Skip to main content
main-content

01.12.2017 | Research | Ausgabe 1/2017 Open Access

Virology Journal 1/2017

Genetic characterization of 11 porcine reproductive and respiratory syndrome virus isolates in South China from 2014 to 2015

Zeitschrift:
Virology Journal > Ausgabe 1/2017
Autoren:
Linyang Yu, Pandeng Zhao, Jianguo Dong, Yanling Liu, Leyi Zhang, Pengshuai Liang, Lei Wang, Changxu Song
Abbreviations
AA
Amino acid
dNTP
Deoxynucleoside triphosphate
E
Envelope
HP-PRRSV
Highly pathogenic porcine reproductive and respiratory syndrome virus
M
Membrane
N
Nucleoprotein
NSPs
Nonstructural proteins
ORFs
Open reading frames
PRRS
Porcine reproductive and respiratory syndrome
PRRSV
Porcine reproductive and respiratory syndrome virus
S
Spike

Background

Porcine reproductive and respiratory syndrome (PRRS) is an important swine contagious disease across the world, leading to an enormous loss per year to the swine industry [1]. In 1987, PRRSV was first reported in the United States, and later it appeared in Europe [2, 3]. Unfortunately, after a short while, PRRS also outbroke in Asia countries. In 2006, a highly pathogenic strain of porcine reproductive and respiratory syndrome virus (HP-PRRSV) broke out in China and spreaded rapidly to most areas of China and neighboring countries [46]. Recently, mang NADC30 like strains had been monitored and isolated in the Middle, North-east and South-east China [79].
Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped, positive-sense single-stranded RNA virus belonging to the family Arteriviridae, order Nidovirales [10]. The PRRSV complete genome is about 15 kb in length, including at least 10 open reading frames (ORFs): ORF1a, ORF1b, ORF2a, ORF2b, ORF3, ORF4, ORF5, ORF5a, ORF6 and ORF7 [11, 12]. ORF1a and ORF1b encode viral replicase polyproteins, which are furtherly cleaved into 16 nonstructural proteins (Nsps), including NSP1α, NSP1β, NSP2, NSP2TF, NSP2N, NSP3, NSP4, NSP5, NSP6, NSP7α, NSP7β, NSP8, NSP9, NSP10, NSP11 and NSP12 [1315], whereas other ORFs encode the viral structural proteins GP2a, E, GP3, GP4, GP5, ORF5a, M, and N, respectively (12).
To fully understand the genetic characteristics of PRRSV genome in South China, we collected the lung samples infected with PRRSV in Guangdong and Hainan province from 2014 to 2015 and tried to isolate the PRRSV. Finally, 11 PRRSV strains were successfully isolated and the complete genomes were sequenced and analyzed.

Methods

Clinical samples

Lung samples were collected from sick pigs infected with PRRSV in Guangdong and Hainan provinces of South China from 2014 to 2015. The lung samples were homogenized and centrifuged and the supernatants were used for virus isolation. All the samples were collected according to the animal ethical regulation of National Engineering Center for Swine Breeding Industry (NECSBI 2015–16).

Virus isolation

Virus isolation was performed in MARC-145 cells which were maintained in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS; Thermo), 100 mg/mL penicillin, and 100 units/mL of streptomycin. MARC-145 cells seeded in 6-well cell culture plates (Corning Inc., USA) were incubated with the supernatants from the homogenized lung samples for 1 h, then the supernatants were discarded and DMEM was added into the 6-well cells and the cells were maintained at 37 °C with 5% CO2. The cultured cells and supernatants were harvested when cytopathic effect (CPE) appeared in 70% and the recovered strains were passaged twice in MARC-145 cells and the viral cultures of the third passage were used for genomic sequence analysis.

