0.2 μM of each primer, 1.5 mM of MgCl2, 10 mM of Tris hydrochloride (pH 8.3), and 1 U of Taq DNA polymerase (Fermentas, Italy). Cycling conditions included an initial denaturation step of 94 °C for 4 min followed by 35 cycles of denaturation (94 °C for 30s), annealing (61 °C for 30s), and extension (72 °C for 40s), the last cycle also included a final extension step at 72 °C for 5 min. PCR products were separated on 1.5% agarose gel and visualized with ethidium bromide staining under an ultraviolet illuminator. To assess the reproducibility of the analysis about 10% of the samples were genotyped two times for each polymorphism and the results were 100% identical to the ones of the first genotyping attempt.
Table 1
Primers used for SNPs of FoxP3 gene
Position
Method
Primer Sequences
Allele Phenotypes
−3279 A > C (rs3761548)
 
Forward: CTGGCTCTCTCCCCAACTGA
Forward: TGGCTCTCTCCCCAACTGC
Common Reverse: ACAGAGCCCATCATCAGACTCTCTA
A: 334 bp
C: 333 bp
−924 A > G (rs2232365)
PCR-SSP
Forward: CCCAGCTCAAGAGACCCCA
Reverse: GGGCTAGTGAGGAGGCTATTGTAAC
Forward: CCAGCTCAAGAGACCCCG
Reverse: GCTATTGTAACAGTCCTGGCAAGTG
A: 442 bp
G: 427 bp
FoxP3 gene
qRT- PCR
Forward: CAGCTGCCCACACTGCCCCTAG
Reverse: CATTTGCCAGCAGTGGGTAG
 
GAPDH gene
Forward: CCAGGTGGTCTCCTCTGACTTCAACA
Reverse: AGGGTCTCTCTCTTCCTCTTGTGCTCT

FOX3 gene expression analysis

To identify the expression level of FOX3 gene, the quantitative real time PCR method was used based on the light cycler system (bio-rad, USA). The reagent quantity and thermal condition of qRT- PCR were as similar as our previous study [27]. Briefly, 1 μg of isolated RNA was applied for cDNA synthesis kit (Fermentas, Italy) containing oligo dT primers and M-MLV reverse transcriptase in accordance with instruction’s guidline. GAPDH was tested as the reference gene. The primers for both described genes were listed in Table 1. To amplify the FoxP3 gene, 0.5 μl of each cDNA was added to 20 μl master mixture solution including 2x cyber green solution and 0.5 μM of described primers. The PCR program was set up as an initial denaturation step of 4 min at 95 °C, 35 cycles of 20 s at 94 °C, 61 °C at 30 s as annealing tempreature for each gene and 20 s at 72 °C. The efficiency of all run was between 95% to 99%. The relative expression of FoxP3 gene mRNA was evaluated according to standard curve obtained from the specific target and housekeeping gene. Finally, Pfaffl method was applied for data analysis.

Statistical analysis

To study differences in the allele frequencies and genotype distribution between the groups. We used Fisher exact and x2 analysis tests. P-value of adjusted odds ratio calculated by logistic regression analysis with 95% confidence interval (CI). Accordance of genotype distribution with Hardy–Weinberg equilibrium was assessed by an exact test. Statistical power calculations were performed using Epi Info v. 6.02 (CDC Atlanta USA).

Results

Comparison of FoxP3 genotypes (−924 A > G, −3279 A > C) in both case and control groups

