Skip to main content
Erschienen in: Antimicrobial Resistance & Infection Control 1/2017

Open Access 01.12.2017 | Research

Genetic characterization of novel class 1 Integrons In0, In1069 and In1287 to In1290, and the inference of In1069-associated integron evolution in Enterobacteriaceae

verfasst von: Dongguo Wang, Jianfeng Zhu, Kaiyu Zhou, Jiayu Chen, Zhe Yin, Jiao Feng, Liman Ma, Dongsheng Zhou

Erschienen in: Antimicrobial Resistance & Infection Control | Ausgabe 1/2017

Abstract

Background

This study aims to characterize genetically related class 1 integrons In1069, In893 and In1287 to In1290, and to further propose a scheme of stepwise integration or excision of individual gene cassettes (GCs) to generation of these integron variations.

Methods

Six of 139 non-redundant Enterobacteriaceae strains were studied by bacterial antimicrobial susceptibility testing, detection of carbapenemase activity, and integron sequencing and sequence comparison.

Results

Six novel class 1 integrons, In0, In1069, and In1287 to In1290, together with the previously characterized In893, were determined from the above strains. An unusual bla KPC-2-carrying In0 and the bla IMP-30-carrying In1069 coexists in a single isolate of Escherichia coli. In0 contains a PcH1 promoter and a truncated aacA4’-3 gene cassette (GCaacA4’-3), as well as a bla KPC-2-containing region of Tn6296 integrated between PcH1 and GCaacA4’-3. In1069 carries GCbla IMP-30 and GCaacA4’-3 in this order. The other five integrons, In893 and In1287 to In1290, are genetically related to In1069, and all possess a core GCaacA4’-3. The integration or excision of one or more individual gene cassettes, such as GCbla IMP-30, GCaadA16, GCcatB3, GCarr3 and GCdfrA27, upstream or downstream of GCaacA4’-3 generates various gene cassettes arrays among these five integrons.

Conclusions

These findings provide the insight into stepwise and parallel evolution of In1069-associated integron variations likely under antibiotic selection pressure in clinical settings.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s13756-017-0241-9) contains supplementary material, which is available to authorized users.
Abkürzungen
3′-CS
3′-conserved segment
5′-CS
5′-conserved segment
GC
gene cassette
MDR
multidrug resistance
MIC
minimum inhibitory concentration
PCR
polymerase chain reaction

Background

Integrons are genetic elements containing a site-specific recombination system capable of integrating, exchanging, and expressing gene cassettes (GCs). Each GC is composed of an exogenous and often promoterless gene together with a recombination site, attC [15]. The recombination system possesses an integrase gene, intI, needed for site-specific recombination, an adjacent recombination site, attI, recognized by the IntI integrase, and a promoter, Pc, located upstream of attI and necessary for efficient transcription and expression of GCs [15]. The attC site is also recognized by IntI, and recombination between attC and attI leads to the addition and exchange of GCs and further generation of a multi-GC array within the integron structure [15].
Based on the amino acid sequences of IntI integrase, integrons can be divided into different classes, with those carrying intI1 defined as class 1, intI2 as class 2, intI3 as class 3, and so on. Class 1 integrons are the most common type present among Enterobacteriaceae isolates [68]. Class 1 integrons constitute a substantial reservoir of resistance genes that confer a selective advantage upon strong selection pressure imposed by human use of antimicrobial compounds, leading to the horizontal transfer of integron-carrying resistance markers from the community to hospitals and the development of multidrug resistance (MDR) among Enterobacteriaceae, independent of species or isolate origin [68].
The ancestors of class 1 integrons are not considered to be mobile elements, and the connection of class 1 integrons with Tn402 with a complete tniABQC transposition module generates a hybrid structure flanked by the 25 bp terminal inverted repeat initial (IRi) and inverted repeat terminal (IRt), making class 1 integrons capable of self-mobility [13]. The capture and formation of a quaternary ammonium compound resistance (qacEΔ1)-sulphonamide resistance (sul1)-orf5 region occurs immediately downstream of the GC array [13]. Eventually, class 1integrons manifest as a prototype structure organized in order of IRi, a 5′-conserved segment (5′-CS: intI-attI), a central variable region (the GC array), a 3′-conserved segment (3′-CS: qacEΔ1-sul1-orf5-tniABQC), and IRt [13]. Most class 1 integrons from clinical contexts carry modifications at their 5′ and 3′ ends, especially partial or complete deletions of the tniABQC module of Tn402, which impairs their mobility [4, 5]. These integrons are often inserted within mobile DNA elements such as plasmids and transposons, facilitating their rapid spread in the community and within hospitals [4, 5].
This work presents the sequences of six novel class 1 integrons, In0, In1069 and In1287 to In1290, together with the previously characterized In893. These integrons were obtained from clinical Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae isolates. The bla KPC-2-carrying unusual In0 and the bla IMP-30-carrying In1069 coexist in a single Escherichia coli isolate. The detailed genetic characterization of genetically related integrons In1069, In893 and In1287 to In1290 denotes a scheme of stepwise integration or excision of individual GCs to generate these integron variations.

