Background
Pneumonia is one of the most serious infectious diseases, with high morbidity and mortality. In 2015, pneumonia killed an estimated 922,000 children under 5 years of age, accounting for 15% of all child deaths.
Mycoplasma pneumoniae is a major bacterial pathogen of the airways that causes acute and chronic infections of the respiratory tract and accounts for approximately 10–40% of all lower respiratory tract infections including community-acquired pneumonia (CAP) [
1,
2]. Children under 5 years of age usually suffer from mild upper respiratory symptoms, while older children and adolescents develop bronchopneumonia and require hospitalization [
3].
Several mechanisms, including intracellular localization, direct cytotoxicity, and inflammation response activation through Toll-like receptors (TLRs) leading to pro-inflammatory cytokine-mediated tissue injury, play essential roles in the pathogenesis of pneumonia [
4‐
6]. The symptoms of
M. pneumoniae pneumonia (MPP) are correlated with the induction of pro-inflammatory cytokines [
7]. Excessive inflammatory responses induced by
M. pneumoniae play vital roles in the pathogenesis of CAP including refractory
M. pneumoniae pneumonia (RMPP) [
8].
RMPP presents with clinical and radiological deterioration despite macrolide antibiotic therapy for ≥7 days [
9], and can develop into severe life-threatening pneumonia. IL-10 and IFN-γ may have important roles in RMPP [
10].
The mechanism for the excessive inflammatory responses in RMPP has not been fully elucidated. High-mobility group box protein 1 (HMGB1) is an actively secreted cytokine produced by macrophages and other inflammatory cells during innate immune responses to invasion [
11]. Like other members of the pro-inflammatory cytokine family, biologically active HMGB1 can be expressed on the plasma membrane or released by activated inflammatory cells to accumulate in vivo during infection. HMGB1 is related to epithelial barrier destruction, organ dysfunction, and even death through its activation of immunocompetent cells to produce some pro-inflammatory factors (such as TNF-α, IL-1) [
12]. A previous study demonstrated that surfactant protein-A can inhibit mycoplasma-induced dendritic cell maturation through regulation of HMGB1 cytokine activity to minimize lung inflammation [
13]. Thus, HMGB1 may play a role in the inflammatory responses during
M. pneumoniae infection. To our knowledge, there are no reports on HMGB1 expression in children with RMPP.
The present study aimed to explore the role and clinical significance of HMGB1 in children with RMPP or non-RMPP (NRMPP) and the potential mechanism of HMGB1 expression, and to provide new clues for MPP prevention and treatment.
Methods
Patients
Children diagnosed with CAP were enrolled from January 2013 to December 2015 in the Children’s Hospital of Soochow University. The age range was 1 month to 14 years. All patients underwent chest radiography and M. pneumoniae tests including specific IgM in peripheral blood by ELISA and specific DNA fragments in nasopharyngeal aspirates by real-time PCR. The exclusion criteria for the study were: (1) patients with congenital heart diseases, hereditary metabolic diseases, neurological disorders, bronchopulmonary dysplasia, and immunodeficiency; (2) patients co-infected with other pathogens.
Finally, a total of 452 hospitalized children with MPP on the basis of either specific IgM in a blood test or positive PCR result combined with chest radiography and physical examination [
14] were enrolled during the study period. All of the chest radiographs were reviewed by an experienced radiologist. Data for clinical manifestations and laboratory tests during the disease course were obtained. RMPP cases were defined as those showing clinical and radiological deterioration despite appropriate antibiotic therapy for ≥7 days [
9]. Twenty-four children who underwent selective surgery were chosen as healthy controls. The study was approved by the Institutional Review Board of the Children’s Hospital of Soochow University.
Serology of M. pneumoniae
Specific antibodies against M. pneumoniae (IgM and IgG) were detected in serum samples from the children during the acute phase (upon admission) and convalescent phase (upon discharge) using a commercial ELISA kit (Shenzen YHLO Biotech, Shenzhen, China) according to the manufacturer’s instructions. Acute M. pneumoniae infection was defined as either a single positive serum IgM titer (cut-off 1.1 S/CO) or a 4-fold increase in IgG titer (cut-off 24 RU/mL) in the convalescent serum sample.
Real-time PCR for M. pneumoniae detection
A real-time PCR procedure (Daan Gene Co. Ltd., Guangzhou, China), which was approved by the State Food and Drug Administration of China, was used to detect
M.
pneumoniae in real time [
15]. Briefly, one sample of nasopharyngeal aspirate was shaken for 30 s and centrifuged at 15,000×
g for 5 min. The sediment was collected and DNA was extracted from a 400-μl aliquot in accordance with the manufacturer’s instructions. PCR amplification was performed using primers and probes purchased from Daan Gene Co. Ltd. in a 7600 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The PCR conditions were as follows: 93 °C for 2 min; 10 cycles of 93 °C for 45 s and 55 °C for 60 s; 30 cycles of 93 °C for 30 s and 55 °C for 45 s. Quantitative curves were drawn with standard control samples at several concentrations.
