Skip to main content
main-content

01.12.2017 | Research | Ausgabe 1/2017 Open Access

Virology Journal 1/2017

Genomic organization and recombination analysis of a porcine sapovirus identified from a piglet with diarrhea in China

Zeitschrift:
Virology Journal > Ausgabe 1/2017
Autoren:
Jingjiao Li, Quan Shen, Wen Zhang, Tingting Zhao, Yi Li, Jing Jiang, Xiangqian Yu, Zhibo Guo, Li Cui, Xiuguo Hua
Abbreviations
aa
Amino acid
GIII
Genogroup III
JC
Jukes-cantor
NJ
Neighbor joining
NoV
Norovirus
nt
Nucleotides
ORF
Open reading frame
PCR
Polymerase chain reaction
PCV2
Porcine circovirus type 2
PEDV
Porcine epidemic diarrhea virus
PRV
Porcine rotavirus
PTGV
Porcine transmissible gastroenteritis virus
RdRp
RNA-dependent RNA polymerase
RT-PCR
Reverse transcription polymerase chain reaction
SaV
Sapovirus
UTR
Untranslated region.

Background

Sapovirus (SaV) is the causative agent of gastroenteritis and has been detected in multiple mammalian species and pigs are the predominant host of SaV [13]. Based on the complete capsid protein VP1 sequences, SaV now has been divided into 15 genogroups (GI-GXV) and GIII was the predominant one infecting pigs [4]. GIII strains have been further clustered into several genotypes based on the partial VP1 or RNA-dependent RNA polymerase (RdRp) sequences reported by different researchers [5, 6]. Genomic organization of a common SaV includes two open reading frames (ORF1 and ORF2), whereas in certain genogroups strains were identified an additional ORF (ORF3) [79]. ORF1 encodes the predicted viral NS proteins and the major capsid protein VP1, ORF2 encodes the minor capsid protein VP2, and ORF 3 encodes a small basic protein with unknown function [9].
SaV strains with inconsistent grouping between the nonstructural protein-encoding region (including the RdRp region) and the VP1 encoding region have been designated as “recombinant”. Previous studies suggested that the recombination site was at the polymerase-capsid junction [1, 2]. To date, both intra- and inter-genogroup recombinant strains have been reported in humans, however, few porcine recombinant SaV strains have been reported all over the world [1013]. In particular, no recombinant strain of SaV has been identified either in human or pig in China.
In the present study, we characterized the complete genome of a porcine SaV which might lead to a piglet diarrhea and analyzed the recombination of this strain. Phylogenetic and recombination analysis showed that this strain was an intra-genogroup recombinant, and the breakpoint for this recombination event located at the polymerase-capsid junction within ORF1. This is the first report that intra-genogroup recombination of porcine SaV related with a piglet diarrhea in China.

Methods

Specimens

A fecal sample from a 15-day-old piglet with diarrhea was collected in October, 2015 in Shanghai, China. Bacterial infection was ruled out by the diagnosis of the licensed veterinarian from the pig farm. In order to avoid sample contamination, specimen was obtained directly from the pig anus and disposable materials were used during sampling. Stool sample was freshly collected and immediately converted to 10% (w/v) suspension in phosphate-buffered saline (PBS, 0.01 M, pH 7.2-7.4) for further RNA and DNA extraction.

RNA and DNA extraction

Viral RNA/DNA was extracted from 200 μl of fecal supernatant by using the TaKaRa MinBEST Viral RNA/DNA Extraction Kit version 5.0 (TaKaRa, Japan), according to the manual instruction. RNA/DNA was dissolved in 25 μl RNase-free water and reverse transcription was performed immediately.

RT-PCR or PCR

Polymerase chain reaction (PCR) or reverse transcription polymerase chain reaction (RT-PCR) assays with certain primer sets for the detection of porcine common viruses that may cause pig diarrhea including porcine circovirus type 2 (PCV2), porcine rotavirus (PRV), porcine transmissible gastroenteritis virus (PTGV), porcine SaV, porcine norovirus (NoV), and porcine epidemic diarrhea virus (PEDV) were performed as previously described [1416].