Primers design

To determine the full genome sequence of isolated strains, primers were designed based on the referenced PRRSV sequences available in NCBI. The primers used for complete genome sequencing were given in Table 1.
Table 1
Primers used for PRRSV genome amplification. The primers for amplifying PRRSV genome were listed in Table 1
Primers Name
Sequence(5′-3′)
Positiona
PRRSV1F
ATGACGTATAGGTGTTGGCT
1–20
PRRSV1R
GTCGCACCAGAGCGTGCTTTC
1357–1377
PRRSV1F
CAGAATCAGGGTTGAGCCCAAT
1255–1276
PRRSV1R
CTGCCCAGGCCATCATTTCTGAA
2551–2573
PRRSV2F
CCACTGGACTTGGCCCGCGAC
2451–2471
PRRSV2R
CTGAAGGCAGCAAATCAGTGA
3780–3800
PRRSV3F
CCGGTCTGCGACCAACCTGCC
3680–2700
PRRSV3R
GAAAATACACCCAAGAGGGGAG
4029–4050
PRRSV4F
CACACCTCTTCAAATCTGACAG
3921–3942
PRRSV4R
CGAAGGCATATTTACAGAAATC
5368–5389
PRRSV5F
CCCTTACCTGGTTGCTTTGTGT
5280–5301
PRRSV5R
GTAACGGATGCCCTTGAGTTGC
6521–6542
PRRSV6F
GGATGTTTGTGCTATCTTGGCT
6378–6399
PRRSV6R
GCGGCTAGCAGTTTAAACACTGC
7684–7706
PRRSV7F
GAGCAAGCCCTTGGTATGATGA
7583–7604
PRRSV7R
CAAGGCACCTGCCTAAAACCGGA
8844–8866
PRRSV8F
CGTTGAGTGGTGTCACCCAGGG
8756–8777
PRRSV8R
TTCCCTCCTGGATGAAGCAGCG
10,281–10,302
PRRSV9F
GGCTTTGGGGACGTGCCGGTTC
10,164–10,185
PRRSV9R
AACTGATTCCTTGGGAAGGAAG
11,400–11,421
PRRSV110F
CTGAGTCCCTCCCACATGCCTT
11,312–11,333
PRRSV110R
AAGTACTATTATACACTATG
12,613–12,632
PRRSV11F
TGGATGTGGTGGCTCATTTTC
12,498–12,518
PRRSV11R
CCCCAACATACTTGAACATTCA
13,776–13,797
PRRSV12F
CCAACATGTCAAGGAGTTTAC
13,646–13,666
PRRSV12R
CTTTCGCTGCTTGCCGTTGTTA
14,898–14,919
PRRSV13F
TACGGTTAACGGCACATTGGTG
14,798–14,819
PRRSV13R
d(T)20AATTTCGGCCGCATGG
15,395–15,432
aNumbers represents the nucleotide position within the genome of CH-1a (GenBank accession number: AY032626)

RNA extraction and RT-PCR

Total RNA was extracted using TRIzol reagent (Life Technologies, USA) according to the manufacturer’s instructions. Reverse transcription was performed in a total volume of 20 μL containing 10.5 μL total RNA, 4 μL 5× reverse transcription buffer, 2 μL deoxynucleoside triphosphate (dNTP) mixture (10 mM), 1 μL 9-mer random primers (50 pM), 2 μL reverse transcriptase M-MLV (Takara, Dalian), and 0.5 μL RNase inhibitor (40 U/μL). The reactants were mixed gently, placed in a water bath at 42 °C for 1 h, then incubated on ice for 2 min. The polymerase chain reaction was conducted using PrimeSTAR HS DNA Polymerase (Takara, Dalian).

Nucleotide cloning and sequencing

PCR products were purified using the Wizard SV Gel and PCR Clean-Up system (Promega, USA), and then cloned into pEASY Simple Blunt vector (TransGen tech Co., Beijing, China). Plasmids were submitted to BGI (Guangzhou, China) for sequencing and the complete PRRSV genome sequence was obtained by SeqMan program of DNASTAR7.0 software (DNASTAR Inc., Madison, WI, USA). The complete genome sequence was submitted to GenBank and the accession no. was listed in Table 2.
Table 2
Information of 11 PRRSV isolated from South China. The designation, isolated year, accession No, sample, area of isolated strains were listed in Table 2
No.
Designation
Isolated year
Accession No.
Sample
Area
1
GDGZ
2014
KY488471
Lung
Guangzhou
2
GDJM
2014
KY488470
Lung
Jiangmen
3
GDMM
2014
KY488472
Lung
Maoming
4
GDST
2014
KY498542
Lung
Shantou
5
GDZQ
2014
KY488473
Lung
Zhaoqing
6
HNHK1
2014
KY488474
Lung
Haikou
7
HNHK2
2014
KY488475
Lung
Haikou
8
GDHY
2015
KY488476
Lung
Heyuan
9
GDHZ
2015
KY488477
Lung
Huizhou
10
GDQY
2015
KY488478
Lung
Qingyuan
11
GDSG
2015
KY488479
Lung
Shaoguan