M. pneumoniae-positive samples were defined as those with DNA concentrations exceeding 2.5 × 10
3 copies/ml to exclude
M. pneumoniae colonization.
Detection of TNF-α and IL-6 by ELISA
Peripheral blood was collected on admission and the plasma supernatant was stored at − 70 °C after centrifugation. TNF-α and IL-6 ELISA kits were purchased from Multi Science Company. All procedures were conducted according to the manufacturer’s instructions.
Preparation of lipid-associated membrane proteins (LAMPs) from M. pneumoniae
M. pneumoniae strain M129 was purchased from the Institute of Pathogen Biology (Medical College of University of South China). M. pneumoniae was grown in SP4 broth for 72 h at 37 °C, centrifuged at 10,000×g for 20 min, resuspended in saline to yield 1 × 108 CFU/50 μl, and frozen at − 80 °C until extraction of LAMPs. Briefly, the M. pneumoniae pellet was suspended in Tris-buffered saline containing 1 mM EDTA (TBSE), solubilized by addition of Triton X-114 to a final concentration of 2%, and incubated at 4 °C for 1 h. The lysate was then incubated at 37 °C for 10 min for phase separation. After centrifugation at 10,000×g for 20 min, the upper aqueous phase was removed and replaced with the same volume of TBSE. The phase separation procedure was repeated twice. The final Triton X-114 phase was resuspended in TBSE to the original volume, and 2.5 volumes of ethanol were added to precipitate membrane components after overnight incubation at − 20 °C. After centrifugation, the pellet was suspended in phosphate-buffered saline and sonicated for 30 s at output 5 (Sonics, USA). The protein concentration of the final suspension was measured with the Coomassie Protein Assay Regent (Pierce, Rockford, IL, USA).
THP-1 cell stimulation by LAMPs in vitro
The human monocytic cell line THP-1 was purchased from ATCC (Manassas, VA, USA). THP-1 cells were cultured in RPMI 1640 medium containing 10% fetal calf serum (Wisent, Nanjing, China), 2 mM l-glutamine, 100 U/ml penicillin G, and 100 μg/ml streptomycin. The cell density was adjusted to 1 × 106 cells/ml in 24-well plates. The cells were then cultured with different doses of LAMPs (0, 2, 4, 6, 8, and 10 μg/ml) for 16 h. The cells were harvested and immediately stored at − 80 °C until further analysis.
HMGB1, TNF-α, IL-6, RAGE, TLR2, and TLR4 detection by real-time PCR
Peripheral blood mononuclear cells from children with
M. pneumoniae infection or freshly isolated THP-1 cells in culture were collected and lysed with Trizol (Invitrogen, Carlsbad, CA, USA). Total RNA was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). A total mixture of 15 μl containing 2 μg RNA, 25 μM random hexamers (Sangon Biotech, Shanghai, China), and RNase-free water was prepared for cDNA synthesis at 37 °C according to the manufacturer’s instructions. PCR amplifications were performed in a volume of 20 μl containing 1 μl cDNA, 10 μl primers, and probes (Table
1). The PCR conditions were as follows: 40 cycles of 95 °C for 30 s, 95 °C for 3 s, and 57 °C for 20 s. The gene expression was assessed by the comparative cycle threshold (Ct) method. The relative amounts of mRNA for the TLRs were determined by subtracting the Ct values for these genes from the Ct value for the housekeeping gene GAPDH (ΔCt). The amounts of mRNA were expressed relative to the amount of GAPDH mRNA (2
-ΔΔCt) and presented as means ± SEM.
Table 1
Foward and reverse primers using for real-time PCRs
TNF-α | CAACCTCTTCTGGCTCAA | TGGTGGTCTTGTTGCTTA |
HMGB1 | TGTAAGGCTGTGTAAGATT | AAGGTTAGTGGCTATTGAA |
IL-6 | ACCTCAGATTGTTGTTGTT | TAGTGTCCTAACGCTCATA |
RAGE | CAATGAACAGGAATGGAA | AGAGGCAGAATCTACAAT |
TLR2 | TGAGGAACTTGAGATTGAT | CACGGAACTTGTAACATC |
TLR4 | TCAGTGTGCTTGTAGTAT | CCTGGCTTGAGTAGATAA |
GAPDH | CTCTGGTAAAGTGGATATTGT | GGTGGAATCATATTGGAACA |
Statistical analysis
Continuous variables were compared by Student’s t-test or the Mann–Whitney U test if the clinical or laboratory data had a non-normal distribution. Categorical data were analyzed by the chi-square test. For in vitro studies, statistical significance was determined by one-way ANOVA, followed by the Tukey–Kramer test. Correlations between HMGB1 and other inflammatory factors were evaluated by Spearman’s rank correlation. Data were expressed as means ± SD if data had a normal distribution.
Discussion
Increasing numbers of refractory or severe, even fatal, cases of
M. pneumoniae infections have been reported in recent years [
10,
16], although
M. pneumoniae infection was traditionally considered to be self-limiting. In the present study, children with RMPP had longer durations of hospital stay and fever as well as high levels of LDH, a useful marker for initiation of steroid therapy [
17].
