Background
Extended-spectrum ß-lactamase-producing
Enterobacteriaceae (ESBL-PE) represent a major problem in the management of nosocomial infections, resulting in prolonged hospital stays, increased hospital charges, and higher mortality and morbidity rates [
1]. ESBLs confer resistance to many antibiotics, such as penicillins, cephalosporins and aztreonam, but not to cephamycins, moxalactam and carbapenems.
Klebsiella pneumoniae and
Escherichia coli are the main ESBL-producing organisms worldwide. Although at a lower frequency, these enzymes have also been detected in several other members of the
Enterobacteriaceae family, such as
Enterobacter spp.,
Citrobacter spp.,
Proteus spp. and
Morganella morganii. [
2‐
4]. Therefore, all these species can contribute to ESBL spread in hospital settings. Moreover, due to the coexistence of various modifying enzymes on the same plasmid, ESBL-PE often are resistant also to fluoroquinolones, aminoglycosides, trimethoprim sulfamethoxazole and tetracycline. Thus, ESBL-PE frequently display a multidrug resistance phenotype and are an important cause of treatment failure [
5,
6].
ESBLs are encoded by different genes [
7] inserted in genetic mobile elements, such as plasmids, that facilitate their spread between bacterial species. The most common ESBLs belong to the CTX-M, SHV and TEM families [
8,
9]. The CTX-M family, particularly CTX-M-15, has emerged worldwide, and is now the most common ESBL type in hospitals and in the community [
10]. Although ESBL-mediated bacterial resistance is recognized as an important health problem, limited data are currently available on ESBL-PE prevalence and molecular characterization in Sub-Saharan Africa. Particularly, to our knowledge, there is no study on ESBL-PE prevalence in clinical isolates in Chad.
The purpose of this study was to determine the prevalence and genetic characteristics of ESBL-PE in three main hospitals in Chad.
Methods
Setting
This study was conducted in the three main hospitals of Chad from January to March 2017. These three hospitals are located in N’Djamena, the capital city of Chad (1.5 million inhabitants) and are: (i) the National Reference General Hospital (HGRN), a university teaching hospital and one of the first national reference health facility. This hospital has 750 beds, with 8517 admissions and 50,896 outpatients in 2016; (ii) the Mother and Child Hospital (HME), a university teaching hospital and the reference mother-child hospital in Chad. It has a capacity of 261 beds (including an intensive care unit), with about 5000 admissions and 45,000 outpatients in 2016; and (iii) the Renaissance Hospital (HR), a tertiary healthcare facility designed to receive patients with complicated/chronic diseases from other healthcare centers. It has 250 beds and 8 intensive care unit beds. In 2016, 1457 inpatients were admitted among 23,909 consultations.
Sample collection and identification
We analyzed 1713 consecutive clinical specimens (urine, surgical wound, pus, stool, sperm and blood samples) sent to the microbiology laboratory of each of these three hospitals (HME: n = 623, HGRN: n = 505, HR: n = 585). From these specimens, 313 non-duplicated and clinically significant bacterial isolates were obtained. Identification of the bacterial species was performed using biochemical tests and then confirmed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (Bruker Daltonics, Bremen, Germany).
Antimicrobial susceptibility testing and ESBL-production
Antimicrobial susceptibility testing was performed with the disk diffusion method on Müller-Hinton agar, as recommended by the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines and using the EUCAST clinical breakpoints (Version 7.1) (
http://www.eucast.org/ clinical_breakpoints/). The following antibiotics were tested: amoxicillin, amoxicillin-clavulanic acid, ticarcillin, ticarcillin-clavulanic acid, piperacillin, piperacillin-tazobactam, temocilin, cephalexin, cefpodoxime, aztreonam, cefotaxime, ceftazidime, cefepime, cefoxitin, ertapenem, imipenem, gentamicin, tobramycin, nethilmycin, amikacin, trimethoprim + sulfamethoxazole, nalidixic acid, ofloxacin, ciprofloxacin, levofloxacin, tetracycline, chloramphenicol and fosfomycin. ESBL production was confirmed with the double-disk synergy method [
11]. In the case of high-level production of cephalosporinase, the double-disk synergy test was performed using cloxacillin-supplemented medium (250 mg/L).