Methods

Bacterial isolates and identification

A total of 139 non-redundant Enterobacteriaceae strains, including Escherichia coli EC6335, Escherichia coli EC4212, Klebsiella pneumoniae KP1262, Enterobacter cloacae ECL2236, Escherichia coli EC7328 and Klebsiella pneumoniae KP5325, were recovered from hospitalized patients with nosocomial infections in a teaching hospital of Taizhou, China, from January 2014 to September 2015. Bacterial species were identified by 16S rRNA gene sequencing [9]. All DNA markers listed in Table 1 were screened by PCR amplification (ThermoFisher scientific, USA) using the listed primers, followed by amplicon sequencing on an ABI 3730 Sequencer (ThermoFisher scientific, USA). PCR was run for 3 min at 94 °C followed by 30 cycles of 1 min of denaturing at 94 °C and annealing at 50 to 59 °C according to various primers, with a final elongation of 10 min at 72 °C on Life Veriti® PCR machine (Invitrogen, USA). The total reaction volume was 20 μL containing 4 μL 5 × PCR buffer, 0.4 μL of 10 mM dNTPs, 1 μL each of 10 μM primers and 0.2 μL Polymerase, with nuclease-free water filled up to 20 μL. PCR amplification and amplicon sequencing were run in according with operation manual.
Table 1
Oligonucleotide primers used in this study
Target
Primer
Primer sequence (5′-3′)
Amplicon
length (bp)
Reference
bla KPC
KPC-F
GTATCGCCGTCTAGTTCTGC
637
[26]
KPC-R
GGTCGTGTTTCCCTTTAGCC
bla IMP
IMP-F
GGAATAGAGTGGCTTAAYTCTC
232
[26]
IMP-R
GGTTTAAYAAAACAACCACC
bla NDM
NDM-F
GGTTTGGCGATCTGGTTTTC
621
[26]
NDM-R
CGGAATGGCTCATCACGATC
bla VIM
VIM-F
GATGGTGTTTGGTCGCATA
390
[26]
VIM-R
CGAATGCGCAGCACCAG
bla OXA-23
OXA-23-F
GATCGGATTGGAGAACCAGA
501
[27]
OXA-23-R
ATTTCTGACCGCATTTCCAT
bla OXA-48
OXA-48-F
TTGGTGGCATCGATTATCGG
744
[28]
OXA-48-R
GAGCACTTCTTTTGTGATGGC
bla OXA-58
OXA-58-F
AAGTATTGGGGCTTGTGCTG
599
[27]
OXA-58-R
CCCCTCTGCGCTCTACATAC
aacA4
aacA4-F
TATGAGTGGCTAAATCGAT
395
[23]
aacA4-R
CCCGCTTTCTCGTAGCA
intI1
intI1-F
GCTGAAAGGTCTGGTCATAC
515
This study
intI1-R
GTTCTTCTACGGCAAGGTG
tniR
tniR-F
CCAGGGTTGGCTGCTTGC
375
This study
tniR-R1
ATCGCCCACCTTGGTTTCC
intI1 to tniR
intI1-F
GCTGAAAGGTCTGGTCATAC
Variable
This study
tniR-R2
ACGCTGATCGTGTGGAAG