Whole genome amplification

To amplify the genome of this SaV strain, the first strand cDNA was synthetized in 20 μl reaction mixture followed the Thermo Scientific RevertAid First Strand cDNA Synthesis Kit’s (Thermo, USA) introductions with 1 μl random hexamer primer supplied by the kit for the full sequences amplification or 1 μl gene-specific primer QT (Table 1) especially for the 3’ end amplification (3’ RACE method), respectively [17]. Eleven sets of specific primers were designed based on KF204570 to amplify the remaining sequences (Table 1). All the PCR products were purified by OMEGA Gel Kit (OMEGA, USA) following the manufacturer’s instructions, ligated to the pMD19-T vector (TaKaRa, Japan) and then transformed into DH5α competent Escherichia coli cells (Yeasen, China). For each product, three to five colonies were selected and sequenced (Sangon, China) in both directions with the M13+/- universal primers. The consensus sequences were assembled using the Lasergene Software package (version 8) (DNASTAR Inc., Madison, WI).
Table 1
Primers for amplifying the complete genome
Primer name
Primer sequence (5’-3’)
Position
References
SAVP1F
GTGATCGTGATGGCTAATTGC
1-21
JX678943
SAVP1R
GAACTGTTTCAACACTGT
622-639
JX678943
SAVP2F
GGGACATGTGGCAGTAC
533-549
JX678943
SAVP2R
TTGAAGTAGTCCACTATCCACAT
1087-1109
JX678943
SAVP3F
ACTGACAAGTTTGCTGA
862-878
JX678943
SAVP3R
GTGTGGGGCAATTGGTGGT
1660-1678
JX678943
SAV4FW
TTGAATTGTGACCGGCCAGAG
1600-1620
KX688107
SAVP5R
TCATCATACTCATCGTCCCT
2863-2882
JX678943
SAVP6F
CTGAACACCCGTGA
2782-2795
JX678943
SAVP9R
AGCACAGCCATGGCAAAG
4551-4568
JX678943
SAVP10F
CCATAGCCACACTGTGTTCAC
4427-4447
JX678943
SAVP10R
TCTTCATCTTCATTGGTGGGAG
5102-5123
JX678943
SAVP11F
CCAAGGGCAGTGTTTGAC
4963-4980
JX678943
SAVP11R
GGTTGGTACACATAAAGTGCC
5676-5696
JX678943
SAVP12F
GATGTTAGGGCGGTGGA
5620-5636
JX678943
SAVP12R
AGGTGAAAGTGGTGTCTTCTG
6674-6694
JX678943
SAVP13F
CTCGGCACGCACACGGG
6469-6485
JX678943
SAVP13R
TGATTGGCAGGTAAATTTG
6961-6979
JX678943
SAV14N
GATGGAGTTGGCTAAAGAACA
6893-6913
KX688107
QT
CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT
 
[17]
QO
CCAGTGAGCAGAGTGACG
 
[17]
QI
GAGGACTCGAGCTCAAGC
 
[17]

Sequence and recombination analysis

Similarity searches of the sequences were carried out in BLAST (http://​www.​ncbi.​nlm.​nih.​gov/​BLAST/​). After a multiple alignment with CLUSTAL W embedded in MEGA 7, the phylogenetic relationship of the strain in the present study and the reference sequences were assessed using MEGA 7. For analysis in MEGA 7, Jukes-cantor (JC) distance was utilized, employing the Neighbor joining (NJ) algorithm [18]. The reliability of different phylogenetic groupings was evaluated by using the bootstrap test (1000 bootstrap replications) available in MEGA 7. The identification of recombinants was performed by using the Recombination Detection Program 4 (RDP 4) (http://​darwin.​uvigo.​es/​rdp/​rdp.​html) [19]. Prototype SaV strains used as references in the analysis with their corresponding GenBank accession numbers, source of origin and genogroups are showed in Table 2.
Table 2
Profile of porcine sapovirus isolates used for sequence analyses
Strain ID
GenBank accession number
Length
Geographic origin
Genogroup
VZ
DQ056363
1940 bp
Venezuela
GIII
YiY1/2006
EU381231
1635 bp
China b
GIII
OH-MM280/2003
AY823308
2971 bp
USA
GIII
NC-QW270
AY826426
2971 bp
USA
GIII
S20
AB242875
1635 bp
Japan
GIII
HW20/2007
HM346629
2983 bp
South Korea
GIII
DG24/2007
HM346628
3016 bp
South Korea
GIII
ah-1/2009
JX678943
7342 bp
China b
GIII
Cowden
AF182760
7320 bp
USA
GIII
LL14
AY425671
7291 bp
USA
GIII
JJ259
KT922089
7347 bp
USA
GIII
sav1/2008
FJ387164
7558 bp
China b
GIII
CH430/2012
KF204570
7371 bp
China b
GIII
p2a
KX688107
7371 bp
China b
GIII
WG194D-1
KX000383
7496 bp
USA
GV
TYMPo239
AB521771
3949 bp
Japan
GV
TYMPo31
AB521772
3949 bp
Japan
GV
OH-JJ674
KJ508818
7198 bp
USA
GVI
OH-JJ681
AY974192
7198 bp
USA
GVI
RV0042/2011
KX000384
7150 bp
USA
GVII
OH-LL26/2002
AY974195
2952 bp
USA
GVII
K7
AB221130
7144 bp
Japan
GVII
K10
AB221131
2972 bp
Japan
GVII
AB23
FJ498787
3000 bp
Canada
GVII
DO19/2007
HM346630
2983 bp
South Korea
GVII
2014P2
DQ359099
1626 bp
Brazil
GVII
F2-4/2006
GU230161
2935 bp
Canada
GVII
F8-9/2006
GU230162
2926 bp
Canada
GVII
WGP3/2009
KC309420
2933 bp
USA
GVII
WGP247/2009
KC309421
6052 bp
USA
GVII
WG194D/2009
KC309416
6654 bp
USA
GVIII
WG214D/2009
KC309419
7497 bp
USA
GVIII
06-18p3
EU221477
3094 bp
Italy
GVIII
F19-10
FJ498786
3142 bp
Canda
GVIII
WG180B
KC309415
3111 bp
USA
GVIII
WG197C/2009
KC309417
6497 bp
USA
GVIII
WG214C
KC309418
3695 bp
USA
GIX
F16-7
FJ498788
2982 bp
Canada
GIX
K8
AB242873
1617 bp
Japan
GX
2053P4
DQ359100
1635 bp
Brazil
GXI
aThe strain with complete genomic sequence determined in this study
bThe strains which were deposited in GenBank database by Chinese researchers and used in this study were bolded

