Background
As of 2018, pancreatic cancer is the fourth leading cause of cancer-related deaths in the USA, with 55,000 new cases and 44,000 deaths reported annually. The mean 5-year survival of patients with pancreatic cancer is less than 8% [
1]. Pancreatic ductal adenocarcinomas (PDACs) account for the vast majority of pancreatic cancer cases and are characterized by highly invasive mucin-producing neoplasms that commonly originate from noninvasive epithelial neoplasia of pancreatic ducts [
2]. Through intensive research efforts, driver mutations have been identified in four genes: the oncogene
KRAS and the tumor suppressors
CDKN2A,
TP53, and
SMAD4 [
3]. Early mutations in
KRAS and
CDKN2A (which encodes the tumor suppressor protein P16) are present in more than 90% of all PDAC cases, whereas late mutations in
SMAD4 and
TP53 are present in approximately half of PDAC cases [
4,
5]. Along with these driver mutations, recent large-scale sequencing and bioinformatic endeavors have implicated other biological processes, such as axon guidance, in the development of PDAC [
6]. Despite the identification of driver mutations and the abundance of genomic data, it has proved difficult to identify novel therapeutically relevant targets, and this is reflected in the extremely poor prognosis of PDAC. More functional research efforts are required to identify therapeutic targets that may lead to new agents to improve the treatment and outcomes of PDAC.
To identify novel therapeutic targets of PDAC, we leveraged a genome-wide CRISPR screening approach that allowed us to quantify gene-specific phenotypic variation in PANC-1 cells in response to gemcitabine, the most commonly used PDAC chemotherapeutic. Genome-wide CRISPR screens are pool-based screening strategies that leverage the unique gRNA sequences and next-generation sequencing (NGS) to identify shifts in gRNA frequency after a phenotypic selection event [
7,
8]. These screens are extremely robust [
9] and have been used to identify genes that are essential for cell survival [
10], that are involved in oxidative phosphorylation [
11], and that confer drug resistance [
12], among other important biological pathways. Gemcitabine is one of the most widely used chemotherapeutics for all stages of PDAC, despite its suboptimal efficacy and the rapid development of chemotherapy resistance. By using the genome-wide CRISPR screening approach, we aimed to identify genes that were essential to the survival of PANC-1 cells (our PDAC model of choice) and/or genes that sensitized PANC-1 cells to low-dose gemcitabine treatment. We then compared the regulatory effects of the identified genes on the survival of PANC-1 cells to their effects in a noncancerous pancreatic cell model, hTert-HPNE cells, and in other PDAC cell lines (AsPC-1, Mia PaCa-2, and HPAF-II) in an effort to identify PDAC pan-essential genes that were not required in normal pancreatic cells.
We validated this screening pipeline for identifying genes essential to several cellular models of PDAC. To that end, we interrogated a top candidate gene, proteasome subunit alpha type-6 (
PSMA6), and confirmed that it is uniquely essential in the PDAC cells tested, but not in the noncancerous HPNE pancreatic cells. We were unable to identify a gene that had a synergistic relation with gemcitabine in all PDAC models, likely because of the multitude of drug transporters involved and the pathways disturbed by gemcitabine [
13,
14].
Methods
Materials
Fetal bovine serum was purchased from HyClone (Logan, UT). Cell culture reagents, fluorescent secondary antibodies, and RNAiMAX transfection reagent were purchased from Invitrogen (Carlsbad, CA). All siRNAs (custom cherry-picked libraries) were purchased from Dharmacon (Lafayette, CO). PSMA6 and 18S TaqMan probes were purchased from Thermo Fisher Scientific (Waltham, MA).
Cell culture
All cell lines were maintained in a humidified incubator at 37 °C in 5% CO
2. PANC-1, hTert HPNE, Mia PaCa-2, HPAF-II, and AsPC-1 cells were purchased from ATCC and used experimentally within five passages. All cell lines were maintained according to ATCC recommendations, and ATCC authenticated the cell lines by short tandem repeat (STR) DNA profiling. The cells were verified to be mycoplasma-free by using the MycoProbe Mycoplasma Detection kit (R&D Systems, Minneapolis, MN). Cas9 stable cell lines were made by virally transducing cells with LentiCAS9-Blast (Addgene, Cambridge, MA; cat. # 52962) [
15] and selecting with 8 μg/mL of blasticidin for 5 days. Expression was verified by Western blot analysis (Additional file
1b).