Integron cloning and sequencing

For cloning of In0 and In1069, the bla KPC- and bla IMP- positive strain EC6335 was identified by PCR. Plasmid DNA was then isolated from this strain using the AxyPrep Plasmid Miniprep kit (Axygen, USA), digested with BamHI, and ligated into the cloning vector pMD19-T. This was transformed into host bacteria Escherichia coli TOP10, which were screened for bla KPC- or bla IMP- positivity. Inserts within recombinant pMD19-T vectors from the above transformants were sequenced using the primer walking method. For cloning of In893 and In1287 to In1290, the strains EC4212, KP1262, ECL2236, EC7328, and KP5325, each co-harboring the three genes aacA4, intI1, and tniR, were identified by PCR, then DNA fragments were amplified from these strains using the primer pair intI1-F/tniR-R2 and subsequently sequenced as above.

Sequence annotation and comparison

Open reading frames were predicted using RAST 2.0 [10] combined with BLASTP/BLASTN [11] searches against the UniProtKB/Swiss-Prot database [12] and the RefSeq database [13]. Annotation of resistance genes, mobile elements, and other features was carried out using the online databases including CARD [14], ResFinder [15], ISfinder [16] and INTEGRALL [17]. Multiple and pairwise sequence comparisons were performed using MUSCLE 3.8.31 [18] and BLASTN, respectively. Gene organization diagrams were drawn in Inkscape 0.48.1 (https://​inkscape.​org).

Detection of carbapenemase activity

The activity of class A/B/D carbapenemases in bacterial cell extracts was determined via a modified Carba NP test [19]. Overnight bacterial cell cultures in MH broth were diluted 1: 100 into 3 mL of fresh MH broth, and bacteria were allowed to grow at 37 °C with shaking at 200 rpm to reach an OD600 of 1.0 to 1.4. If required, ampicillin was used at 200 μg/mL. Bacterial cells were harvested from 2 mL of the above culture, and washed twice with 20 mM Tris-HCl (pH 7.8). Cell pellets were resuspended in 500 μL of 20 mM Tris-HCl (pH 7.8), and lysed by sonication, followed by centrifugation at 10,000×g at 4 °C for 5 min. A total of 50 μL of the supernatant (the enzymatic bacterial suspension) was separately mixed with 50 μL each of substrates I to V: 50 μL supernatant was added to 50 μL substrate I, then separately 50 μL supernatant was added to 50 μL substrate II, and so on; followed by incubation at 37 °C for a maximum of 2 h. Substrate I: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8); substrate II: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), and 0.6 mg/μL imipenem; substrate III: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), 0.6 mg/μL imipenem, and 0.8 mg/μL tazobactam; substrate IV: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), 0.6 mg/μL imipenem, and 3 mM EDTA (pH 7.8); substrate V: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), 0.6 mg/μL imipenem, 0.8 mg/μL tazobactam, and 3 mM EDTA (pH 7.8).

Bacterial antimicrobial susceptibility testing

Bacterial antimicrobial susceptibility was tested by the MicroScan broth dilution method (MicroScan, USA) and interpreted according to Clinical and Laboratory Standards Institute (CLSI) guidelines [20].

Nucleotide sequence accession numbers

The sequences of In0, In1069, In893, and In1287 to In1290 were deposited in GenBank under accession numbers KP870110, KM589497, KX434463, KX371912, and KX387648 to KX387650, respectively.

