Hdac7 promotes lung tumorigenesis by inhibiting Stat3 activation

Hdac7 PB (PiggyBac) heterozygote mutant mice (thereafter called Hdac7 ^+/− mice or Hdac7 mutant mice), carrying an Hdac7 mutant allele disrupted by insertion of a PB transposon in the intron between exon 1 and 2, was generated on the FVB/NJ background. Mapping information of PB insertion in Hdac7 gene can be found in the PB mice database (http://​idm.​fudan.​edu.​cn/​PBmice). LSL-K-Ras ^G12D mice (Stock No. 008179) were previously described [29] and LSL-K-Ras ^G12D allele was introduced into FVB genetic background through breeding with FVB mice for more than six generations (therefore called K-Ras mice or control mice). Hdac7 ^+/− mice were crossed with K-Ras mice to generate Hdac7 ^+/−/K-Ras mice. All mice were maintained on 12/12-h light/dark cycles. Experiments were conducted with consent from the Animal Care and Use Committee of the Institute of Developmental Biology and Molecular Medicine at Fudan University, Shanghai, China.

Lung tumors were induced by the method described previously [30]. Briefly, 6-weeks-old Hdac7 ^+/−/K-Ras and control mice were infected with 5 × 10⁷ plaque-forming units (PFU) of adenovirus (Ad-Cre) expressing Cre by intranasal inhalation, or 10⁶ transforming unit (TU) of lentivirus (lenti-Cre or lenti-Cre-2A-dnStat3) by tracheal instillation. Six weeks later, mouse lungs were retrieved and tumors on mouse lung surface were counted under dissection microscope. For tumor burden analysis, lungs were perfused through the trachea with 4% paraformaldehyde and fixed overnight followed by standard procedures for paraffin sections and H&E staining. Twelve randomly selected, lung sections/mice were scanned for 6 mice each genotype, total lung area occupied by tumor was measured and tumor burden was calculated as (area of lung section occupied by tumor)/(total area of section) in μm² using Image J (NIH, Bethesda, MD, USA).

pFUW-Cre: A Cre fragment from MIGR1-Cre was cloned into of pFUGW to replace EGFP fragment. Plasmid pFUW-Cre-2A-dnStat3: A Cre fragment from pCS4-Cre and P2A–dnStat3 fragment from pCS4-dnStat3 were cloned into pFUGW to replace EGFP fragment. Plasmid pCMV6-Stat3-Flag: a PCR fragment of Stat3 was cloned into pCMV-Entry and in-frame fused to Flag tag. Plasmid pcDNA3.1-GST-Hdac7 (aa445–938): PCR fragments of GST and Hdac7 (aa 445–938) or Hdac7AWA (aa 445–938) were cloned into pcDNA3.1 and in-frame fused to Myc tag. Plasmid pLKO.1-shHDAC7: The selected ShHDAC7 targeting sequences were synthesized and cloned into pLKO.1. They are: shHDAC7 #1: ATCCGGGTGCACAGTAAATA, shHDAC7 #2: AAGTAGTTGGAACCAGAGAA, shHDAC7 #3: TCACTGACCTCGCCTTCAAAG.

293T cells were cultured in as described [31]. Human lung cancer cells A549, H1299, H2009 and H522 were cultured in RPMI 1640 with 10% FBS. Ad-Cre was prepared and titrated as previously described [32]. Recombinant lentiviruses were generated by co-transfecting lentivirus expression vectors and package plasmids (pCMV-VSV-G, pRSV-Rev and pMDLg/pRRE) into 293T cells and harvested 48 h later. Harvested lentiviruses for knockdown experiments were stored at −80 °C or directly used to infect human lung cancer cell lines. Hdac7-silencing or scrambled cells were selected with puromycin. Lentiviruses for infecting mice were further concentrated by PEG 6000 as described previously [33]. TU of lenti-Cre and lenti-Cre-2A-dnStat3 was determine by infecting 293T cells carrying LSL-EGFP transgenes followed the methods published [33].

Cells were plated at a density of 5000 cells/well in 96-well plate and cultured for desired time periods. The medium was then replaced by 200 μl of fresh RPMI 1640 and 20 μl MTT (5.0 mg/ml) and incubated for 4 h at 37 °C. 100 μl/well DMSO was added before reading OD 570 on a plate reader (Bio-Rad, Hercules, CA, USA).

