Background
Pancreatic ductal adenocarcinomas (PDAC) arise from the exocrine pancreas, account for 95% of pancreatic cancers and, due to the poor survival rate, represent the seventh leading cause of cancer-related deaths worldwide and the third in the United States [
1]. PDAC are typically diagnosed at advanced stages when the only available treatments are palliative. The poor clinical outcome of PDAC is attributable to early local spread, the high trend of distant metastasis, and resistance to radio- and chemotherapy [
2]. A better understanding of molecular and epigenetic events affecting progression and response to therapy has the potential to improve early diagnosis, prognostic evaluations, and to provide new elements for rational therapeutic approaches.
Some studies analyzed the mutational landscape of PDAC using state of the art genomic sequencing [
3‐
6]. Conversely, the characterization of epigenetic changes occurring in PDAC has not been extensively studied. A comprehensive study analyzed genome-wide promoter methylation in pancreatic cell lines with the aim to improve the diagnosis of PDAC and to identify key regulatory genes and pathways that merit therapeutic targeting [
7]. A subset of CpG island showing aberrant methylation in cell lines was also investigated in PDAC tumor specimens, but the levels of methylation often differed from that observed in cell lines [
7]. Considering the importance of epigenetic changes in malignant transformation, further characterization of these alterations in PDAC tumor specimens is needed.
Genes that are frequently mutated in PDAC are likely to play an essential role in the biology of this tumor, and they might also be a target of epigenetic dysregulation. Therefore, studying epigenetic changes in these genes may provide complementary evidence of their role in PDAC malignant transformation.
Protocadherins were included in the homophilic cell adhesion gene set that was shown to be subject to frequent alterations in an early study on transcriptome sequencing pancreatic cancers [
8], but this observation was not highlighted in subsequent genome-wide studies [
3‐
6]. These genes are among those showing aberrant methylation in pancreatic cancer cell lines [
7], suggesting their relevant role in PDAC carcinogenesis. Protocadherins represent a major subfamily of the cadherin superfamily [
9,
10] and more than seventy coding genes for protocadherins have been identified. Based on their organization, their protein products can be divided into two large groups: “
clustered” and “
non clustered” protocadherins [
11]. The
clustered protocadherins constitute the largest group. Unlike the
clustered, the
non clustered protocaderins are so named because their genes are not located in a single gene locus, but in three different chromosomal loci. They contain six extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from that of the classical cadherins [
10]. Protocadherins exhibit cell-to-cell adhesion activities, but distinct from that of classical cadherins, and are believed to possess other important functions such as signal transduction and growth control, although the exact mechanisms of action have not been fully elucidated. Different studies indicated a potential role as tumor suppressors for some of them [
12]. The onset and the malignant progression of different cancers are often associated with the lack of expression of protocadherins caused by an epigenetic silencing event that involves hypermethylation of specific chromosomal regions [
13]. Promoter methylation of protocadherins has been suggested as a prognostic marker in different tumors, including prostate, gastric, colorectal, bladder and clear cell renal cell carcinoma [
13], but in PDAC this epigenetic modification has not been extensively studied. In particular, only
PCDH10 had been previously studied in PDAC primary tumors, but that study failed to find any correlation between
PCDH10 methylation status and tumor staging [
14].
Considering that protocadherins are frequently mutated in PDAC [
8] and could play a crucial role in the biology of this tumor, but little is known about their epigenetic modifications, we analyzed promoter methylation of three protocadherins. In particular we analyzed promoter CpG methylation of
PCDH10,
PCDHAC2 and
PCDHGC5 that in our query of The Cancer Genome Atlas database resulted among the most frequently mutated in PDAC. Notably,
PCDH10 promoter methylation had been previously suggested as a prognostic marker in prostate, gastric and colorectal cancer [
13]. In our study,
PCDH10 methylation was identified as a factor associated with PDAC progression-free survival and, consequently, we suggest its possible role as a prognostic marker that might be useful for personalized treatment.
DNA extraction and bisulfite modification of DNA
Resected PDACs and adjacent non-neoplastic tissues from the same patients were taken separately, immediately frozen in liquid nitrogen and stored at − 80 °C until the nucleic acid extraction. These control tissues were verified as tumor-free by a pathologist.
Genomic DNA was isolated using the AllPrep DNA/RNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. DNA concentration and purity were controlled by NanoDrop Spectrophotometer (Thermo Fisher, Waltham, MA, USA).
Bisulfite treatment was performed according to the manufacturer’s protocol (EpiTect Bisulfite Kit, Qiagen). The bisulfite-treated DNA was amplified with primers designed according to MethPrimer [
18]. Primer sequences and PCR conditions are available in Table
2.