Here, PCR-SSP method was applied to identify the two SNP, rs3761548 and rs2232365, at promoter region of FoxP3 gene among 183 TB patients and 183 healthy subjects. Figure 1 depicts findings from gel electrophoresis of PCR products. Because the FoxP3 gene is localized in the small arm of the X-chromosome, data analyses were divided into female and male groups. Overall, in this case-control study, genotype distribution was in accordance with Hardy–Weinberg equilibrium. Furthermore, data revealed that allele G was significantly more prevalent in TB patients with compared to healthy group (OR = 0.43, 95% CI = 0.3 ± 0.61, P < 0.001). As outlined in Table 2, the prevalence of GG genotype was statistically higher in female patients than control group (OR = 0.35, 95% CI = 0.14 ± 0.85, P < 0.05). In addition, male patients had significantly higher G allele than control group (OR = 3.42, 95% CI = 2.17 ± 5.39, P < 0.01). However, there was no significant discrepant in the allele distribution at −3279 A > C between patients and control cases (P > 0.05).
Table 2
Genotypes and alleles frequencies of FoxP3 gene SNPs in the cases and controls in relation to susceptibility to TB
Position
Gender
(No)
Genotype/Allele
Controls (%)No
TB patient
No (%)
Odd Ratioa
(95% CI)
Pb
FoxP3
−3279 A > C
Female
AA
AC
CC
38 (53.2)
20 (28.1)
13 (18.3)
43 (51.1)
15 (17.8)
26 (30.9)
1:00 (Reference)c
0.56 (0.25 ± 1.2)
1.5 (0.67 ± 3.35)
0.1
Male
A
C
65 (58.03)
47 (41.9)
64 (64.6)
35 (35.3)
1:00 (Reference)
1.3 (0.75 ± 2.3)
0.3
Total
A
C
161 (63.3)
93 (36.6)
165 (61.7)
102 (38.2)
1:00 (Reference)
0.93 (0.65 ± 1.3)
0.7
FoxP3
−924 A > G
Female
AA
AG
GG
34 (47.8)
14 (19.7)
23 (32.3)
19 (22.6)
22 (26.19)
43 (51.1)
1:00 (Reference)
0.29 (0.14 ± 0.63)
0.35 (0.14 ± 0.85)
0.005
Male
A
G
73 (65.1)
39 (34.8)
48 (48.4)
51 (51.5)
1:00 (Reference)
3.42 (2.17 ± 5.39)
0.01
Total
A
G
155 (61)
99 (39)
108 (40.4)
159 (59.5)
1:00 (Reference)
0.43(0.3 ± 0.61)
0.00
aLogistic regression analyses were used for calculating odds ratios with 95% confidence interval
b P value was determined by x2 test (for genotype) or Fisher exact test (for alleles) from a 2 × 2 and 2 × 3 contingency table
cThe first allele or genotype is considered as reference

FoxP3 gene expression according to FoxP3 genotypes (−924 A > G, −3279 A > C)

Considering to discrepant frequency of alleles at −924 A > G in patients and control groups, we evaluated whether is there a relation between the genotype and the quantity of FoxP3 gene expression? As our previous observation, FoxP3 gene expression in tuberculosis patients was 2.8 fold higher than normal group (CI = 1.29 ± 2.37, P ≤ 0.001) [27]. Here, we observed statistically significant increase expression of FoxP3 gene in female group with GG genotype compared to control group with the same genotype (P ≤ 0.001). Moreover, among female population, the FoxP3 gene expression according to GG genotype was 2.28 folds and 1.79 fold more than the AA genotype (CI = 3.18 ± 0.84, P = 0.001) and AG genotypes (CI = 0.09 ± 2.87, P = 0.03), respectively (Fig. 2) However, there was higher FoxP3 gene expression among patients groups compared with healthy subjects but among male population, the differences between the presence of A or G allele and case and control groups was not significant (P > 0.05(.In addition, there were no statistically significant differences between FoxP3 gene expression and FoxP3–3279 A > C region in patients and control group (P > 0.05).