Molecular characterization of ESBL and associated genes
DNA was extracted from one single colony of each isolate by incubation in a final volume of 100 μL of distilled water at 95 °C for 10 min followed by centrifugation. The presence of the
blaCTX-M (CTX-M group 1, 2, 8, 9 and 25),
blaTEM,
blaSHV and
blaOXA-like genes was assessed using a multiplex PCR method following the protocol by Dallenne et al. 2012 [
12]. Primers are listed in Table
1. The cycling conditions were: 95 °C for 10 min, followed by 30 cycles of denaturation at 95 °C for 40s, annealing at 55 °C for 40s, elongation at 72 °C for 1 min, and a final elongation step at 72 °C for 7 min. DNA samples from reference
blaCTX-M,
blaTEM,
blaSHV and
blaOXA-like-positive strains were used as positive controls. The plasmid-mediated quinolone resistance (PMQR) gene (
qnr (A, B, C, D, S),
aac (6′)-Ib-cr, qepA and
oqxAB) and the aminoglycoside resistance-conferring 16S rRNA methylase genes (
armA, rmtB and rmtC) were assessed using PCRs as previously described [
13,
14]. PCR products were visualized after electrophoresis (100 V for 90 min) on 2% agarose gels containing ethidium bromide. A 100 bp DNA ladder (Promega, USA) was used as marker size. PCR products were sequenced bidirectionally on a 3100 ABI Prism Genetic Analyzer (Applied Biosystems). The sequencing data were analyzed online using the BLAST tool available at the National Center for Biotechnology Information web page (
https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Table 1
Primers used for the detection of β-lactamase-encoding genes
Multiplex I | TEM including TEM-1 and TEM-2 | MultiTSO-T_for MultiTSO-T_rev | CATTTCCGTGTCGCCCTTATTC CGTTCATCCATAGTTGCCTGAC | 800 |
SHV including SHV-1 | MultiTSO-S_for MultiTSO-S_rev | AGCCGCTTGAGCAAATTAAAC ATCCCGCAGATAAATCACCAC | 713 |
OXA-1, OXA-4 and OXA-30 | MultiTSO-O_for MultiTSO-O_re | GGCACCAGATTCAACTTTCAAG GACCCCAAGTTTCCTGTAAGTG | 564 |
Multiplex II | CTX-M-1, CTX-M-3 and CTX-M-15 | MultiCTXMGp1_for MultiCTXMGp1-2_rev | TTAGGAARTGTGCCGCTGYA CGATATCGTTGGTGGTRCCAT | 688 |
CTX-M-2 | MultiCTXMGp2_for MultiCTXMGp1-2_re | CGTTAACGGCACGATGAC CGATATCGTTGGTGGTRCCAT | 404 |
CTX-M-9 and CTX-M14 | MultiCTXMGp9_for MultiCTXMGp9_rev | TCAAGCCTGCCGATCTGGT TGATTCTCGCCGCTGAAG | 561 |
CTX-M-8/25 | CTX-M-8/25 | CTX-Mg8/25_for CTX-Mg8/25_re | AACRCRCAGACGCTCTAC TCGAGCCGGAASGTGTYAT | 326 |
Statistics
Statistical analyses were performed using the Epi Info software, version 3.5.3 (Centers for Disease Control and Prevention, Atlanta, GA, USA). Differences in the proportion of ESBL-producers between patient groups were assessed using the Chi-square test, while associations between the presence of ESBL-encoding genes and categorical variables (sex, age and source of infection) were tested using multinomial logistic regressions. A p value < 0.05 was considered as statistically significant.
Discussion
The study reveals an ESBL-PE prevalence of 48% among clinical isolates in three major Chadian hospitals. Our results also confirm the spread of CTX-M-15 genes in isolates from African patients, and the finding that ESBL-PE display co-resistance to other antibiotic classes.