Table 2
Sequences of primers employed for PCR amplification of bisulfite-treated DNA
PCDHAC2
| 235 | 11 | f.aggggtttgattgttttttttagat r.actcaacaaatcctactctaattc |
PCDHGC5
| 290 | 14 | f.gggtatggtgttatttagtttaat r.ccaaactctaaaatcactataatat |
PCDH10
| 196 | 16 | f. ggttagggaggatggatgtaagtat r. cccaccatactaaattaaaccactaat |
Combined bisulfite restriction analysis (COBRA)
COBRA is a technique to semiquantitate the methylated and unmethylated DNA after sodium bisulfite treatment by using restriction enzyme cutting sites. PCR products containing CpG dinucleotides and at least 1 BstUI restriction site were digested with BstUI (New England BioLabs) that recognizes the sequence 5′-CGCG-3′, retained in the bisulfite-treated methylated DNA, but not in the unmethylated DNA. The DNA digests were separated by denaturing high-performance liquid chromatography (dHPLC) (Wave 1100, Transgenomic, Omaha, NE).
In case of methylated CpG dinucleotides, after enzymatic digestion, the 235 bp PCDHAC2 PCR product, encompassing the promoter region − 43 to + 192 bp from the transcription start site, provides two fragments of 210 and 25 bp, respectively; the 290 bp PCDHGC5 PCR product, encompassing the promoter region − 3287 to − 2997 bp upstream from the transcription start site, provides two fragments of 200 and 90 bp, respectively; the 196 bp PCDH10 PCR product, encompassing the promoter region − 1204 to − 1008 bp upstream from the transcription start site, has two cutting sites for BstUI and provides three fragments of 113, 52 and 31 base pairs, respectively. For PCDH10, the presence of two cutting sites for BstUI restriction enzyme hampered the interpretation of the analysis in case of partial methylation of the analyzed CpG islands. For this reason, we used BGS for this gene in all cases analyzed. Also for PCDHAC2 and PCDHGC5 DNA from a representative tumor and non-neoplastic sample were subjected to bisulfite genomic sequencing (BGS) to verify COBRA results independently.
BGS
We directly sequenced the PCR products generated from bisulfite-treated templates with the same primers used for amplification (Table
2).
Sequencing analysis was performed using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Methylation status was expressed as the percentage of CpG methylated over the total number of CpG included in the sequence analyzed. In some cases, sequence analysis of bisulphite-treated DNA showed the simultaneous presence of both peaks (T and C), but in these cases there was always a major peak accounting for at least 70% of the total signal. This major peak was considered to call the island as methylated (C major peak) or unmethylated (T major peak) in subsequent analyses. For PCDH10, in cases showing CpG dinucleotides with the simultaneous presence of both peaks (T and C), we also analyzed data taking into account the relative height of the two peaks. The inclusion of this information in the analyses introduced marginal variations (2–3%) in the percentage of methylation status, and the subsequent analyses of the association between methylation and prognosis yielded virtually identical results.
Analysis of PCDH10 expression by RT-PCR in cancer cell lines
Total RNA was extracted from Capan-2, AsPC-1, AGS, MB-231 cancer cell lines using Trizol reagent (Invitrogen Corp., Carlsbad, California, USA. Complementary DNA (cDNA) was synthesised as previously described [
19] and amplified for
PCDH10 gene with previously published primers [
20].
PCDH10 cDNA RT-PCR amplified fragments were separated by dHPLC.
Statistical analysis
A cut-off of 52% was chosen to dichotomize PCDH10 methylation levels according to the receiver operating characteristic (ROC) curve analysis. Consequently, the tumor was identified as PCDH10High with methylation levels above the cut-off threshold and PCDH10Low with methylation levels below the threshold. The relationships between PCDH10 methylation status and clinicopathological parameters were investigated by Pearson’s χ2 test.
Progression-free survival (PFS) was defined as the time from surgery to relapse, and overall survival (OS) as the time until death from any cause. Survival curves were plotted by the Kaplan-Meier method (log-rank test). Univariate analysis of PCDH10 methylation status with outcome was tested by Cox’s proportional hazards model. SPSS Version 15.0 (SPSS, Chicago, IL) was used for statistical analyses.
Discussion
PDAC is one of the worst malignant tumors, which commonly has an unfavourable prognosis. Currently, the most important clinical prognostic indicators of disease outcome are the PDAC staging based on the size and extent of the primary tumor and presence and extent of metastasis. Beyond the parameters used in the stage grouping (i.e., TNM classification), no additional prognostic factors are recommended for clinical care of PDAC patients. Thus, additional prognostic biomarkers are needed to provide a better risk assessment.