Discussion

According to our knowledge, our work was the first finding of the assessment polymorphisms A to G in the promoter of FoxP3 gene and its relation to susceptibility to tuberculosis. We observed that the presence of G allele in male and GG genotype in female patients with TB could be an effective marker increasing risk factor to emergence of TB. Several previous studies confirmed that Treg cells play critical roles in the development of TB and their number increases in peripheral blood and disease sites in patient [712].Since FoxP3 is the most specific molecular marker for naturally occurring Treg cells, therefore, many studies has been done on FoxP3 gene expression that some of them have shown increased FoxP3 gene expression in patients with TB [2729]. Our previous reports showed significant higher expression of FoxP3 gene in TB patients. The combination of data from the FoxP3 gene expression and SNP polymorphism provided the surprising finding. Here, our data viewed approximately 5- folds more FoxP3 gene expression in female patients with GG genotype in comparison to female healthy cases with the same genotype. Hence, the harboring G allele particularly genotype of GG among female at the position of 924 on the promoter of FoxP3 gene augments the risk of developing TB. So far, little information is available about FoxP3 gene polymorphism in tuberculosis, but two studies reported that FoxP3 gene polymorphism may be associated with hepatitis B-related and malaria [17, 19].
In summary, our outcome suggests that the −924 A > G polymorphism leads to enhance FoxP3 gene expression and susceptibility to tuberculosis in the sex dependent manner. This event may rise the count of Treg cells and modulate the immune response against tuberculosis.
Nevertheless, these findings still remain unclear and Larger-scale studies involving multiple centers are needed to elucidate further the role of FoxP3 gene polymorphism in tuberculosis. Also our study limitations include: a) In this study, only two SNPs of foxp3 gene were studied in patients and controls, but since there is still limited information about the relationship between foxp3 gene and tuberculosis, also with regard to the complexities observed in immune responses, it is recommended that other SNPs of this gene be investigated in patients who these studies are likely to help further clarify the interactions between the pathogen and the host. b) Some of the patients in Iran were infected with HIV but were excluded from our study. Therefore, it is suggested that in other studies, patients with TB and HIV co-infection should also be evaluated. c) In our study of the association between foxp3 gene polymorphisms in patients with active tuberculosis compared with control, it is suggested that this relationship be investigated in patients with latent tuberculosis infection.

Acknowledgements

The authors wish to thanks the patients and the employment of tooba clinical laboratory technicians of Mazandaran province who contributed to this study.

Funding

This study was supported by Mazandaran University of Medical Sciences, Sari, Iran (grant No.89–1298).

Availability of data and materials

The datasets generated and/or analyzed during the current study are not publicly available due to the respect and protection of privacy of the patients, but are available from the corresponding author on reasonable request.
The local ethics committee of Mazandaran University of Medical Sciences approved the study, and informed consent was obtained from all participants.
Not applicable.s