CRISPR screen
Stable Cas9-expressing PANC-1 cells were transduced with the CRISPR lentiviral library at an experimentally established MOI of 0.3 in the presence of 4 μg/mL of polybrene overnight. The cells were selected with 2 μg/mL of puromycin for 9 days, at which point 1 × 10
8 cells were collected and frozen for genomic DNA isolation. A further 1 × 10
8 cells were grown in the presence of 100 nM gemcitabine for 6 days, after which the cells were frozen for genomic DNA isolation. Sequencing was performed on the Illumina HiSeq 2500 platform (100 bp SE), and raw FASTQ files were deconvoluted by barcode and trimmed of excess nucleotides by using custom scripts on the St. Jude Children’s Research Hospital high-performance computing facility. The resulting amplicons were then analyzed with MAGeCK-VISPR [
16].
Genomic DNA isolation and PCR amplification
Genomic DNA was extracted with QIAamp Blood Maxi kit (Qiagen, cat. # 51192) in accordance with the manufacturer’s protocol. Using a nested PCR program, we generated barcoded amplicons containing the integrated gRNA sequences. Briefly, 10 separate 100-μL redundant reactions were performed, each containing 5 μg of DNA, Premix Ex Taq HS (TaKaRa, cat. # RR030A), and 6 μL of a 10 μM solution of each primer (F1 and R1) (Additional file
2). The first round of the PCR amplification program was as follows: step 1, 95 °C for 1 min; step 2, 95 °C for 30 s; step 3, 55 °C for 30 s; and step 4, 72 °C for 30 s; with steps 2–4 being repeated 15 times. Then, 5 μL of the PCR product was used to seed the second round of PCR, along with Premix Ex Taq HS, 6 μL of the R2 primer, and 6 μL of a 10 μM solution of the F2 primer in a staggered mixture that contained the Illumina adapters and a barcode to identify the sample after sequencing analysis (Additional file
2). The second-round PCR program was as follows: step 1, 95 °C for 1 min; step 2, 95 °C for 30 s; step 3, 63 °C for 30 s; and step 4, 72 °C for 30 s; with steps 2–4 being repeated 17 times.
siRNA confirmation screens
Top CRISPR screen hits were validated and deconvoluted with siRNA (on-target) from Dharmacon. Briefly, siRNA (25 nM) was mixed with 0.09 μL of RNAiMAX and Opti-MEM (Thermo Fischer Scientific). To generate heat maps and movies, 2000 cells were added to each well and the plates were analyzed with an IncuCyte Live Cell Analysis System (Essen BioScience, Inc., Ann Arbor, MI) for 3–5 days (as indicated in the figures), with the confluence of the cells being tracked every 4 h. We used 1 μM staurosporine as a positive control for cytotoxicity, and lipid only and a non-targeting siRNA were used as negative controls, with the data being normalized to these controls. Heat maps were generated after data normalization by using GraphPad Prism (GraphPad Software, La Jolla, CA). siRNAs targeting PSMA6 (sequences AGACUAAACAUUGUCGUUA, CCUCUUGGUUGUUGUAUGA, CUACAGAGGGCACGCUAUCG, and GGUUACUACUGUGGGUUUA) were purchased from Dharmacon (cat. #s J-011360-05, J-011360-06, J-011360-07, and J-011360-08).
RNA extraction and quantitative reverse transcription PCR
RNA was extracted with a Maxwell RSC simplyRNA Tissue Kit and a Maxwell RSC Instrument (Promega, Madison, WI). The RNA concentration was measured with a NanoDrop 8000 UV-Vis Spectrophotometer (Thermo Fisher Scientific). A SuperScript VILO cDNA Synthesis Kit (Life Technologies, Carlsbad, CA) was used to synthesize cDNA according to the manufacturer’s protocol. To determine mRNA expression, Applied Biosystems TaqMan assays (20×), Fast Advanced Master Mix (Life Technologies), and an Applied Biosystems 7900HT Fast Real-Time PCR System (Life Technologies) were used in accordance with the TaqMan Fast protocol. Gene expression was normalized to the 18S rRNA housekeeping gene, which did not vary in its expression during the growth of the cell lines. Each experiment was performed at least three times, and all samples were analyzed in triplicate.