Sequence alignment and phylogenetic analysis

Nucleotide and deduced amino acid (AA) sequences were aligned using the MegAlign program of DNASTAR7.0 software (DNASTAR Inc., WI, USA) to determine sequence homology. A phylogenetic tree was constructed using MEGA5.2 software with the neighbor-joining method; bootstrap values were calculated for 1000 replicates for alignment with multiple sequences of representative PRRSV sequences available in GenBank (Table 3).
Table 3
Information of the representative strains. The strain designation, area, isolatedtime, accession No. of representative strains were listed in Table 3
No.
Strain
Area
Time
Accession No
1
EDRD-1
Japan
1992
AB288356
2
Leystad virus
Netherlands
1993
M96262
3
CH-1a
Beijing, China
1996
AY032626
4
BJ-4
Beijing, China
1996
AF331831
5
PL97–1
South Korea
1997
AY585241
6
HB-1(sh)/2002
Hebei, China
2002
AY150312
7
VR-2332
America
2003
AY150564
8
Resp PRRS MLV
America
2005
AF066183
9
SHB
Guangdong, China
2005
EU864232
10
JXA1
Jiangxi, China
2006
EF112445
11
JXwn06
Jiangxi, China
2006
EF641008
12
GD
Guangdong, China
2006
EU825724
13
HuN4
Hunan, China
2007
EF635006
14
CH-1R
Heilongjiang, China
2008
EU807840
15
JXA1-P80
Guangdong, China
2008
FJ548853
16
GDBY1
Guangdong, China
2008
GQ374442
17
NADC30
America
2008
JN654459
18
GD-100
Guangdong, China
2009
GU143913
19
QY2010
Guangdong, China
2010
JQ743666
20
GX1003
Guangxi, China
2010
JX912249
21
GM2
Guangdong, China
2011
JN662424
22
QYYZ
Guangdong, China
2011
JQ308798
23
SD16
Shanxi, China
2012
JX087437
24
JL580
Jilin, China
2013
KR706343
25
CHsx1401
Beijing, China
2015
KP861625

Results

Phylogenetic analysis of the isolated PRRSV genome

To understand the evolution relationships of all the isolated PRRSV strains with the representative strains, phylogenetic trees were constructed using the neighor-joining method based on the complete genome, NSP2 nucleotide and ORF5 nucleotide sequences, respectively. As shown in Fig. 1a, the isolated strains and the representative strains could be divided into five subgenotypes: Subgenotype I, II, III, IV and V. All the isolated strains clustered into subgenotype V along with the HP-PRRSV representative strains JXA1, HuN4 and JXwn06. The subgenotype V was furtherly divided into two groups. GDHZ, GDHY and GDSG belonged to Group I, sharing a high homology with HP-PRRSV strains HuN4 and GD. The other isolated strains belonged to Group II, sharing a high identity with the HP-PRRSV strains JXA1 and JXwn06. When the phylogenetic trees were constructed based on NSP2 and ORF5 gene sequences of all the isolated strains and the reference strains, they had a similar cluster. GDHZ, GDHY and GDSG belonged to Group I, sharing a high homology with HP-PRRSV strains HuN4 and GD. The other isolated strains belonged to Group II, sharing a high identity with the HP-PRRSV strains JXA1 and JXwn06 (Fig. 1b and c).

Alignment and analysis of NSP2 amino acid sequences

To explore the genetic characteristics of the isolated PRRSV strains, the NSP2 AA sequence of isolated strains were analyzed. The results showed that AA sequence identities among all the isolated strains ranged from 92.3%–97.7%. All the NSP2 AA sequence of isolated strains shared 75.3%–78.0%, 84.8%–88.0%, and 93.7%–98.7% AA identity with the reference strains VR-2332, CH-1a and JXA1, respectively. Compared with the NADC30 and recently isolated NADC30-like strains JL580 and CHsx1401, they shared 66.4%–67.7% AA identity. However, they only shared 11.8%–13.2% AA identity with the European genotypic strain Lelystad virus (LV). These results indicated that all the isolated strains belonged to North American genotype. The AA sequence alignment analysis indicated that all the isolated strains had 1 AA deletion and 29 AA continuous deletion at position 481 and 533–561. Notably, GDHY strain had another 120 AA continuous deletion at position 629–748, which was similar with the MLV vaccine strain TJM derived from HP-PRRSV TJ strain and shared 99.8% identity with TJM (Fig. 2).