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Farzam B, Fooladi AAI, Izadi M, Hossaini HM, Feizabadi MM. Comparison of cyp141 and IS6110 for detection of Mycobacterium tuberculosis from clinical specimens by PCR. J Infect Public Health. 2015;8(1):32–6.CrossRefPubMed Farzam B, Fooladi AAI, Izadi M, Hossaini HM, Feizabadi MM. Comparison of cyp141 and IS6110 for detection of Mycobacterium tuberculosis from clinical specimens by PCR. J Infect Public Health. 2015;8(1):32–6.CrossRefPubMed
2.
Zurück zum Zitat Kaufmann SH, McMichael AJ. Annulling a dangerous liaison: vaccination strategies against AIDS and tuberculosis. Nat Med. 2005;11:S33–44.CrossRefPubMed Kaufmann SH, McMichael AJ. Annulling a dangerous liaison: vaccination strategies against AIDS and tuberculosis. Nat Med. 2005;11:S33–44.CrossRefPubMed
3.
Zurück zum Zitat WHO: Global tuberculosis report 2014. Geneva: WHO; 2014. See http://apps whoint/iris/bitstream/10665/137094/1/9789241564809_eng pdf 2014. WHO: Global tuberculosis report 2014. Geneva: WHO; 2014. See http://​apps whoint/iris/bitstream/10665/137094/1/9789241564809_eng pdf 2014.
4.
Zurück zum Zitat de Martino M, Galli L, Chiappini E. Reflections on the immunology of tuberculosis: will we ever unravel the skein? BMC Infect Dis. 2014;14(1):1.CrossRef de Martino M, Galli L, Chiappini E. Reflections on the immunology of tuberculosis: will we ever unravel the skein? BMC Infect Dis. 2014;14(1):1.CrossRef
5.
Zurück zum Zitat Larson RP, Shafiani S, Urdahl KB. Foxp3+ regulatory T cells in tuberculosis. In: The New Paradigm of Immunity to Tuberculosis. Adv Exp Med Biol. 2013;783:165–80.CrossRefPubMed Larson RP, Shafiani S, Urdahl KB. Foxp3+ regulatory T cells in tuberculosis. In: The New Paradigm of Immunity to Tuberculosis. Adv Exp Med Biol. 2013;783:165–80.CrossRefPubMed
6.
Zurück zum Zitat Raja A. Immunology of tuberculosis. Indian J Med Res. 2004;120(4):213–32.PubMed Raja A. Immunology of tuberculosis. Indian J Med Res. 2004;120(4):213–32.PubMed
7.
Zurück zum Zitat O'Garra A, Redford PS, McNab FW, Bloom CI, Wilkinson RJ, Berry MP. The immune response in tuberculosis. Annu Rev Immunol. 2013;31:475–527.CrossRefPubMed O'Garra A, Redford PS, McNab FW, Bloom CI, Wilkinson RJ, Berry MP. The immune response in tuberculosis. Annu Rev Immunol. 2013;31:475–527.CrossRefPubMed
8.
Zurück zum Zitat Scott-Browne JP, Shafiani S, Ishida-Tsubota K, Fontenot JD, Rudensky AY, Bevan MJ, Urdahl KB. Expansion and function of Foxp3-expressing T regulatory cells during tuberculosis. J Exp Med. 2007;204(9):2159–69.CrossRefPubMedPubMedCentral Scott-Browne JP, Shafiani S, Ishida-Tsubota K, Fontenot JD, Rudensky AY, Bevan MJ, Urdahl KB. Expansion and function of Foxp3-expressing T regulatory cells during tuberculosis. J Exp Med. 2007;204(9):2159–69.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Singh A, Dey AB, Mohan A, Sharma PK, Mitra DK. Foxp3+ regulatory T cells among tuberculosis patients: impact on prognosis and restoration of antigen specific IFN-γ producing T cells. PLoS One. 2012;7(9):e44728.CrossRefPubMedPubMedCentral Singh A, Dey AB, Mohan A, Sharma PK, Mitra DK. Foxp3+ regulatory T cells among tuberculosis patients: impact on prognosis and restoration of antigen specific IFN-γ producing T cells. PLoS One. 2012;7(9):e44728.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Sakaki M, Makino R, Hiroishi K, Ueda K, Eguchi J, Hiraide A, Omori R, Imawari M. Cyclooxygenase 2 gene promoter polymorphisms affect susceptibility to hepatitis C virus infection and disease progression. Hepatol Res. 2010;40(12):1219–26.CrossRefPubMed Sakaki M, Makino R, Hiroishi K, Ueda K, Eguchi J, Hiraide A, Omori R, Imawari M. Cyclooxygenase 2 gene promoter polymorphisms affect susceptibility to hepatitis C virus infection and disease progression. Hepatol Res. 2010;40(12):1219–26.CrossRefPubMed
11.
Zurück zum Zitat Guyot-Revol V, Innes JA, Hackforth S, Hinks T, Lalvani A. Regulatory T cells are expanded in blood and disease sites in patients with tuberculosis. Am J Respir Crit Care Med. 2006;173(7):803–10.CrossRefPubMed Guyot-Revol V, Innes JA, Hackforth S, Hinks T, Lalvani A. Regulatory T cells are expanded in blood and disease sites in patients with tuberculosis. Am J Respir Crit Care Med. 2006;173(7):803–10.CrossRefPubMed