Results

Result of viruses detection

RT-PCR or PCR were performed to detect the common viruses that may cause pig diarrhea. Result showed that the fecal sample was negative for porcine NoV, PCV 2, PRV, PTGV and PEDV, but was positive for porcine SaV.

Genome organization

The whole genome of p2 strain was determined by RT-PCR and 3’ RACE method. The entire genome of this porcine SaV strain (named as p2, GenBank no. KX688107) consisted of 7387 nucleotides (nt) including the poly (A) tail with a 9 nt 5’ untranslated region (UTR) and a 54 nt 3’-UTR. Similar to previously reported porcine strains, p2 has two ORFs. ORF1 comprised 6,765 nt (10-6774) encoding a single polyprotein of 2,254 amino acid (aa). ORF2 comprised 516 nt (6771–7286) and contained a 4-nt overlapping region (6771ATGA6774) with the 3′ end of ORF1 (Fig. 1).

Phylogenetic and recombination analysis

P2 shared the highest nucleotide homology (91%) through the entire genome and about 94% in the capsid region with CH430 (GIII-3, GenBank no. KF204570) (a Chinese porcine SaV strain), respectively. However, it shared only 87% identity with strain CH430 in the RdRp region. On the contrary, p2 shared the highest 91% nucleotide identity with an American strain JJ259 (GIII-2, GenBank no. KT922089) in the RdRp region, which was opposite to the general phenomenon observed for caliciviruses that the RdRp region is more conserved than the capsid region. In the previous studies, SaV strains with inconsistent grouping between the nonstructural protein-encoding region (including the RdRp region) and the VP1 encoding region were designated as recombinant. All of these suggested that p2 strain may be a recombinant virus.
Phylogenetic and recombination analysis were further performed to verify the genotype definition and recombination. Phylogenetic tree based on 42 of the complete VP1 nucleotide sequences was constructed by the NJ method, in which p2 was grouped into GIII-3 clustering with CH430 (Fig. 2). However, phylogenetic analysis based on the 3’ end of RdRp nucleotide sequences gave a different grouping result, in which p2 was grouped into the GIII-2 clustering with JJ259 (Fig. 3). This finding suggested that this strain may be an intra-genogroup recombinant within GIII. To confirm the finding and detect the breakpoint where the recombination event occurred, we performed recombination analysis with p2 as the query sequence, JJ259 and CH430 as the background sequences and OH-MM280 (GIII-1, GenBank no. AY823308) as the outlier sequence using RPD software. Recombination analysis confirmed that the p2 strain was a recombinant and the major and minor parent was JJ259 and CH430, respectively. Moreover, the breakpoint for this recombination event located at position 5139 nt of the genome, which was the polymerase-capsid junction within ORF1 (Fig. 4).