H1299 cells infected shHAC7 or scrambled lentivirus were gently dissociated with trypsin/EDTA and stained for annexin V and 7AAD using the eBioscience™ Annexin V Apoptosis Detection Kit APC (#88–8007-74, Thermo Fisher Scientific) according to manufacturer’s instructions. The stained cells were immediately analyzed by flow cytometry (FACSCalibur, BD Biosciences). All annexin V positive cells were counted as apoptotic cells.

Soft agar assay was performed as previously described [34]. Briefly, cells were plated at a density of 500 cells/well in 6-well plates and cultured for 14–21 days. Colonies were stained with MTT and counted using Colony Counter software (Tanon, Shanghai, China).

Total RNA was extracted from wild type (wt) and Hdac7 mutant mouse lung tissue with TRIzol (Invitrogen, Carlsbad, CA, USA). Quantitative RT-PCR was performed with TaKaRa RNA PCR kit (TaKaRa, Dalian, China) and with Fast SYBR Green QPCR Master Mix on Mx3000P (Stratagene, San Diego, CA, USA) according to the manufacturer’s instructions and data were analyzed with the MxPro software. Expression of Gapdh was used as an internal control. The primer sequence is: Hdac7-F: CCCAGTGTGCTCTACATTTCCC, Hdac7-R: CACGTTGACATTGAAGCCCTC.

Antibodies against the following proteins were used for our studies: HDAC7 (#ab53101) and AKAP12 (#ab49849) from Abcam (Cambridge, UK); acetylated lysine (#9441), STAT3 (#8768), Phospho-STAT3 (Tyr705)(#9145), Acetyl-Stat3 (Lys685)(#2523), JAK1(#3344), JAK2(#3230), PKC(#2056), p53(#2524) from Cell Signaling (Danvers, MA, USA); anti-HA(#H3663), anti-FLAG(#F1804) and anti-β-Actin(A3854) from Sigma-Aldrich (St Louis, MI, USA); Myc (#SC-40) from Santa Cruz (Santa Cruz, CA, USA).

Standard Western blot protocol was adopted. Images were acquired with Tanon-5200 and the density of bands was determined with Image J. The methods for immunoprecipitation was previously described [31].

pCDNA3.1-GST-Hdac7(aa445–938), pCDNA3.1-GST-Hdac7(aa445–938)-AWA and pCMV6-Stat3-Flag were transfected into 293 T cells separately. Cells were lysed with RIPA (Radio immunoprecipitation assay) buffer 48 h after transfection. GST-Hdac7(aa445–938) and GST-Hdac7(aa445–938)-AWA fusion proteins were purified using Glutathione Sepharose 4B (#17–0756-01 GE Healthcare), and Flag-tagged Stat3 was purified with ANTI-Flag M2 Affinity Gel (#A2220, Sigma) and eluted with 3X FLAG peptide (#F4799, Sigma). For in vitro pull-down assays, purified proteins were incubated together in Nonidet P-40 lysis buffer [31] for 1.5 h, followed by washing with PBS for three times, and finally analyzed by Western blot.

In vitro deacetylation assay was performed as described previously [35] with some modification. In brief, 0.5 μg purified Stat3 protein from 293 T cells was incubated with 0.5 μg purified GST-Hdac7(aa445–938) or GST-Hdac7(aa445–938)-AWA fusion proteins in deacetylation buffer (15 mM Tris–HCl, pH 8.0, 10 mM NaCl, 0.25 mM EDTA, 10 mM 2-mercaptoethanol, 10% (v/v) glycerol) for one hour at 37 °C. The reaction products were subjected to Western blot with anti-acetylated lysine antibody.

Clinical lung cancer samples obtained from Huashan Hospital, Fudan University, Shanghai, China were used for immunoblot analysis.