Alignment and analysis of GP5 amino acid sequences

The GP5 AA sequences of all isolated strains were the same size with the reperesentative strains. AA sequence alignments showed that AA sequence identities among all the isolated strains ranged from 95.5–99.5%, with 86.1–89.1%, 91.0–92.5%, and 96.0–99.0% AA similarity with reference strains VR-2332, CH-1a and JXA1, respectively. They shared 85.2–95.4% AA identity with the NADC30 and recently isolated NADC30-like strains. However, they only had 56.9–58.4% AA identity with the European genotypic strain LV. These results indicated that all the isolated strains had more closer relationship with the North American genotype.
As Fig. 3 showed, the AA substitutions mainly focused on the putative signal, extravirion and intravirion region. The three transmembrane region (TM1, TM2 and TM3) were relatively conserved [16]. The residues R13 and R151 of GP5 are relevant to PRRSV virulence [17, 18]. All the isolated strains had the same AA R13 with the reference strain. However, in group I, GDHZ, GDHY and GDSG had a R151K residue mutation, which was identical to the NADC30 and NADC30-like strains (JL580 and CHsx1401). The residue A137 of GP5 was considered to differentiate vaccine strains (18). Compared with VR-2332, all the other reference and isolated strains in this study had an A137S mutation.
It was reported that the primary neutralizing epitope (PNE) of GP5 AA37–44 played a vital role in inducing immune responsiveness [19]. All the isolated strains had a L39I mutation, compared to the VR-2332 strain.
The N30, N34, N44 and N51 of four potential N-glycosylation sites of GP5 are related with viral infection and antigen characteristics [20]. In group I, only GDHZ had a N34 T mutation. All the other isolated strains had conserved N30, N44 and N51 glycosylation sites.

Discussion

PRRSV has been one of the most prevalent diseases in pigs since its emergence in China, recently the NADC30 like strains have been extensively reported in most regions of China and it has caused huge economic loss to pig farmers (7–9). Considerable genetic diversity of PRRSV in field and invalid protection of current commercial vaccine to new emerging strains and in order to providing effect disease control, it is very necessary to execute frequent surveillance of the emerged new strains. In our study, 11 PRRSV strains were isolated from PRRSV positive samples in Guangdong and Hainan provinces of South China and the complete genomes were sequenced and analyzed. The results revealed that all the isolated strains were HP-PRRSV. Moreover, one isolated strain had another 120 AA continuous deletion except the discontinuous 30 (29 + 1) AA deletion in NSP2 region, which was similar with the MLV vaccine strain TJM derived from HP-PRRSV TJ strain [21].
Researchers have showed that recently isolated PRRSV strains belonged to North American strain and some strains had a close identity with NADC30 strain [22]. In our study, phylogenetic analysis indicated that all the isolated strains furtherly formed a subgenotype V with the representative strains. The subgenotype V was furtherly divided into two groups. GDHZ, GDHY and GDSG belonged to Group I, sharing a high homology with HP-PRRSV strains HuN4 and GD. The other isolated strains belonged to Group II, sharing a high identity with the HP-PRRSV strains JXA1 and JXwn06. No NADC30 like strains were isolated. These results indicated that the prevalent strain in Guangdong and Hainan was HP-PRRSV strains. Therefore, using the effective vaccine to resist the HP-PRRSV strain is a primary choose for controling HP-PRRS outbreak in these areas. Further surveillance should be reinforced to monitor the possibly emerging new strains.
NSP2 is the most variable region in the genome of PRRSV and was used for monitoring the evolution of PRRSV in the viral genome [2325]. Comparing the NSP2 amino acid sequence of the 11 isolated strains with the reference strains VR-2332 and CH-1a, the NSP2 region of 10 isolated strains had 30 AA discontinuous deletion, including 1 AA deletion at position 481 and 29 AA continuous deletion at position 532 to 560. The result was identical with other Chinese isolated HP-PRRSV strains since 2006 [26]. Moreover, 1 strain GDHY had an another 121 AA continuous deletion at position 630 to 750 in NSP2 region, which was completely different from the previous reports (4–7, 17, 26). Compared with other isolated strains from pig farms, the clinic symptoms of pig infected GDHY was more severe. This result showed that a new extensive deleted PRRSV strain had emerged in Southern China. It is necessary to monitor the positive rate of PRRSV infected samples to determine whether this strain would be an epidemic strain in the future, so farmers can draw up a reasonable plan to control PRRSV outbreak.
GP5 is one of the most variant structural proteins in PRRSV, so it often been used to analyze viral genetic mutation [27, 28]. The PNE epitope and potential glycosylation sites of GP5 are related to the neutralizing activity, immune responsiveness, antigen characteristics and viral susceptibility (19, 20). Comparing to reference strain VR-2332, all the isolated strains had a L39I mutation in the PNE (AA37–44) epitope. In group I, only GDHZ had a N34 T mutation, which was different from the CH-1R and JXA1 P80 vaccine strains. All the other isolated strains had conserved N30, N44 and N51 glycosylation sites. It was reported that the AA changes of N-glycosylation sites in GP5 could benefit mutant virus escaping the neutralization [29]. At present, the attenuated modified live PRRS vaccine could not provide complete protection. Whether the failure of vaccine protection was relevant to the variation of N-glycosylation sites of GP5 will be further researched.
The residues R13 and R151 of GP5 are related to PRRSV virulence (15, 16). All the isolated strains had the same AA R13. However, in group I, three strains GDHZ, GDHY and GDSG had a R151K residue mutation, which was the same with the NADC30 and NADC30-like strains (JL580 and CHsx1401). It was reported that NADC30 like strain was virulent and extensively epidemic in China. Therefore, it might be that the change of R151 was relevant to the virulence of isolated PRRSV strains. Besides, our researches showed that AA mutation mainly focused on the putative signal, extravirion and intravirion regions of GP5. The changes of AA in these regions might affect the form of normal GP5 in cells and promote mutation of PRRSV [27, 28].