Lentivirus generation and viral transduction
Lentivirus was generated in HEK293T cells (ATCC, Manassas, VA) in 225-cm
2 flasks. Briefly, 22.2 μg of a CRISPR pooled gRNA library (human sgRNA library Brunello in lentiGuide-Puro) transfer vector (Addgene, cat. #73178) [
17], 16.7 μg of psPAX2 plasmid (Addgene, cat. # 12260), and 11 μg of pMD2.G plasmid (Addgene, cat. # 12259) were combined with Lipofectamine 3000 (Thermo Fisher Scientific) in accordance with the manufacturer’s protocol, and the mixture was used to transfect the cells. The virus-containing medium was collected 48 h after transfection and centrifuged at 500×
g for 5 min to remove cells and debris. The supernatant containing the virus was then filtered with a 0.45-μM PES filter and frozen at − 80 °C. Viral transduction was accomplished by adding 150 μL of virus-containing medium per 1 × 10
6 cells (titer determined experimentally, MOI = 0.3) to 225-cm
2 flasks of PANC-1 cells at 75% cellular confluence, along with 4 μg/mL polybrene (Sigma-Aldrich), for 16 h. The virus-containing medium was then replaced with fresh growth medium.
Determination of titer
A series of ten-fold serial dilutions of the lentivirus-containing supernatant was used to determine the MOI. Briefly, in six-well plates, serially diluted lentiviral supernatant (in replicates of six, one plate per concentration) was added, along with 4 μg/mL of polybrene, to 200,000 PANC-1 cells, and the plates were incubated overnight. Twenty-four hours after the transduction, 2 μg/mL of puromycin was added to half of the samples at a given lentiviral concentration. After 3 days, the cells were counted and the counts compared to those for non-puromycin controls. Infection rates were determined as the ratio of cells under puromycin selection to cells not under puromycin selection. Values were plotted, and the volume that corresponded to an infection rate of 30% was used (MOI = 0.3).
Flow cytometry
To determine the stage of apoptotic cell death in control and treated PANC-1 and Mia PaCa-2 cells, we performed flow cytometric analysis on PANC-1 and Mia PaCa-2 cells grown in vitro, using the PE Annexin V Apoptosis Detection Kit I (BD Biosciences, San Jose, CA) in accordance with the manufacturer’s protocol. Briefly, cells were washed twice with cold PBS and resuspended in 1× Binding Buffer at a concentration of 2 × 106 cells/mL. Aliquots of 200 μL of the solution (containing 4 × 105 cells) were transferred to 5-mL round-bottom tubes, then 5 μL of PE Annexin V and 5 μL of 7-AAD cell viability dye were added to the tubes. The cells were gently vortexed and incubated for 15 min. at room temperature while protected from light. Next, 400 μL of 1× Binding Buffer was added to each tube and the samples were immediately analyzed on a custom-configured BD Fortessa cytometry analyzer using FACSDiva software (Becton-Dickinson, San Jose, CA). Data were analyzed using FlowJo software (TreeStar, Ashland, OR). All experiments were performed with at least three biological replicates, and at least 200,000 events were collected per sample.
Stable cell line generation
Three individual pools of Tet-on shRNA stable PANC-1 cells were generated after lentiviral transduction of early passage PANC-1 cells with SMARTvector (hEF1a) inducible
PSMA6 shRNA plasmids (Dharmacon 1255-01EG5687shRNA sequences: TAGAGTCCTAACCACTTCG, GATCTGGAAACTAACGAC, ACAGGTAAGTGGCATCACG). PANC-1 cells were selected with puromycin (2 μg/ml) for 3 days then analyzed for knockdown efficiency and stored with Bambanker Serum Free Freezing Media (Wako Chemicals #302–14,681) in liquid nitrogen vapor phase for future studies. Knockdown efficiency was tested 3 days post doxycycline treatment and mRNA of
PSMA6 was compared to the same stable cell line not treated with doxycycline, ACAGGTAAGTGGCATCACG sequence had a > 80% knockdown of
PSMA6 (Fig.
