Background
Maturity-onset diabetes of the young (MODY) is a rare form of diabetes mellitus with autosomal dominant inheritance, typically diagnosed before 25 years of age. It is caused by mutations in 13 genes involved in pancreatic β-cell function [
1]. One of the most common types reported is MODY2, which is caused by heterogenous inactivating mutations in the glucokinase (
GCK) gene, hence also known as glucokinase-maturity-onset diabetes of the young (GCK-MODY) [
1].
GCK-MODY is characterized by asymptomatic fasting hyperglycaemia, which is present from birth and remains stable throughout life [
2]. Typically the fasting glucose falls in the range 5.6–8.0 mmol/L with hemoglobin A1c (HbA1c) 5.6–7.3% (38–56 mmol/mol) in those aged 40 years and below, as shown in a large cohort of GCK-MODY patients [
3].
Glucokinase (GCK) is a key enzyme in the regulation of insulin release in pancreatic β-cells. It is encoded by the glucokinase gene located at chromosome 7p15.3–p15.1, consisting of 10 exons and spanning 45,168 bp [
4]. Abnormalities in GCK due to gene mutations will disrupt glucose homeostasis causing both hyperglycaemia and hypoglycaemia. Heterozygous inactivating mutations cause GCK-MODY while homozygous or compound heterozygous mutations result in a more severe phenotype of permanent neonatal diabetes mellitus. In contrast, heterozygous activating mutations cause persistent hyperinsulinemic hypoglycaemia of infancy [
4].
There are 620 different mutations found in 1441 families in the 10 exons (exons 1–10) of the
GCK gene expressed in the pancreatic β-cells [
4]. Missense, nonsense, frameshift, and splice site mutations are commonly reported and most of the mutations are private [
4]. Although heterozygous pathogenic
GCK mutations are diverse, they all lead to the same phenotype of mild fasting hyperglycaemia.
Most of the studies on GCK-MODY are in Caucasian populations. Studies on
GCK mutations in Asian populations are few and showed a much lower frequency of mutations (less than 5%) in those with clinical diagnosis of MODY [
5‐
7]. However, a more recent study involving 80 patients in Japan revealed a higher frequency of
GCK mutations in 22.8% of paediatric-onset MODY patients, comparable to European studies [
8]. An Indian study found a low frequency of
GCK mutations in children and adolescents with mild hyperglycaemia [
9]. As GCK-MODY studies are scarce in Chinese populations, little is known about the clinical features of GCK-MODY in Chinese children. We previously reported a boy who was misdiagnosed as type 1 diabetes and was treated with insulin for half a year until he was identified to be GCK-MODY [
10]. We therefore realized that many patients with GCK-MODY might be missed and misdiagnosed as other types of diabetes. In an attempt to improve the diagnosis and management of GCK-MODY in China, we investigated the clinical and molecular characteristics of Chinese children with a clinical suspicion of GCK-MODY seen in the biggest children’s hospital in South China.
Methods
Patients
From April 2011 to April 2016, there were 587 children with newly diagnosed diabetes mellitus in Guangzhou Women and Children’s Medical Center (the biggest children’s hospital in South China). There were 24 children with clinically diagnosed MODY. Eleven of these 24 children had asymptomatic hyperglycaemia and were clinically suspected to have GCK-MODY. GCK gene mutation analysis was performed in these eleven children.
The presumptive clinical diagnosis of GCK-MODY was established by the following features according to the European guidelines [
11,
12]: 1) asymptomatic fasting hyperglycaemia ≥5.5 mmol/L, HbA1c < 7.5% (59 mmol/mol), and small 2-h glucose increment < 3 mmol/L in an oral glucose tolerance test (OGTT). 2) parents have diabetes without complications or unaffected parents have mild fasting hyperglycaemia 5.5–8 mmol/L.
Details of clinical data were obtained from medical records. Clinical follow-up started from the time of diagnosis and subsequently at 3–6 month intervals. Self monitored blood glucose levels were recorded, and HbA1c, height and weight were measured at every visit. OGTT was performed yearly with an oral glucose dose of 1.75 g/kg body weight (maximum 75 g) after a minimum of 8 h of fasting.