Conclusion

In summary, we analyzed evolution characteristics of 11 PRRSV isolated strains in South China from 2014 to 2015. These results indicated that HP-PRRSV is still the prevalent strains in the region. One strain had another 120 AA continuous deletion except the discontinuous 30 (29 + 1) AA deletion in NSP2 region compared with the other isolated strains and reference strains. The GP5 of all isolated strains had many AA substitutions in the putative signal, extravirion, intravirion and extravirion regions. These results will benefit for vaccine research and disease control in this area.

Acknowledgements

We thank Mr. Fu-an Liu from South China Agriculture University for his help with editorial assistance.

Funding

This work was supported by the National Key Technologies R&D Program. (2015BAD12B02–5), Guangzhou City Project (201508020062), Henan Science and Technology Project (172102110198) and Key Subject of Prevention Veterinary Science of Henan University of Animal Husbandry and Ecomony (MXK2016102).

Availability of data and materials

Genetic data presented in this paper are publicly available via GenBank.

Ethics approval and consent to participate

All the samples were collected according to the animal ethical regulation of National Engineering Center for Swine Breeding Industry (NECSBI 2015–16).

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interest.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 1/2017

Virology Journal 1/2017 Zur Ausgabe


 

Neu im Fachgebiet Innere Medizin

Meistgelesene Bücher aus der Inneren Medizin

2017 | Buch

Rheumatologie aus der Praxis

Entzündliche Gelenkerkrankungen – mit Fallbeispielen

Dieses Fachbuch macht mit den wichtigsten chronisch entzündlichen Gelenk- und Wirbelsäulenerkrankungen vertraut. Anhand von über 40 instruktiven Fallbeispielen werden anschaulich diagnostisches Vorgehen, therapeutisches Ansprechen und der Verlauf …

Herausgeber:
Rudolf Puchner

2016 | Buch

Ambulant erworbene Pneumonie

Was, wann, warum – Dieses Buch bietet differenzierte Diagnostik und Therapie der ambulant erworbenen Pneumonie zur sofortigen sicheren Anwendung. Entsprechend der neuesten Studien und Leitlinien aller wichtigen Fachgesellschaften.

Herausgeber:
Santiago Ewig

Mail Icon II Newsletter

Bestellen Sie unseren kostenlosen Newsletter Update Innere Medizin und bleiben Sie gut informiert – ganz bequem per eMail.

© Springer Medizin 

Bildnachweise