4f) and was used for subsequent studies. All inducible stable cell lines were maintained in tetracycline screened fetal bovine serum (Hyclone, Logan UT).
Western blot
Alpha tubulin and PSMA6 antibodies were purchased from Cell Signaling Technologies (Boston, MA). Briefly, PANC-1 cells were treated with 25 nM siControl (non-targeting) or siPSMA6 for 72 h, lysed with RIPA buffer, and supernatant was collected for gel electrophoresis. PVDF membrane was probed with alpha tubulin and PSMA6 antibodies and imaged on a Li-Cor FC and bands were analyzed with Li-Cor Odyssey software.
PANC-1 cells stably expressing shRNA targeting PSMA6 were seeded into a round-bottom 96-well plate at a density of 300 cells/well. The medium was changed every 3–4 days, and spheroid images were captured using an IN Cell Analyzer 6000 (GE). Viability was also measured on day 10 by using the CellTiter-Glo 3D Cell Viability Assay (Promega) in accordance with the manufacturer’s protocol, with the results being recorded in luminescence units.
Reactome, gene ontology (GO) analysis, and Kaplan-meier survival plots
All genes that correlated to depleted sgRNAs from the negative-selection (drop-out) CRISPR screen were filtered at a maximum
P-value of 0.05. The scores of the remaining 1073 genes were transformed such that the highest value was represented as 1 in order to assign weight. All statistically significant genes were verified to have a weight greater than 0, and the list and corresponding weights were loaded into Enrichr [
18] for downstream analysis. Enrichment analysis of pathways were obtained by selecting the Reactome Pathways 2016 and EMBL GO Biological Process databases. For transcription factor enrichment analysis, the eXpression2Kinases tool [
19] was used with all default settings. The cBioPortal tool [
20,
21] was used to measure expression of
PSMA6 across available patient samples from the TCGA Research Network:
http://cancergenome.nih.gov/. Kaplan-Meier survival plot was generated using Kaplan-Meier plotter using Pan-cancer RNAseq dataset [
22].
Statistical analysis
MAGeCK-VISPR [
16] was used to rank and sort gRNAs by
P-value and/or FDR (Additional file
3). Data from at least three independent replicated experiments were quantitatively analyzed by two-way ANOVA with the Sidak multiple comparisons test or by Student’s 2-tailed
t-test, using GraphPad Prism 7.0 software, as indicated. All data are represented as the mean ± SD.
Discussion
PDAC is an aggressive cancer that has a poor prognosis because of various factors, including the poor treatment options available [
28]. Although various chemotherapeutic treatment combinations are being tested [
29], most advances in PDAC treatment have been in the areas of early detection and surgical resection of tumors, and there has been little progress in developing effective treatment options for advanced cases [
30]. Therefore, it is vitally important to develop novel treatments for this cancer.
In the present study, we aimed to uncover genes required for PDAC cell growth to potentially reveal novel targets for developing effective anticancer agents. To achieve this, we conducted a genome-wide CRISPR screen in PANC-1 cells, together with validation siRNA screens in several PDAC cell lines. We were unable to achieve both of our original goals- to identify essential genes and genes that would sensitize PDAC cells to gemcitabine. One potential hypothesis is the redundancy of gemcitabine transporters in PDAC cells [
13]. With that said, we were still able to identify a variety of candidate essential genes in several PDAC cell lines.
Gene Ontology (GO) analysis and a pathway analysis revealed that cell-cycle genes were disproportionally enriched among the gene hits and that MYC is a probable upstream transcription factor for many of the identified gene hits. MYC deregulation and activation are involved in many PDAC models, and MYC has been hypothesized to be a potential novel therapeutic [
31]. Additionally, MYC has been implicated in chemosensitization to cisplatin and paclitaxel (Taxol), probably through cell-cycle regulation [
32,
33].
We focused on
PSMA6 because it was the top hit that was not a cycle-regulator or a target of MYC and is an important component of a potentially targetable pathway.