Parents without history of diabetes mellitus were tested for fasting plasma glucose (FPG) and HbA1c. Clinical information and recent FPG and HbA1c were obtained from parents and grandparents with a history of diabetes.
Informed consent was obtained from all patients’ parents. The study was approved by the Institutional Review Board of Guangzhou Women and Children’s Medical Center. The mutational analysis of GCK gene was performed at Guangzhou Women and Children’s Medical Center from May 2012 to May 2016.
Laboratory evaluation
The following biochemical parameters were measured on patients blood samples: plasma glucose by enzymatic method; HbA1c by latex immunoagglutination inhibition methodology (DCA Systems, Siemens, Erlangen, Germany); serum fasting insulin by chemiluminescence immunoassay (ADVIA Centaur XP Immunoassay Systems, Siemens, Erlangen, Germany); anti-glutamic acid decarboxylase (GAD), anti-islet cell (ICA) and anti-insulin (IAA) antibodies by radioimmunoassay.
Mutational analysis of GCK gene and other genes associated with monogenic diabetes
Genomic DNA was extracted from peripheral blood leukocytes of the probands, their parents and grandparents, using a whole blood DNA extraction kit (Qiagen 51,106 QIAamp DNA Mini Kit, Germany) according to the manufacturer’s protocol. Exons 1–10 and exon-intron boundaries of the GCK gene were amplified by polymerase chain reaction (PCR) (Mastercyclers Pro TM Gradient Thermal Cycler, Eppendorf, Hamburg, Germany). The primer sequences are listed in Table
1. DNA sequence analyses were conducted with DNA Analyzer 3730(ABI, USA). Sequences were compared with the reference sequence (NM_000162.3) using DNAMAN and Chromas software (V.2.01, Technelysium Pty Ltd., Tewantin QLD, Australia). The novel mutations in the study were determined by comparing with the SNP databases, including 1000Genomes, ESP6500, ExAc and dbSNP, and the Human Gene Mutation Database (HGMD). The pathogenicity of the mutation occurring in flanking intronic regions resulted in abnormal splicing was predicted by the online tools of MutationTaster, NetGene2, and Human Splicing Finder V3.0, while only MutationTaster was used for frame shift or deletion type mutations.
Table 1
Primers for amplification of Glucokinase (GCK) gene coding sequences
Exon1 | 1F | ATTTCCACTTCAGAAGCCTACT | 58 |
1R | GGCTCAAACAAACCATGGAAT | |
Exon2 | 2F | GGGGTCAGAAGACAGAAGGAGGC | 64 |
2R | TGAGAACTGGCCCAAGTCGAGGA | |
Exon3 | 3F | GTAATATCCGGGCTCAGTCACC | 64 |
3R | ACAGGTGGCACCTCCCGTCAG | |
Exon4 | 4F | ATAGCTTGGCTTGAGGCCGTG | 62 |
4R | TTTGAAGGCAGAGTTCCTCTG | |
Exon5–6 | 5–6F | CTGCTCTGAGCCTGTTTCC | 62 |
5–6R | ACGGTGCTTCCATCTTGAT | |
Exon7 | 7F | CCGCCTTTCCATTGTTCC | 64 |
7R | CTCCCATCTGCCGCTGCACC | |
Exon8 | 8F | AGGAAGGTTTCGGAGGGACT | 62 |
8R | TGAGACCAAGTCTGCAGTGCC | |
Exon9 | 9F | GATGGACTGTCGGAGCGACACT | 64 |
9R | TCTTGGAGCTTGGGAACCGC | |
Exon10 | 10F | AAGGGTCGACTGCGTGCAG | 64 |
10R | ATTCCAGCGAGAAAGGTG | |
2 patients in whom
GCK mutations were not detected, were screened by targeted next-generation sequencing (NGS) technology. A capture panel (NimbleGen, Madison, USA) of monogenic diabetes genes was designed which comprised 157,624 bp that covered all exons together with the flanking exon and intron boundaries (±15 bp) of 44 genes, including
GCK,
INS,
HNF1A,
HNF1B,
HNF4A,
KLF11,
BLK,
CEL,
NEUROD1,
NEUROD3,
PDX1,
KCNJ11,
ABCC8,
ZFP57,
HYMAI,
EIF2AK3,
WFS1,
AKT2,
GLUD1,
HADH,
MAPK8IP1,
PAX4,
PLAGL1,
PTF1A INHANCER,
RFX6,
SLC2A2,
SLC19A2,
UCP2,
GLIS3,
INSR,
PTF1A,
GATA6,
IER3IP1,
PAX4,
FOXA2,
SLC16A1,
FOXP3,
CISD2,
CAPN10,
PPAR,
AGPAT2,
BSCL2,
IPF1 and
MNX1. Then the genomic DNA samples was fragmented by Covaris LE220 (Massachusetts, USA) to generate a paired-end library (200–250 bp). The library was enriched by array hybridization according to the procedure described previously [