Results

Clinical bacterial isolates containing integrons

Escherichia coli EC6335, Escherichia coli EC4212, Klebsiella pneumoniae KP1262, Enterobacter cloacae ECL2236, Escherichia coli EC7328, and Klebsiella pneumoniae KP5325 were determind to harbor class 1 intergrons In0 and In1069, In893, In1287, In1288, In1289, and In1290 (see Additional file 1), respetively. Modular stuctures and sequence comprasion of these integrons and related reference sequences were showed in Figs. 1 and 2. These strains were isolated from diffrent patients from the single hospital.
A 53-year-old male with vomiting, high fever, and septic shock was admitted in the hospital in August 2015. The patient had underlying diabetes, and complained of an infected leg wound. Large doses of vasoactive drugs were needed to maintain his blood pressure, but empirical intravenous antimicrobial administration of teicoplanin plus meropenem was ineffective. Carbapenem-nonsusceptible Escherichia coli EC6335 was subsequently isolated from the wound secretions. The patient was switched to intravenous administration of levofloxacin plus fluconazole based on antimicrobial susceptibility test results. His symptoms associated with infection progressively improved and he was discharged after 10 days of antimicrobial treatment.
Klebsiella pneumoniae KP1262 and Escherichia coli EC4212 were isolated from the blood specimens in the infection unit in July 2015. Both patients complained of suffering high fevers for two to three days, and were diagnosed to have bacteriaemia. Enterobacter cloacae ECL2236 was isolated from the sputum specimens in the respiration medicine unit in January 2014. Escherichia coli EC7328 was recovered from the urine specimens in the urinary surgery ward in September 2015. Klebsiella pneumoniae KP5325 was a cultivated from the sputum in the neurosurgery unit in May 2014. All of these three patients were treated by intravenous administration of ceftriaxone according to the antimicrobial susceptibility test results, and their symptoms associated with infections were gradually recovered after several days of treatments.

Coexistence of In0 and In1069 in Escherichia coli EC6335

PCR screening indicated the presence of blaKPC and blaIMP, but none of the other tested carbapenemase genes blaNDM, blaVIM, blaOXA-23, blaOXA-48, or blaOXA-58, in strain EC6335. Further cloning and sequencing disclosed that EC6335 harbored two novel class 1 integrons: an unusual blaKPC-2-carrying In0EC6335 and a blaIMP-30-carrying In1069. In0EC6335 and In1069 (see Additional file 2) were present in two different BamHI-digested EC6335 DNA fragments, which were independently cloned into pMD19-T and transferred into Escherichia coli TOP10, generating the Escherichia coli transformants In0-TOP10 and In1069-TOP10, respectively.
Strains In0-TOP10 and In1069-TOP10 have class A and B carbapenemase activities, respectively, while EC6335 appears to have class A + B activity (data not shown). All the above strains were resistant to the cephalosporin, carbapenem, and aminoglycoside drugs tested but remained susceptible to the fluoroquinolone drugs tested (Table 2). EC6335 displayed much higher levels of resistance to cephalosporins/carbapenems than In0-TOP10 and In1069-TOP10 (Table 2), which was consistent with the fact that EC6335 harbors two carbapenemase genes, blaKPC-2 and blaIMP-30, while In0-TOP10 and In1069-TOP10 carry only one gene, blaKPC-2 or blaIMP-30, respectively.
Table 2
Antimicrobial drug susceptibility profiles
Category
Antibiotics
MIC (mg/L)/antimicrobial susceptibility
EC6335
(In0+ In1069)
In0-TOP10
(In0)
In1069-TOP10
(In1069)
TOP10
Cephalosporins
Cefazolin
512/R
16/R
256/R
1/S
Ceftazidime
256/R
4/R
128/R
0.5/S
Ceftriaxone
256/R
8/R
128/R
0.5/S
Carbapenems
Ertapenem
16R
8/R
8/R
0.5/S
Meropenem
16/R
8/R
8/R
0.5/S
Imipenem
8/R
4/R
4/R
0.25/S
Aminoglycosides
Netilmicin
256/R
64/R
16/R
2/S
Tobramycin
128/R
32/R
16/R
0.025/S
Amikacin
512/R
128/R
32/R
1/S
Fluoroquinolones
Norfloxacin
0.10/S
0.10/S
0.05/S
0.05/S
Ofloxacin
0.005/S
0.005/S
0.003/S
0.003/S
Ciprofloxacin
0.25/S
0.25/S
0.125/S
0.0125/S
S sensitive; R resistant