ESBL-PE prevalence varies widely between geographic areas. Low prevalence rates have been reported in Europe, USA and North America [
15,
16], while high rates are usually observed in South America, Asia [
17] and some African countries [
18]. In Sub-Saharan Africa, and particularly in Central Africa, limited data are available on ESBL-PE. The prevalence found in our study (48%) is similar to the one reported for other African countries, such as Ghana (49.4%) [
19], Gabon (50%) [
20], Burkina Faso (58%) [
21] and Cameroon 55.3% [
22], and higher than in Nigeria (20.9%) [
23] and Central African Republic (19.3%) [
24]. Therefore, it confirms the spread of these bacteria in the African continent. A possible explanation for such high ESBL-PE prevalence is the high selective pressure generated by an important use of beta-lactam antibiotics in African countries, where they are frequently proposed as first-line treatment for bacterial infections caused by
Enterobacteriaceae [
25]
. Other factors that contribute to their spread include non-prescription antimicrobial use, self-medication, poor hygiene, high burden of infectious diseases, consumption of counterfeit drugs, lack of antimicrobial resistance detection systems, and absence of diagnostic tools [
26‐
28].
E. coli and
K. pneumoniae were the most common ESBL-PE isolates and most of these isolates were from urine samples, in agreement with previous findings in India [
29]. Urinary Tract Infection (UTI) is the most frequent bacterial infection worldwide in patients with nosocomial and community-acquired infections, and
Enterobacteriaceae (mainly
E. coli and
K. pneumoniae) are generally the causal agent [
30,
31].
ESBL-PE prevalence was significantly higher in isolates from inpatient than outpatient, as previously reported in Ghana and Rwanda [
19,
31]. This pattern could be explained by the extensive use of ceftriaxone and cefotaxime as empirical antibiotic treatment in Chadian hospitals. Moreover, hospitalization has been identified as a high-risk factor for ESBL-PE infection, because ESBL-encoding genes are carried via plasmids that can be easily disseminated among the different bacteria that contaminate hospitalized patients [
26,
32]. Both factors could be operating at the same time, and further research is needed to determine their contribution to the observed pattern. Like in previous studies, ESBL-PE were more frequent (
p = 0.002) in isolates from older patients (≥60 years of age) [
33]. This could be explained by the frequent administration of antibiotic therapy to older patient.
Regarding the association of resistance to different antibiotic classes, this study shows a positive association between ESBL-PE and resistance to quinolones, aminoglycosides (except amikacin), tetracycline, chloramphenicol and co-trimoxazole (trimethoprim/sulfamethoxazole), as previously reported in Burkina Faso and Gabon [
21,
34]. The resistance to other antibiotic classes in ESBL-PE isolates is alarming, because it could further restrict the choice of adequate empirical therapy for the treatment of infections caused by these bacteria. In our study, isolates were susceptible to imipenem, ertapenem and amikacin. However, these drugs should be used with caution for empirical treatments in order to avoid emergence of carbapenem-resistant
Enterobacteriaceae.
In our study, the most common resistance gene (
blaCTX-M-15 in 96.7% of isolates) belonged to the CTX-M family. CTX-M-15 is now considered endemic in many countries and is rapidly disseminating among different
Enterobacteriaceae species [
14]. Similar to our study, high proportions of
blaCTX-M-15-positive clinical isolates were reported in other Sub-Saharan African countries: Cameroon (96%) [
22], Gabon (84.1%) [
33], Burkina Faso (94%) [
21], Ghana (98%) [
32], and Nigeria (79%) [
35].
The interpretation of the findings of this study is limited by the fact that there was no knowledge of the patients’ previous antibiotic treatments. Indeed, antibiotic treatments prior to sample collection could have favored the transient selection of resistant bacteria, and thus increased ESBL-PE prevalence compared with patients who were not previously treated with antibiotics.
Conclusions
This report reveals a high ESBL-PE prevalence (48%) and the predominance of the CTX-M-15 enzyme among clinical isolates in three major Chadian hospitals. This emphasizes the urgent need to rationalize the use of antibiotics in hospital settings and to implement a national surveillance system for antibiotic-resistant bacteria to develop empirical treatment guidelines.
We also recommend further investigations to monitor carbapenem resistance and to determine whether healthy individuals act as ESBL-PE reservoirs in the community. These studies will contribute to better understand the mechanisms responsible for the spread of ESBL-PE in hospitals and communities.