12.
Zurück zum Zitat Sharma PK, Saha PK, Singh A, Sharma SK, Ghosh B, Mitra DK. FoxP3+ regulatory T cells suppress effector T-cell function at pathologic site in miliary tuberculosis. Am J Respir Crit Care Med. 2009;179(11):1061–70.CrossRefPubMed Sharma PK, Saha PK, Singh A, Sharma SK, Ghosh B, Mitra DK. FoxP3+ regulatory T cells suppress effector T-cell function at pathologic site in miliary tuberculosis. Am J Respir Crit Care Med. 2009;179(11):1061–70.CrossRefPubMed
14.
Zurück zum Zitat Chen Z, Lin F, Gao Y, Li Z, Zhang J, Xing Y, Deng Z, Yao Z, Tsun A, Li B. FOXP3 and RORγt: transcriptional regulation of Treg and Th17. Int Immunopharmacol. 2011;11(5):536–42.CrossRefPubMed Chen Z, Lin F, Gao Y, Li Z, Zhang J, Xing Y, Deng Z, Yao Z, Tsun A, Li B. FOXP3 and RORγt: transcriptional regulation of Treg and Th17. Int Immunopharmacol. 2011;11(5):536–42.CrossRefPubMed
15.
Zurück zum Zitat Hougardy J-M, Place S, Hildebrand M, Drowart A, Debrie A-S, Locht C, Mascart F. Regulatory T cells depress immune responses to protective antigens in active tuberculosis. Am J Respir Crit Care Med. 2007;176(4):409–16.CrossRefPubMed Hougardy J-M, Place S, Hildebrand M, Drowart A, Debrie A-S, Locht C, Mascart F. Regulatory T cells depress immune responses to protective antigens in active tuberculosis. Am J Respir Crit Care Med. 2007;176(4):409–16.CrossRefPubMed
16.
17.
Zurück zum Zitat Chen Y, Zhang H, Liao W, Zhou J, He G, Xie X, Fei R, Qin L, Wei L, Chen H. FOXP3 gene polymorphism is associated with hepatitis B-related hepatocellular carcinoma in China. J Exp Clin Cancer Res. 2013;32(1):1.CrossRef Chen Y, Zhang H, Liao W, Zhou J, He G, Xie X, Fei R, Qin L, Wei L, Chen H. FOXP3 gene polymorphism is associated with hepatitis B-related hepatocellular carcinoma in China. J Exp Clin Cancer Res. 2013;32(1):1.CrossRef
18.
Zurück zum Zitat He Y, Na H, Li Y, Qiu Z, Li W. FoxP3 rs3761548 polymorphism predicts autoimmune disease susceptibility: a meta-analysis. Hum Immunol. 2013;74(12):1665–71.CrossRefPubMed He Y, Na H, Li Y, Qiu Z, Li W. FoxP3 rs3761548 polymorphism predicts autoimmune disease susceptibility: a meta-analysis. Hum Immunol. 2013;74(12):1665–71.CrossRefPubMed
19.
Zurück zum Zitat Koukouikila-Koussounda F, Ntoumi F, Ndounga M, Tong HV, Abena A-A, Velavan TP. Genetic evidence of regulatory gene variants of the STAT6, IL10R and FOXP3 locus as a susceptibility factor in uncomplicated malaria and parasitaemia in Congolese children. Malar J. 2013;12(1):1.CrossRef Koukouikila-Koussounda F, Ntoumi F, Ndounga M, Tong HV, Abena A-A, Velavan TP. Genetic evidence of regulatory gene variants of the STAT6, IL10R and FOXP3 locus as a susceptibility factor in uncomplicated malaria and parasitaemia in Congolese children. Malar J. 2013;12(1):1.CrossRef
20.
Zurück zum Zitat Oda JM, Hirata BK, Guembarovski RL, Watanabe MA. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T-cell role and development of human diseases. J Genet. 2013;92(1):163–71.CrossRefPubMed Oda JM, Hirata BK, Guembarovski RL, Watanabe MA. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T-cell role and development of human diseases. J Genet. 2013;92(1):163–71.CrossRefPubMed
21.
Zurück zum Zitat Torgerson TR, Ochs HD. Immune dysregulation, polyendocrinopathy, enteropathy, X-linked: forkhead box protein 3 mutations and lack of regulatory T cells. J Allergy Clin Immunol. 2007;120(4):744–50.CrossRefPubMed Torgerson TR, Ochs HD. Immune dysregulation, polyendocrinopathy, enteropathy, X-linked: forkhead box protein 3 mutations and lack of regulatory T cells. J Allergy Clin Immunol. 2007;120(4):744–50.CrossRefPubMed
22.
Zurück zum Zitat Wu Z, You Z, Zhang C, Li Z, Su X, Zhang X, Li Y. Association between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han population. Clin Dev Immunol. 2012;2012:896458.PubMed Wu Z, You Z, Zhang C, Li Z, Su X, Zhang X, Li Y. Association between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han population. Clin Dev Immunol. 2012;2012:896458.PubMed