A recent study demonstrated that macrolide-resistant
M. pneumoniae can lead to clinically refractory pneumonia, showing no clinical or radiological response to macrolides, and further progress to severe and complicated pneumonia [
18]. However, the prevalence of macrolide-resistant MPP has rapidly increased, especially in Asian countries, recently reaching 80–90% of cases. In the Suzhou area, the prevalence of macrolide-resistant
M. pneumoniae accounts for 92.5% of cases (data not shown). Thus, macrolide resistance may be not the main reason for the development of RMPP in children.
Many studies have suggested that excessive inflammatory responses play important roles in RMPP [
8,
10]. HMGB1 participates in the pathogenesis of inflammatory diseases and mediates immune responses that range from inflammation and bacterial killing to tissue repair [
19]. HMGB1 is associated with divergent clinical conditions such as sepsis [
20]. HMGB1 initiates and perpetuates immune responses during infections. A recent study indicated that RSV infection of human airway epithelial cells induces a significant release of HMGB1, which subsequently triggers immune responses by activating primary human monocytes [
21]. To our knowledge, there are no reports on HMGB1 expression in children with
M. pneumoniae infection. We found that children with RMPP had higher HMGB1 levels than children with NRMPP and that HMGB1 had good diagnostic ability to differentiate between RMPP and NRMPP.
TNF-α is mainly produced by monocytes and macrophages, and is a multifunctional peptide with biological activity. TNF-α participates in the lung injury associated with severe pneumonia [
22‐
24]. The TNF-α expression level in children with MPP was significantly higher than that in healthy children. The mechanism is to increase the level of TNF-α in immune cells such as monocytes, macrophages and adhesion receptors after MPP infection,Which is suggested that TNF-α is involved in the pathogenesis of MPP. Wang et al. [
8] showed that serum TNF-α levels in children with RMPP were significantly higher than those in children with NRMPP, which was confirmed in a mouse model of MPP infection [
25]. The increase in IL-6 was the earliest infection index. IL-6 is an important cytokine in the MPP inflammatory responses. It also has a vital role in the early stage of the immune response [
26]. When mycoplasma infection occurs, macrophages produce TNF-α to increase the inflammatory response. By inducing differentiation of T cells, thereby stimulating mononuclear macrophages and lymphocytes to produce IL-6 and other cytokines, the serum concentrations of IL-6 and TNF-α are increased [
22]. Studies have shown that cytokines such as IL-6 are associated with the severity of MPP [
27].
LAMPs extracted from
M. pneumoniae can stimulate THP-1 or pulmonary epithelial cells to induce inflammatory responses including production of IL-6, IL-8, and heme oxygenase-1
in vitro [
28,
29]. Meanwhile, the inflammatory responses induced by
M. pneumoniae were shown to be associated with pathogen-associated molecular patterns (PAMPs) such as TLR2 and TLR4 [
30]. RAGE, a member of the immunoglobulin superfamily of cell surface molecules, is expressed on monocytes and binds to and transduces the signals stimulated by HMGB1. There are no reports on the expression of HMGB1 and its association with other inflammatory factors in THP-1 cells after stimulation with LAMPs. In the present study, it was demonstrated that LAMPs from
M. pneumoniae could induce HMGB1 expression in THP-1 cells. Meanwhile, HMGB1 was correlated with TNF-α, IL-6, and TLR2. Activation and expression of HMGB1 occur when monocytes or macrophages are exposed to microbe-associated PAMPs such as TLR2 and endogenously-derived inflammatory mediators including TNF-α, IL-1, and IFN-γ [
12]. Lipoproteins derived from
M. pneumoniae can activate NF-κb through TLR2 [
31]. Accordingly, we presume that LAMPs enhanced the expression of HMGB1 in THP-1 cells through TLR2. In addition, HMGB1 secreted by monocytes or macrophages can stimulate these cells to release pro-inflammatory cytokines including TNF-α and IL-6 [
32]. Further studies are needed to clarify the mechanism of the inflammatory responses induced by HMGB1 .
This article describes a prospective study to investigate the expressions of TNF-α, IL-6, and HMGB1 in children with MPP. TNF-α and IL-6 are pro-inflammatory factors. In previous studies on HMGB1, TNF-α and IL-6 were often used for reference and comparison with HMGB1, especially in studies on sepsis. The study by van Zoelen et al. [
33] showed that the serum HMGB1 levels in patients with severe pneumonia were significantly higher than healthy controls, suggesting that HMGB1 is involved in the development of pneumonia. However, HMGB1 has not been reported in patients with MPP. In the literature, HMGB1 was mostly detected by PCR, while ELISA was used by a small number of research groups. The present study is the only research at the cellular level, which is also a deficiency of the study.
Acknowledgments
We gratefully acknowledge the valuable cooperation of Mrs. Anwei Xie and the members of her team in helping us accomplish collecting peripheral blood and we thank Alison Sherwin, PhD, from Liwen Bianji, Edanz Group China (
www.liwenbianji.cn/ac) for editing the English text of a draft of this manuscript.