Discussion

Genetic futures of novel In0EC6335

In0 EC6335 differs dramatically from the prototype In0 pVS1 (accession number U49101) from the Pseudomonas aeruginosa plasmid pVS1, and they only overlap each other by a majority region of 5′-CS (Fig. 1). In0 pVS1 has a weak PcW promoter and an unoccupied attI site with no gene cassettes, thereby representing an ancestor of more complex integrons [21]. In0 pVS1 possesses an intact 5′-CS, whereas its 3′-CS is disrupted by the insertion of IS1326, leading to the truncation of tniABQC of Tn402 into tniA-tniBD1 [21].
In0 EC6335 contains a strong PcH1 promoter and a truncated GCaacA4’-3 composed of ∆aacA4’-3 and attC aacA4; a bla KPC-2-containing region of Tn6296 has been integrated between the PcH1 promoter and the truncated GCaacA4’-3, and located downstream of the GCaacA4’-3 remnant are a bla TEM-1-containing region of Tn6296 and an ISKpn27- containing region from Tn6296 (Fig. 1). AacA4’-3 (555 bp in length; aminoglycoside resistance) is a derivative of the reference aacA4 gene (accession number AF034958), and encodes the variations Asn5Thr and Leu102Ser compared with aacA4. The ∆aacA4’-3 gene of In0 EC6335 has a 36 bp deletion at its 5′ end. It is most likely that In0 EC6335 originates from a GCaacA4’-3-carrying integron that has recombined with Tn6296, which is one of the major mobile platforms of bla KPC genes in China [2224], and Tn3 as a major mobile platform of bla TEM-1 [2224].

Inferred evolution of In1069 and related integrons in Enterobacteriae

In1069 carries two GCs, GCbla IMP-30 (carbapenem resistance) and GCaacA4’-3, in this order, and its intI1 gene is truncated because of the connection of IS26 at its 3′ end. We also determined the sequences of four genetically related integrons, In893 and In1287 to In1290, from three different Enterobacteriaceae species: Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae (Fig. 2). In1069 and the other four integrons carry PcS and PcH1, which are both strong promoters known to drive GC expression [21].
These integrons appear to have conserved 5′-CS and 3′-CS (tni of Tn402), and possess a core GCaacA4’-3 in which the attC site has an unusual 9 bp deletion (CCCTTCCAT) (Fig. 2). Five more GCs, including GCbla IMP-30, GCaadA16 (aminoglycoside resistance), GCcatB3 (phenicol resistance), GCarr3, and GCdfrA27 (rifampin resistance), are also present in these integrons. The integration/excision of one or more of these GCs upstream/downstream of the GCaacA4’-3 core generates various organizations of GC arrays, which are mediated by the IntI-based, attC-recognizing site-specific recombination system [25]. In893 seems to represent the most primitive form of these integrons. In893, In1069, and In1287 carry one or two different resistance markers, while In1288 to In1290 have evolved to capture the determinants for at least three different classes of antibiotics, mostly likely conferring MDR. These findings provide the insight into stepwise and parallel evolution of In1069-associated integron variations (Fig. 2).

Conclusions

Excessive use of antibiotics causes the spread of MDR Enterobacteriaceae strains in clinical settings, most of which harbor class 1 integrons. The characterization of novel class 1 integrons In0, In1069 and In1287 to In1290 denotes a step-by-step and parallel evolution scheme involving massive genetic changes in integron GC arrays under high levels of antibiotic selection pressure in clinical settings.

Acknowledgements

We are grateful to Professor Thomas Jové (INTEGRALL curator) for his designation of In0, In1069, In893 and In1287 to In1290, all of which are registered in the INTEGRALL database.