For prognosis analysis of lung cancer patients, gene expression representative as FPKM (fragments Per Kilobase of transcript per Million mapped reads) derived from RNA-seq were downloaded from the TCGA project (https://​portal.​gdc.​cancer.​gov/​). Kaplan-Meier survival analysis and Cox’s proportional hazards regression were conducted by survival package in R (version: 3.2.3). Prognosis effect from HDAC7 was estimated by Peto & Peto modification of the Gehan-Wilcoxon test and conducted by survdiff function from survival package (R). Hazard ratio (HR) and corresponding 95%CI were estimated with Cox’s proportional hazards regression.

To investigate the role of Hdac7 in lung cancer, we first verified Hdac7 expression in wt and Hdac7 ^+/− mouse lung tissues. The results showed that both Hdac7 mRNA and protein levels were reduced by more than 50% in Hdac7 ^+/− mice compared to wt mice (Fig. 1a and b left panel). Then, Hdac7 ^+/− mice were crossed with K-Ras transgenic mice, the most frequently used mouse model for lung cancer [29]. The resulting Hdac7 ^+/−/K-Ras mice and control K-Ras mice were administrated with Ad-Cre to induce lung tumors (see Methods). The results showed that total tumor numbers on mouse lung surface (Fig. 1c) and tumor burden (Fig. 1d) were markedly reduced in Hdac7 ^+/− /K-Ras mice compared with control mice. Immunoblotting also demonstrated again that Hdac7 expression in Hdac7 ^+/− mouse lung tumors was dramatically decreased (Fig. 1b right panel). These results suggest that Hdac7 mutant notably inhibits mouse lung tumorigenesis.

Cell proliferation and apoptosis play critical roles in cancer development. However, previously reported results about the role of HDAC7 in regulating cell proliferation of normal human umbilical vein endothelial cells (HUVEC) and human cancer cell lines are controversial [36‐38] and the functions of HDAC7 in apoptosis of different cells also appear varied [13, 39, 40]. To understand the cellular mechanism(s) by which Hdac7 mutant suppresses lung tumorigenesis, we evaluated cell proliferation and apoptosis in lung tumors of Hdac7 ^+/−/ K-Ras and control mice. Our in vivo EdU-pulse labeling experiments showed that cell proliferation was dramatically decreased in Hdac7 ^+/− /K-Ras tumors (Fig. 2a). Our TUNEL assay also revealed that apoptosis in Hdac7 ^+/− /K-Ras tumors was substantially increased (Fig. 2b). Consistent with the results of TUNEL and EdU labeling assay, more caspase-3 cleavage and less p-Histone H3 was observed in Hdac7 ^+/−/K-Ras tumor cells respectively (Fig. 2c). Taken together, these data strongly suggest that Hdac7 mutant can inhibit mouse lung cancer via attenuating cell proliferation and promoting apoptosis.

Since in vivo study demonstrates that HDAC7 functions as an oncogenic factor in mouse lung cancer, we further reasoned that reduction of HDAC7 expression in human lung cancer cells could inhibit their growth. To verify this possibility and exam the biological impact of HDAC7 depletion on human lung cancer cells, we silenced HDAC7 expression by lentivirus-mediated shRNA in two human lung cancer cell lines (H1299 and H522) with wt K-RAS and two human lung cancer cell lines (A549 and H2009) with a mutant K-RAS to mimic the conditions of our mouse study (Fig. 3a and Additional file 1: Figure S1B). The growth of H1299 and A549 cells expressing shHDAC7 was significantly inhibited (Fig. 3b). Annexin V assay showed that HDAC7 knockdown resulted in significant enhanced apoptosis of human lung cancer cells (Fig. 3c and d). Moreover, soft agar colony formation assay revealed that shHDAC7 markedly suppressed colony formation of H1299 and A549 cells in soft-agar (Fig. 3e and f). These results indicate that suppressing HDAC7 expression in human lung cancer cells may restrain human lung cancer development.

Knockdown HDAC7 in multiple human cancer cell lines resulted in suppression of cell growth by down regulating c-MYC expression and up regulating p21 and p27 expression [38]. HDAC7 has also been shown to protect neurons from apoptosis by inhibiting c-JUN expression [39]. To investigate whether Hdac7 may regulate the proliferation and apoptosis of lung cancer cells by similar mechanisms, the expression of c-Myc, p21 and c-Jun in mouse lung tumors of Hdac7 ^+/− /K-Ras mice were evaluated by immunoblotting. The results showed that the protein levels of c-Myc, c-Jun and p21 were not considerably changed in Hdac7 ^+/− /K-Ras lung tumors compared with the control K-Ras lung tumors (Additional file 1: Figure S1A).