13], followed by elution and post-capture amplification. The products were then subjected to Agilent 2100 Bioanalyzer to estimate the magnitude of enrichment. After quality control, captured library sequencing was carried out on Illumina HiSeq2500 Analyzers (Illumina, San Diego, USA) for 90 cycles per read to generate paired-end reads. Image analysis, error estimation, and base calling were performed using Illumina Pipeline software (version 1.3.4) to generate raw data with an average of 178-fold depth coverage to identify causal mutations.
Discussion
GCK mutation is a common cause of incidental hyperglycaemia in otherwise well asymptomatic children in other populations [
16,
17]. We found
GCK mutations in nine out of eleven children with asymptomatic hyperglycaemia in our hospital cohort. There is a recent report from another children’s hospital in China, where three families with genetically confirmed MODY2 were diagnosed in over a year, two probands were children with asymptomatic hyperglycaemia and had abnormal OGTT [
18]. These observations suggest that
GCK mutations may be a common cause of asymptomatic hyperglycaemia in Chinese children. Further study with larger cohort numbers is needed to confirm this.
The clinical features of our cohort in terms of glycaemic profile are very similar to other populations. The fasting glucose of 6.1–8.5 mmol/L and HbA1c 5.2–6.7% fell within the typical ranges reported in GCK-MODY. Stability in both parameters on follow-up for up to 5 years without drug treatment is consistent with GCK-MODY. Most GCK-MODY patients have a small increment in blood glucose (< 3.0 mmol/L) during an oral glucose tolerance test [
11]. In this study, 2 out of the 9 cases had 2-h glucose increment > 3 mmol/L (3.5 mmol/L and 4.6 mmol/L respectively) on repeat OGTT at follow-up. Glycosuria was absent in all patients, reflecting the mild hyperglycaemia below renal threshold, similar to findings in GCK-MODY in Caucasian populations [
2].
Neonatal diabetes mellitus, a monogenic disorder, needs to be considered in hyperglycaemia within the first 6 months of life. Insulin treatment is required and sulphonylurea is the treatment of choice if there are activating mutations in the
KCNJ11 or
ABCC8 genes [
19]. In case 1 and case 3, neonatal diabetes mellitus was ruled out based on the clinical course of stable hyperglycaemia without pharmacotherapy. In case 2, the genetic analysis clinched the diagnosis of GCK-MODY rather than neonatal diabetes and drug treatment was confidently stopped. The detection of hyperglycaemia in early infancy that remains stable, as described in three cases (cases 1–3) here, is consistent with previous reports of hyperglycaemia being present early in life, including the neonatal period, in GCK-MODY [
20]. Type 1 diabetes mellitus, the most prevalent form of diabetes in childhood, was ruled out in cases 4–9 as there was no ketosis without insulin therapy and pancreatic autoantibodies were negative. They (cases 4–9) were unlikely to have type 2 diabetes, the next common form of paediatric diabetes, as they lacked the typical features of obesity and acanthosis nigricans. However, the prevalence of type 2 diabetes is high in Asia and many Asian children with type 2 diabetes are not obese [
21]. Incidental hyperglycaemia in an asymptomatic Asian child will always raise the possibility of development of type 2 diabetes especially if there is a positive family history. Differentiating GCK-MODY and pre-diabetic phase of type 2 diabetes in Asian children based on clinical features is therefore challenging. Genetic analysis for GCK mutation is vital to differentiate GCK-MODY from the pre-diabetic phase of type 2 diabetes in non-obese Asian children.