Funding

This work was supported by grants from the Special Key Project of Biosafety and Technologies (2016YFC1202600) for the National Major Research and Development Program of China, the Foundation of Department of Science and Technology of Zhejiang Province (2014C33153), the Foundation of Zhejiang Health Department (2014KYB218 and 2017KY717), the Foundation of Taizhou Science and Technology Bureau (14SF05), and the Foundation of Yinzhou Science and Technology Bureau of Ningbo (2015–60).

Availability of data and materials

Please contact author for data requests.
The use of patient specimens and all related experimental protocols were approved by the Committee on Human Research at all the institutions involved in this study. The study was carried out in accordance with the approved guidelines of the Ethics Committee of Taizhou Municipal Hospital affiliated with Taizhou University.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Partridge SR, Tsafnat G, Coiera E, Iredell JR. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev. 2009;33(4):757–84.CrossRefPubMed Partridge SR, Tsafnat G, Coiera E, Iredell JR. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev. 2009;33(4):757–84.CrossRefPubMed
2.
Zurück zum Zitat Domingues S, da Silva GJ, Nielsen KM. Integrons: vehicles and pathways for horizontal dissemination in bacteria. Mobile genetic elements. 2012;2(5):211–23.CrossRefPubMedPubMedCentral Domingues S, da Silva GJ, Nielsen KM. Integrons: vehicles and pathways for horizontal dissemination in bacteria. Mobile genetic elements. 2012;2(5):211–23.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Rowe-Magnus DA, Guerout AM, Mazel D. Bacterial resistance evolution by recruitment of super-integron gene cassettes. Mol Microbiol. 2002;43(6):1657–69.CrossRefPubMed Rowe-Magnus DA, Guerout AM, Mazel D. Bacterial resistance evolution by recruitment of super-integron gene cassettes. Mol Microbiol. 2002;43(6):1657–69.CrossRefPubMed
5.
Zurück zum Zitat Gillings M, Boucher Y, Labbate M, Holmes A, Krishnan S, Holley M, Stokes HW. The evolution of class 1 integrons and the rise of antibiotic resistance. J Bacteriol. 2008;190(14):5095–100.CrossRefPubMedPubMedCentral Gillings M, Boucher Y, Labbate M, Holmes A, Krishnan S, Holley M, Stokes HW. The evolution of class 1 integrons and the rise of antibiotic resistance. J Bacteriol. 2008;190(14):5095–100.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Leverstein-van Hall MA, Blok HE M, Donders AR T, Paauw A, Fluit AC, Verhoef J. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis. 2003;187(2):251–9.CrossRefPubMed Leverstein-van Hall MA, Blok HE M, Donders AR T, Paauw A, Fluit AC, Verhoef J. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis. 2003;187(2):251–9.CrossRefPubMed
7.
Zurück zum Zitat Leverstein-Van Hall MA, Paauw A, Box AT, Blok HE, Verhoef J, Fluit AC. Presence of integron-associated resistance in the community is widespread and contributes to multidrug resistance in the hospital. J Clin Microbiol. 2002;40(8):3038–40.CrossRefPubMedPubMedCentral Leverstein-Van Hall MA, Paauw A, Box AT, Blok HE, Verhoef J, Fluit AC. Presence of integron-associated resistance in the community is widespread and contributes to multidrug resistance in the hospital. J Clin Microbiol. 2002;40(8):3038–40.CrossRefPubMedPubMedCentral
8.
9.