23.
Zurück zum Zitat Yagi H, Nomura T, Nakamura K, Yamazaki S, Kitawaki T, Hori S, Maeda M, Onodera M, Uchiyama T, Fujii S. Crucial role of FOXP3 in the development and function of human CD25+ CD4+ regulatory T cells. Int Immunol. 2004;16(11):1643–56.CrossRefPubMed Yagi H, Nomura T, Nakamura K, Yamazaki S, Kitawaki T, Hori S, Maeda M, Onodera M, Uchiyama T, Fujii S. Crucial role of FOXP3 in the development and function of human CD25+ CD4+ regulatory T cells. Int Immunol. 2004;16(11):1643–56.CrossRefPubMed
24.
Zurück zum Zitat Song P, Wang XW, Li HX, Li K, Liu L, Wei C, Jian Z, Yi XL, Li Q, Wang G. Association between FOXP3 polymorphisms and vitiligo in a Han Chinese population. Br J Dermatol. 2013;169(3):571–8.CrossRefPubMed Song P, Wang XW, Li HX, Li K, Liu L, Wei C, Jian Z, Yi XL, Li Q, Wang G. Association between FOXP3 polymorphisms and vitiligo in a Han Chinese population. Br J Dermatol. 2013;169(3):571–8.CrossRefPubMed
25.
Zurück zum Zitat Altshuler DBL, Chakravarti A, Collins FS, Daly MJ, Donnelly P. International HapMap consortium a haplotype map of the human genome. Nature. 2005;437(7063):1299–320.CrossRef Altshuler DBL, Chakravarti A, Collins FS, Daly MJ, Donnelly P. International HapMap consortium a haplotype map of the human genome. Nature. 2005;437(7063):1299–320.CrossRef
26.
Zurück zum Zitat Reis-Filho JS, Pinheiro C, Lambros M, Milanezi F, Carvalho S, Savage K, Simpson PT, Jones C, Swift S, Mackay A. EGFR amplification and lack of activating mutations in metaplastic breast carcinomas. J Pathol. 2006;209(4):445–53.CrossRefPubMed Reis-Filho JS, Pinheiro C, Lambros M, Milanezi F, Carvalho S, Savage K, Simpson PT, Jones C, Swift S, Mackay A. EGFR amplification and lack of activating mutations in metaplastic breast carcinomas. J Pathol. 2006;209(4):445–53.CrossRefPubMed
27.
Zurück zum Zitat Beiranvand E, Abediankenari S, Sadegh Rezaei M, Khani S, Sardari S, Beiranvand B. Increased expression of forkhead box protein 3 gene of regulatory T cells in patients with active tuberculosis. Inflamm Allergy Drug Targets. 2014;13(5):330–4.CrossRefPubMed Beiranvand E, Abediankenari S, Sadegh Rezaei M, Khani S, Sardari S, Beiranvand B. Increased expression of forkhead box protein 3 gene of regulatory T cells in patients with active tuberculosis. Inflamm Allergy Drug Targets. 2014;13(5):330–4.CrossRefPubMed
28.
Zurück zum Zitat Gazzola L, Tincati C, Gori A, Saresella M, Marventano I, Zanini F. FoxP3 mRNA expression in regulatory T cells from patients with tuberculosis. Am J Respir Crit Care Med. 2006;174(3):356. author reply 357CrossRefPubMed Gazzola L, Tincati C, Gori A, Saresella M, Marventano I, Zanini F. FoxP3 mRNA expression in regulatory T cells from patients with tuberculosis. Am J Respir Crit Care Med. 2006;174(3):356. author reply 357CrossRefPubMed
29.
Zurück zum Zitat Hill PC, Brookes RH, Fox A, Fielding K, Jeffries DJ, Jackson-Sillah D, Lugos MD, Owiafe PK, Donkor SA, Hammond AS. Large-scale evaluation of enzyme-linked immunospot assay and skin test for diagnosis of Mycobacterium tuberculosis infection against a gradient of exposure in The Gambia. Clin Infect Dis. 2004;38(7):966–73.CrossRefPubMed Hill PC, Brookes RH, Fox A, Fielding K, Jeffries DJ, Jackson-Sillah D, Lugos MD, Owiafe PK, Donkor SA, Hammond AS. Large-scale evaluation of enzyme-linked immunospot assay and skin test for diagnosis of Mycobacterium tuberculosis infection against a gradient of exposure in The Gambia. Clin Infect Dis. 2004;38(7):966–73.CrossRefPubMed
Metadaten
Titel
G allele at −924 A > G position of FoxP3 gene promoter as a risk factor for tuberculosis
verfasst von
Elham Beiranvand
Saeid Abediankenari
Soghra Khani
Hamideh Mahmoodzadeh Hosseini
Sirous Zeinali
Behnoush Beiranvand
Mehdi Goudarzi
Sima Sadat Seyedjavadi
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2017
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-017-2762-5

Weitere Artikel der Ausgabe 1/2017

BMC Infectious Diseases 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.