Discussion

SaV causes acute gastroenteritis in humans and animals including pigs, mink, dogs, sea lions, and bats [4, 9, 20]. Porcine SaV and human strains were separated into a different genogroups, however, based on analyses of RdRp or capsid protein genes, porcine SaV that genetically resembled human strains rather than previously recognized porcine strains had been identified [21, 22]. These findings suggested the possibility of a pig reservoir for human strains or vice versa. Meanwhile, recombination as an important survival event for all living creatures, may result in generation of new viruses with unknown pathogenic potential and altered species tropism for both animals and humans [23]. To date, both intra- and inter-genogroup recombinant strains have been reported [1113, 2224]. So far the recombinant strain was not found in either human beings or animals of China, although the SaV infections in children and pigs were common in this area [2527]. Here, we reported a complete genome of a recombinant SaV strain that identified from a piglet with diarrhea in China. Phylogenetic and recombination analysis based on the genomic sequences showed that p2 was an intra-genogroup recombinant within GIII, and the breakpoint located in the RdRp-capsid junction region, which was consistent with most of other SaV recombination events. Previous reports had shown that, in the genome of SaV, recombination mostly occurred at the polymerase-capsid junction region within ORF 1 which was referred as ‘hot spot’ [2, 13]. Chang et al. detected a 2.2 kb RNA in vitro replication assay with the replication complex of SaV Cowden strain extracted from virus-infected cells suggesting that SaV will generate subgenomic RNA during virus replication [8]. Moreover, researchers found that the RdRp-capsid junction region of SaV contained a highly conserved ~20 nucleotide (nt) motif in both genomic and subgenomic RNA molecules which was considered as a transcription start signal [2]. This conserved nucleotide motif may facilitate homologous recombination during co-infection of a cell by different genogroups of virus.
SaV has been detected in a wide range of mammals with potential ability of zoonotic transmission [2831]. Recombination was considered as a force of evolution which may produce new virus with potentially different pathogenesis and virulence [32]. Moreover, an infectious NoV chimera comprising the distinct biological properties from the parental viruses has been constructed and is infectious in vivo [32, 33]. Therefore, detection and understanding the recombination of SaV is important. In the current study, p2 strain was identified from a pig with diarrhea, in which bacteria and the common enteric viruses that cause pig gastroenteritis were ruled out. This suggested that this recombinant virus may cause this piglet diarrhea under the nature condition. More researches such as experimental infection should be performed in the future to confirm the pathogenicity of this recombinant strain.

Conclusions

This is the first report that an intra-genogroup recombinant porcine SaV infected piglet in China and may lead to the piglet diarrhea. This finding raised our awareness of whether recombination in SaV will increase its virulence.

Funding

This study was funded by the National Natural Science Fund of China (Grant No.31270186, 31572525 and 31402211); The Natural Science Foundation of Jiangsu Province (No. BK20140578), China Postdoctoral Science Foundation (No. 2013 M530234; The Ph.D Programs Foundation of the Ministry of Education of China (No. 20133227120010); Jiangsu Planned Projects for Postdoctoral Research Funds, (No. 1301142C).

Availability of data and materials

All the data supporting the results are included in the article.

Authors' contributions

XGH, QS and JJL conceived the study and designed the experiments. JJL and QS performed the laboratory assays, analyzed the data and drafted the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 1/2017

Virology Journal 1/2017 Zur Ausgabe


 

Neu im Fachgebiet Innere Medizin

Meistgelesene Bücher aus der Inneren Medizin

2017 | Buch

Rheumatologie aus der Praxis

Entzündliche Gelenkerkrankungen – mit Fallbeispielen

Dieses Fachbuch macht mit den wichtigsten chronisch entzündlichen Gelenk- und Wirbelsäulenerkrankungen vertraut. Anhand von über 40 instruktiven Fallbeispielen werden anschaulich diagnostisches Vorgehen, therapeutisches Ansprechen und der Verlauf …

Herausgeber:
Rudolf Puchner

2016 | Buch

Ambulant erworbene Pneumonie

Was, wann, warum – Dieses Buch bietet differenzierte Diagnostik und Therapie der ambulant erworbenen Pneumonie zur sofortigen sicheren Anwendung. Entsprechend der neuesten Studien und Leitlinien aller wichtigen Fachgesellschaften.

Herausgeber:
Santiago Ewig

Mail Icon II Newsletter

Bestellen Sie unseren kostenlosen Newsletter Update Innere Medizin und bleiben Sie gut informiert – ganz bequem per eMail.

© Springer Medizin 

Bildnachweise