Recent studies showed that PDAC is not a clinically homogeneous disease, but molecularly defined subsets of patients with distinct clinical features, including prognosis and response to therapy, can be identified by integrated genome-wide analyses [
4‐
6]. Among the four major PDAC driver genes (
KRAS,
CDKN2A,
TP53,
SMAD4), mutations in
SMAD4 were associated with poor survival, whereas mutations in
KRAS,
CDKN2A and
TP53, or the presence of multiple (> 4) mutations or homozygous deletions among the most frequently mutated genes were not associated with survival [
21].
In addition to mutations, epigenetic modifications may play an important role in PDAC as suggested by the observation that aberrant CpG island methylation of
reprimo, a gene involved in p53-induced G2 cell cycle arrest, was shown to associate with worse prognosis [
22]. However, the characterization of epigenetic changes occurring in PDAC has not been extensively studied, and the only genome-wide study of promoter methylation in PDAC analyzed primarily cell lines [
7].
Since genes that are frequently mutated in PDAC may be crucial for the biology of this tumor, and they might also be a target of epigenetic dysregulation, we searched for genes frequently mutated in PDAC by querying The Cancer Genome Atlas (TCGA) provisional database. The bioinformatics analysis identified protocadherins among the most mutated genes in PDAC.
Therefore, we evaluated whether the epigenetic differences in terms of promoter methylation of protocadherins between the tumor and non-tumor tissue samples could be used as survival predictors in PDAC patients. In particular, we studied the promoter methylation of
PCDHAC2, PCDHGC5 and
PCDH10 because they emerged among the most mutated genes in PDAC through the aforementioned unbiased in silico approach. Notably, the methylation status of
PCDHAC2 and
PCDHGC5 were never analyzed before in PDAC, while
PCDH10 had been previously studied in PDAC cancer cell lines [
7] and one study analyzed this gene in PDAC primary tumors [
14].
In our study
PCDHAC2 resulted hypomethylated, whereas
PCDHGC5 was hypermethylated in all PDAC samples and the same patterns of methylation were also observed in matched adjacent non-neoplastic pancreatic tissues, suggesting that CpG promoter methylation of these genes does not play a major role in the biology of this tumor. Conversely,
PCDH10, that resulted unmethylated in adjacent non-neoplastic pancreatic tissues showed a variable degree of methylation ranging from high to low levels in matched PDAC samples. As expected,
PCDH10 methylation status correlated with the lack of expression of the corresponding transcript in
PCDH10 fully methylated cancer cell lines and, conversely, with expression of
PCDH10 in the unmethylated cell line analyzed. In line with our findings, a previous study [
14] found a significant correlation between
PCDH10 methylation and loss of
PCDH10 mRNA expression in pancreatic, gastric and colorectal cancers tissues.
The variability of PCDH10 methylation among patients led us to investigate the possible correlations between CpG dinucleotide methylation in this gene and PDAC clinical outcome. In this analysis we found, for the first time, an association between PCDH10 promoter methylation status and PDAC patients outcomes, being the hypermethylation of the gene associated with shorter progression-free survival.
Deaths occurred at high rates in both cohorts of PDAC patients and the percentage tended to be higher among PDAC patients with PCDH10High rather than PCDH10Low tumors (86% versus 75%, respectively). However, possibly because of the high rates of death, the relatively small differences among cohorts and the limited number of patients analyzed, we did not find any correlation between PCDH10 status and overall survival.
PCDH10 was already reported to be inactivated by promoter methylation in various types of cancer, including non-small cell lung cancer [
23], gastric cancer [
24], colorectal cancer [
25], nasopharyngeal, esophageal [
17], endometrioid endometrial carcinoma [
26,
27], bladder cancer [
28], cervical cancer [
29], suggesting that it plays an oncosuppressor role in those tumors. In support of a role for
PCDH10 as an oncosuppressor gene, re-expression of this gene by transfection in a gastric cancer cell line inhibited the proliferation, migration, invasion ability, as well as its tumor growth in mice [
16]. Further evidence that this gene plays an oncosuppressor role derives from the observation that methylation of
PCDH10 was associated with poor prognosis in patients with gastric cancer [
16]. In line with this evidence, the genetic deletion of
PCDH10 represents an adverse prognostic marker for the survival of patients with CRC [
30]. In pancreatic tumors, however, the potential role of
PCDH10 as oncosuppressor gene in PDAC was investigated only in pancreatic cancer cell lines where this gene was silenced by methylation and its re-expression by transfection inhibited the proliferation, migration, invasion ability and induced apoptosis [
31]. The only study which analyzed
PCDH10 methylation in pancreatic tumor samples failed to find any correlation between
PCDH10 methylation status and PDAC staging, which was the pathologic feature analyzed in that study [
14]. Also in our study there was no correlation between methylation and tumor staging, but we found that this epigenetic modification was correlated with PFS, which had not been previously analyzed.