Zurück zum Zitat Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol. 2008;74(8):2461–70.CrossRefPubMedPubMedCentral Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol. 2008;74(8):2461–70.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Brettin T, Davis JJ, Disz T, Edwards RA, Gerdes S, Olsen GJ, Olson R, Overbeek R, Parrello B, Pusch GD, et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep. 2015;5:8365.CrossRefPubMedPubMedCentral Brettin T, Davis JJ, Disz T, Edwards RA, Gerdes S, Olsen GJ, Olson R, Overbeek R, Parrello B, Pusch GD, et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep. 2015;5:8365.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Boratyn GM, Camacho C, Cooper PS, Coulouris G, Fong A, Ma N, Madden TL, Matten WT, McGinnis SD, Merezhuk Y et al: BLAST: a more efficient report with usability improvements. Nucleic Acids Res 2013, 41(Web Server issue):W29–33. Boratyn GM, Camacho C, Cooper PS, Coulouris G, Fong A, Ma N, Madden TL, Matten WT, McGinnis SD, Merezhuk Y et al: BLAST: a more efficient report with usability improvements. Nucleic Acids Res 2013, 41(Web Server issue):W29–33.
12.
Zurück zum Zitat Boutet E, Lieberherr D, Tognolli M, Schneider M, Bansal P, Bridge AJ, Poux S, Bougueleret L, Xenarios I. UniProtKB/Swiss-Prot, the manually annotated section of the UniProt KnowledgeBase: how to use the entry view. Methods Mol Biol. 2016;1374:23–54.CrossRefPubMed Boutet E, Lieberherr D, Tognolli M, Schneider M, Bansal P, Bridge AJ, Poux S, Bougueleret L, Xenarios I. UniProtKB/Swiss-Prot, the manually annotated section of the UniProt KnowledgeBase: how to use the entry view. Methods Mol Biol. 2016;1374:23–54.CrossRefPubMed
13.
Zurück zum Zitat O'Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44(D1):D733–45.CrossRefPubMed O'Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44(D1):D733–45.CrossRefPubMed
14.
Zurück zum Zitat Jia B, Raphenya AR, Alcock B, Waglechner N, Guo P, Tsang KK, Lago BA, Dave BM, Pereira S, Sharma AN, et al. CARD 2017: expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res. 2016; Jia B, Raphenya AR, Alcock B, Waglechner N, Guo P, Tsang KK, Lago BA, Dave BM, Pereira S, Sharma AN, et al. CARD 2017: expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res. 2016;
15.
Zurück zum Zitat Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, Lund O, Aarestrup FM, Larsen MV. Identification of acquired antimicrobial resistance genes. J Antimicrob Chemother. 2012;67(11):2640–4.CrossRefPubMedPubMedCentral Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, Lund O, Aarestrup FM, Larsen MV. Identification of acquired antimicrobial resistance genes. J Antimicrob Chemother. 2012;67(11):2640–4.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006;34(Database issue):D32–6.CrossRefPubMed Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006;34(Database issue):D32–6.CrossRefPubMed
17.
Zurück zum Zitat Moura A, Soares M, Pereira C, Leitao N, Henriques I, Correia A. INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics. 2009;25(8):1096–8.CrossRefPubMed Moura A, Soares M, Pereira C, Leitao N, Henriques I, Correia A. INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics. 2009;25(8):1096–8.CrossRefPubMed
19.
Zurück zum Zitat Chen Z, Li H, Feng J, Li Y, Chen X, Guo X, Chen W, Wang L, Lin L, Yang H, et al. NDM-1 encoded by a pNDM-BJ01-like plasmid p3SP-NDM in clinical Enterobacter Aerogenes. Front Microbiol. 2015;6:294.PubMedPubMedCentral Chen Z, Li H, Feng J, Li Y, Chen X, Guo X, Chen W, Wang L, Lin L, Yang H, et al. NDM-1 encoded by a pNDM-BJ01-like plasmid p3SP-NDM in clinical Enterobacter Aerogenes. Front Microbiol. 2015;6:294.PubMedPubMedCentral
20.
Zurück zum Zitat CLSI. Performance standards for antimicrobial susceptibility testing: twenty-fifth informational supplement M100-S25. CLSI: Wayne, PA, USA; 2015. CLSI. Performance standards for antimicrobial susceptibility testing: twenty-fifth informational supplement M100-S25. CLSI: Wayne, PA, USA; 2015.
21.