PSMA6, which encodes a subunit of the proteasome, is ubiquitously expressed; although normal pancreas has low (compared to other normal tissues) mRNA expression [
34]. And
PSMA6 is expressed within human PDAC samples and is largely unaltered without mutations (Additional file
8a). Furthermore, we identified
PSMA6 as an essential gene in all the tested PDAC cell lines: PANC-1, Mia PaCa-2, AsPC-1, and HPAF-II. Interestingly, when tested in the noncancerous HPNE cells, siPSMA6 appeared to have little effect, and cells treated with this siRNA grew similarly to controls treated with a non-targeting siRNA (Fig.
2b; Additional file
5b; Additional file
6). All this data taken together indicates that the knockdown of PSMA6 and subsequent very low levels of PSMA6 expression results in cellular death in PDAC cell models. Additionally and in support of PSMA6’s affect in PDAC cells,
PSMA6 also has a similar phenotype in lung cancer and is also dispensable in normal lung tissue [
35].
One major caveat is the fact that all this work is done in vitro. In an attempt to model in
an in vivo environment we decided to use a spheroid assay [
36]. By using spheroid assays and shRNA against
PSMA6, we further validated this gene as being essential for PDAC growth in a 3D environment, further indicating that
PSMA6 may be a viable therapeutic target that warrants further in vivo study. Of significant note, a Kaplan-Meier survival of curve shows high expression of
PSMA6 is associated with a shorter overall survival in PDAC patients (
P = 0.0009) (Additional file
8b).
PSMA6 has also been shown to have an oncogenic role in several cancer types [
35,
37,
38]. And more broadly, the ubiquitin-proteasome degradation pathway has been shown to be critical for cell survival and proliferation. Many cancers have been shown to have an increased sensitivity to perturbations within the proteasome pathway through a variety of mechanisms including dysregulation of short-lived cell cycle proteins and the accumulation of misfolded proteins [
39,
40]. Bortezomib was developed to inhibit the proteasome and is approved for treating multiple myeloma and mantle cell non-Hodgkin lymphoma [
41]. Bortezomib induces apoptosis in pancreatic cancer cells, probably through a host of pathways, including ceramide formation and ER stress [
42‐
44]. Consistent with these studies and with our data on inhibition of
PSMA6, we have shown that PDAC cells are sensitive to bortezomib treatment. Furthermore, bortezomib treatment results in the rapid onset of apoptosis, with a large population of cells entering late apoptosis within 48 h. It is important to note that bortezomib also binds to the β subunits of the 20S proteasome. Variants of the β subunits, specifically β5 [
27], have been associated with resistance in vitro [
45], however these variants are not seen in vivo [
46]. Thus the effects of bortezomib may not be due solely to the inhibition of PSMA6. Additionally, the effects of bortezomib on pancreatic cancer have been shown to be limited to in vitro assays and observable only in combination treatment with other agents, such as gemcitabine [
47‐
49] (Clinical Trial # NCT00052689).
Conclusion
We have identified several potential new essential genes for PDAC through a screening pipeline. This pipeline included a genome-wide CRISPR screen followed by multiple siRNA screens in several PDAC cell models (PANC-1, Mia PaCa-2, HPAF-II, and AsPC-1) and in a noncancerous cell model (HPNE). Lastly, we validated our top identified hit, PSMA6, by using siRNA and inducible shRNA to show that inhibition of this gene induces apoptosis and results in significantly reduced cell viability. Our in vitro work and the Kaplan-Meier plot (shows a negative correlation between PSMA6 mRNA expression and overall survival) both provide compelling evidence that PSMA6 plays a significant oncogenic role. Future work needs to be done to fully assess PSMA6s in vivo oncogenic role. Lastly, we propose future work into the development of a specific PSMA6 inhibitor that could be used in combination with bortezomib or other chemotherapeutic drugs to treat PDAC. We will also pursue the other gene hits identified in our screening pipeline.
Acknowledgements
We would like to thank the members of the Chen lab, Thomas lab, and Evans lab for the valuable discussions and input on the manuscript. We would also like to specifically thank Jing Wu for her support. We thank the Hartwell Center at St. Jude Children’s Research Hospital for their support and guidance, and Dr. Keith A. Laycock (St. Jude Department of Scientific Editing) for editing the manuscript. We thank the following scientists for providing materials through Addgene: Feng Zhang for LentiCAS9-Blast; David Root for the human sgRNA library Brunello in lentiGuide-Puro; and Didier Trono for psPAX2 and pMD2.G.