Since HDAC7 silencing was reported to result in activation (phosphorylation of Tyr705) of STAT3 in HUVEC [41], we ask whether Hdac7 deficiency could also enhance STAT3 phosphorylation in mouse and human lung tumor cells. Indeed, our studies showed that Stat3 tyrosine phosphorylation, but not Stat3 protein level, was markedly increased in lung tumors from Hdac7 ^+/− /K-Ras mice compared to that in lung tumors from control mice (Fig. 4a). Similar results were also observed in multiple human lung cancer cell lines such as H1299, H2009, H522 and A549, expressing shHDAC7 (Fig. 4b, Additional file 1: Figure S1B). Consistent with the above results, STAT3 phosphorylation was significantly decreased without obvious change of Stat3 protein level when exogenous Hdac7 was expressed in H1299 (Fig. 4c). These results demonstrate that Hdac7 negatively regulates Stat3 phosphorylation (activity) without affecting its protein level in mouse and human lung cancer cells.

STAT3 constitutive activation is usually associated with tumor promoting [16]. However, high pY-STAT3 was reported to be highly correlated with a better prognosis for some human cancers [19‐21] and Stat3 can function as a tumor suppressor in Apc mice [22] and in K-Ras mice [23]. Here we also show that elevated Stat3 phosphorylation is correlated with suppression of lung tumor in Hdac7 ^+/− /K-Ras (Fig. 1c and d). Based on the above information, we hypothesized that Hdac7 mutant inhibits lung tumorigenesis in Hdac7 ^+/− /K-Ras mice via activating STAT3. To test our hypothesis, we investigated if expression of Stat3 ^Y705F , a dnStat3, could rescue lung tumor-suppression role of Hdac7 mutant in mice. Two lentiviruses, Lenti-Cre expressing Cre only and Lenti-Cre-2A-dnStat3 co-expressing Cre and dnStat3, were constructed. We first verified that expression of dnStat3 completely abolished enhanced phosphorylation of Stat3 in Hdac7-depleted H1299 cells infected by Lenti-Cre-2A-dnStat3 (Fig. 5a, compare lane 4 with lane 2). Then, by tracheal instillation, Hdac7 ^+/− /K-Ras mice and control K-Ras mice were infected separately with Lenti-Cre or Lenti-Cre-2A-dnStat3, respectively. We found that in the Lenti-Cre infected group, Hdac7 mutant dramatically inhibited lung cancer development, however, in Lenti-Cre-2A-dnStat3 infected group, neither tumor number on lung surface (Fig. 5b) nor tumor burden (Fig. 5c) were significantly different between Hdac7 ^+/− /K-Ras mice and control K-Ras mice. These results demonstrate that lung tumorigenesis is significantly enhanced in Hdac7 ^+/− /K-Ras mice after enforced expression of dnStat3, that is, that expression of dnStat3 rescues Hdac7-mutant-mediated suppression phenotype of lung tumor in mice. Therefore, we conclude that Hdac7 mutant suppresses lung tumorigenesis in mice by activating Stat3 proteins.

To verify if STAT3 also plays a role in human tumor cell growth regulated by HDAC7, we tested whether expression of dnStat3 was able to rescue the growth suppression mediated by HDAC7 depletion in human lung cancer cell lines. Cell proliferation assay showed that Hdac7-depleted H1299 cells grew significantly slower than scrambled H1299 cells when they both were infected with control lentivirus; however, this growth inhibition was recovered or partially recovered (Fig. 5d) when Hdac7-depleted H1299 cells were infected lentivirus expressing dnStat3. We also found that dnStat3 expression also partially restored the capacity of colony formation of H1299 cells in soft agar that was suppressed by HDAC7 depletion (Fig. 5e). These results suggest that HDAC7 may also regulate the growth of human lung cancer cells by inhibiting STAT3 activity.