To date, more than 600 mutations of the
GCK gene have been documented (Human Gene Mutation Database at the Institute of Medical Genetics in Cardiff: GCK Gene:
http://www.hgmd.cf.ac.uk
). Here we reported 9 different mutations, five of them (p.Val182Met, c.679 + 1G > A, p.Gly295Ser, p.Arg191Gln, and p.Met41Thr) have been previously reported, but not in a Chinese population; four mutations were novel, c.483 + 2 T > A, p.Ser151del, p. Met57GlyfsX29 and p.Val374_Ala377del. Human GCK is an allosteric enzyme consisting of two domains, the hexokinase small domain and the hexokinase large domain [
22]. In this study the mutations were distributed evenly throughout the GCK protein: 4/9 (44.4%) in the small domain, 5/9 (55.6%) in the large domain. These findings are in agreement with studies from Caucasian populations which indicated no hot spot mutations were found in the GCK gene [
4]. All of the mutations in GCK co-segregated with diabetes in more than one affected member of the family and none of the mutations was found among non-diabetic relatives of the proband. They are likely to have a damaging effect on GCK enzyme function. According to the Human Genome Variation Society (HGVS), splice site mutations that alter highly conserved nucleotides (position + 1, + 2, −1 and −2) can be predicted to affect the primary transcript or protein synthesis. Therefore the novel mutation c.483 + 2 T > A which caused T to A transversion at the 3′ donor splice site of exon 4 is likely a disease causing mutation. The indel mutation c.169_170delATinsG (p. Met57GlyfsX29) is predicted to be highly pathogenic, as it gives rise to a premature truncation of GCK protein at position 86. The deletion mutation c.1121_1132del12 (p.Val374_Ala377del) found in exon 9 is due to slipped mispairing during DNA replication, caused by the same dinucleotide CG on both sides of the deletion. However, functional study of the novel mutations on enzyme activity was not performed. Additional kinetic assays are necessary to establish the actual functional basis for the disease.
GCK-MODY is a condition of altered physiological set point of glucose homeostasis due to the mutation, rather than a pathological disease state. It requires no drug treatment, except during pregnancy if there is excessive fetal growth, as pharmacotherapy is ineffective in reducing blood glucose or HbA1c [
2]. There is no increased risk of long-term diabetes-related microvascular and macrovascular complications [
23]. Children with genetically confirmed GCK-MODY do not require regular follow-up as they are expected to have lifelong mild stable fasting hyperglycaemia without any known long-term adverse effects. However, they have the same risk of developing type 1 and type 2 diabetes as the general population [
2]. They need to be reassessed and investigated for type 1 or type 2 diabetes if new suggestive clinical features arise.
Genetic confirmation of GCK-MODY will help predict clinical course and long-term prognosis, aid treatment and follow-up decisions. This is aptly illustrated by case 2 whereby unnecessary anti-diabetic drug treatment was stopped when GCK-MODY was confirmed genetically. Treatment cost can be reduced as unnecessary long-term use of medication and regular investigations as part of routine care of diabetes are prevented. There is a positive impact on the child and their family as frequent hospital clinic visits and blood taking for investigations for diabetes care are stopped. The parents can be reassured that there is no risk of long-term diabetes-related complications in their child. On the contrary, the other two children who have tested negative for GCK gene mutation are likely to have other types of diabetes, such as type 2 diabetes; and require closer monitoring and follow-up. When a child is known to have a GCK gene mutation, genetic screening for the GCK gene mutation can be offered to other family members with a diagnosis of diabetes; eliminating unneccessary anti-diabetic treament if a GCK mutation is confirmed.