Zurück zum Zitat Bissonnette L, Roy PH. Characterization of In0 of Pseudomonas Aeruginosa plasmid pVS1, an ancestor of integrons of multiresistance plasmids and transposons of gram-negative bacteria. J Bacteriol. 1992;174(4):1248–57.CrossRefPubMedPubMedCentral Bissonnette L, Roy PH. Characterization of In0 of Pseudomonas Aeruginosa plasmid pVS1, an ancestor of integrons of multiresistance plasmids and transposons of gram-negative bacteria. J Bacteriol. 1992;174(4):1248–57.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Wang L, Fang H, Feng J, Yin Z, Xie X, Zhu X, Wang J, Chen W, Yang R, Du H, et al. Complete sequences of KPC-2-encoding plasmid p628-KPC and CTX-M-55-encoding p628-CTXM coexisted in Klebsiella Pneumoniae. Front Microbiol. 2015;6:838.PubMedPubMedCentral Wang L, Fang H, Feng J, Yin Z, Xie X, Zhu X, Wang J, Chen W, Yang R, Du H, et al. Complete sequences of KPC-2-encoding plasmid p628-KPC and CTX-M-55-encoding p628-CTXM coexisted in Klebsiella Pneumoniae. Front Microbiol. 2015;6:838.PubMedPubMedCentral
23.
Zurück zum Zitat Feng J, Qiu Y, Yin Z, Chen W, Yang H, Yang W, Wang J, Gao Y, Zhou D. Coexistence of a novel KPC-2-encoding MDR plasmid and an NDM-1-encoding pNDM-HN380-like plasmid in a clinical isolate of Citrobacter freundii. J Antimicrob Chemother. 2015;70(11):2987–91.CrossRefPubMed Feng J, Qiu Y, Yin Z, Chen W, Yang H, Yang W, Wang J, Gao Y, Zhou D. Coexistence of a novel KPC-2-encoding MDR plasmid and an NDM-1-encoding pNDM-HN380-like plasmid in a clinical isolate of Citrobacter freundii. J Antimicrob Chemother. 2015;70(11):2987–91.CrossRefPubMed
24.
Zurück zum Zitat Dai X, Zhou D, Xiong W, Feng J, Luo W, Luo G, Wang H, Sun F, Zhou X. The IncP-6 plasmid p10265-KPC from Pseudomonas Aeruginosa carries a novel DeltaISEc33-associated bla KPC-2 gene cluster. Front Microbiol. 2016;7:310.PubMedPubMedCentral Dai X, Zhou D, Xiong W, Feng J, Luo W, Luo G, Wang H, Sun F, Zhou X. The IncP-6 plasmid p10265-KPC from Pseudomonas Aeruginosa carries a novel DeltaISEc33-associated bla KPC-2 gene cluster. Front Microbiol. 2016;7:310.PubMedPubMedCentral
25.
Zurück zum Zitat Barraud O, Ploy MC. Diversity of class 1 Integron gene cassette rearrangements selected under antibiotic pressure. J Bacteriol. 2015;197(13):2171–8.CrossRefPubMedPubMedCentral Barraud O, Ploy MC. Diversity of class 1 Integron gene cassette rearrangements selected under antibiotic pressure. J Bacteriol. 2015;197(13):2171–8.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119–23.CrossRefPubMed Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119–23.CrossRefPubMed
27.
Zurück zum Zitat Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, Amyes SG, Livermore DM. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27(4):351–3.CrossRefPubMed Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, Amyes SG, Livermore DM. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27(4):351–3.CrossRefPubMed
28.
Zurück zum Zitat Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother. 2012;67(7):1597–606.CrossRefPubMed Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother. 2012;67(7):1597–606.CrossRefPubMed
Metadaten
Titel
Genetic characterization of novel class 1 Integrons In0, In1069 and In1287 to In1290, and the inference of In1069-associated integron evolution in Enterobacteriaceae
verfasst von
Dongguo Wang
Jianfeng Zhu
Kaiyu Zhou
Jiayu Chen
Zhe Yin
Jiao Feng
Liman Ma
Dongsheng Zhou
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Antimicrobial Resistance & Infection Control / Ausgabe 1/2017
Elektronische ISSN: 2047-2994
DOI
https://doi.org/10.1186/s13756-017-0241-9

Weitere Artikel der Ausgabe 1/2017

Antimicrobial Resistance & Infection Control 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.