STAT3 phosphorylation is regulated by JAK, Src, PKC kinases [16]. It has been reported that silencing HDAC7 in glioblastoma (GMB) cell U87 enhanced STAT3 phosphorylation by upregulating JAK1 expression [42]. However, our immunoblotting analysis showed that the expression of JAK1, JAK2 and PKC was not significantly altered when HDAC7 expression was depleted in human lung cancer cell line H1299 (Additional file 1: Figure S1C).

STAT3 acetylation can be modulated by histone acetyl transferases/HDACs, e.g. p300/HDAC3, affect its dimerization, DNA binding and transactivation [14]. Also, the STAT3 mutated at key acetylation sites impairs tyrosine-phosphorylation of STAT3 [15]. HDAC7 was reported to repress STAT3 transcriptional activity by forming a complex with histone acetyltransferase Tip60, but there were no provided detailed mechanism(s) [43]. Therefore, we hypothesized that HDAC7 negatively regulates STAT3 activity by deacetylating STAT3. To test our hypothesis, we first evaluated STAT3 acetylation status in both lung tumors from Hdac7 ^+/− /K-Ras mice and HDAC7-depleted human lung cancer cell lines. The result revealed that Stat3 acetylation was significantly elevated in Hdac7 ^+/− mouse lung tumors (Fig. 6a) and HDAC7-depleted H1299 (Fig. 6b) and A549 cells (Additional file 1: Figure S1E). We also found that the STAT3 acetylation was decreased when exogenous Hdac7 was expressed in human cancer cells, H1299 (Fig. 6c) and A549 (Additional file 1: Figure S1F). Next, we examined if Hdac7 and Stat3 proteins interacted each other. Our study showed that not only exogenous Stat3 and Hdac7 proteins expressed in 293T cells (Fig. 6f and g) were co-immunoprecipitated reciprocally, but also endogenous STAT3 and HDAC7 proteins in human lung cancer cells and mouse lung tumors from control K-Ras mice (Fig. 6d and e). This suggests that Hdac7 may directly interact with Stat3 and catalyzes its deacetylation. To further verify this possibility, we performed pull-down assay and in vitro deacetylase assay using affinity purified Flag-tagged Stat3 protein and GST-Hdac7 fusion protein. Since we failed to purify full length GST-HDAC7 fusion proteins and ~500 aa C-terminal domain of HDAC7 has deacetylase activity [44], C-terminal domain (aa 445–938) of mouse Hdac7 protein (NP_​062518) was fused to GST and used for the following two experiments. The pull-down assay disclosed that both GST-Hdac7(aa445–938) and GST-Hdac7(aa445–938)-AWA (a mutant Hdac7 lacking of deacetylase activity [45]), but not GST, bound to Stat3 (Fig. 6h). Our in vitro deacetylase assay also showed that purified GST-Hdac7(aa445–938) but not GST-Hdac7(aa445–938)-AWA, dramatically reduced the acetylation of purified Flag-Stat3 (Fig. 6i). Taken together, these results strongly suggest that the Hdac7 protein directly interacts with and deacetylates Stat3, which in turn regulates Stat3 phosphorylation.

To further investigate the effects of HDAC7 on human lung cancer, we examined HDAC7 protein level in 33 human lung tumors. HDAC7 expression was upregulated in 15 samples (~45.5%) and down-regulated in 10 samples compared to that in tumor-adjacent tissues, while no HDAC7 protein could be detected in both lung tumors and tumor-adjacent tissue from 8 patients (~24.2%) (Fig. 7a and b). To further gain insight into the role of HDAC7 in human lung cancer, gene expression data of 484 lung cancer patients were collected from TCGA (the Cancer Genome Atlas) for integrated analysis to assess correlation between HDAC7 expression and human lung cancer prognosis. As shown in Fig. 7c, Kaplan-Meier survival analysis showed low HDAC7 (< median) is a significant good prognosis factor (p < 7.8 × 10⁻⁵, X ²  = 15.6, df = 1, Gehan-Wilcoxon test) compared with HDAC7 high expression (> median) in overall patients with HR = 1.46 (95%CI: 1.00–2.13, p = 0.048). Collectively, these results suggest that up-regulation of HDAC7 expression function as an oncogenic factor for human lung cancer development.