Higher levels of TIMP-1 expression are associated with a poor prognosis in triple-negative breast cancer

Microarray datasets of invasive breast carcinoma (The Cancer Genome Atlas: Invasive Breast Carcinoma Gene Expression Data, 2011, http://​tcga-data.​nci.​nih.​gov/​tcga/​) and ductal breast carcinoma (The Cancer Genome Atlas: Invasive Breast Carcinoma Gene Expression Data, 2003, http://​www.​ncbi.​nlm.​nih.​gov/​geo/​query/​acc.​cgi?​acc=​GSE4382) were accessed via the ONCOMINE Cancer Profiling Database (version 4.4.4.4, www.​oncomine.​org) and were used to investigate TIMP-1 expression in various types of breast cancer.

The human breast cancer cell lines corresponding to the luminal subtype (MCF-7 and BT474 cells), HER2+ subtype (SK-BR-3) and TNBC subtype (MDA-MB-231, MDA-MB-468, MDA-MB-435 and BT549 cells) were obtained from the American Type Culture Collection (ATCC) and cultured according to the manufacturer’s online instructions. The immortalized epithelial cell line MCF-10A (ATCC) was maintained in DMEM/F12 medium (Invitrogen) supplemented with 5 % horse serum, EGF (20 ng/ml), hydrocortisone (0.5 mg/ml), cholera toxin (100 ng/ml), insulin (10 μg/ml) and 1 % penicillin/streptomycin.

Total RNA was extracted using Trizol reagent (Cat. #15596-026, Invitrogen) and reverse transcribed using the transcriptase cDNA synthesis kit (Cat. #K1662, Fermentas) according to the manufacturer’s instructions. Real-time PCR analysis was conducted using SYBR Premix Ex Taq™ (Cat. #RR420A, TaKaRa, China) and the Applied Biosystems 7500 Fast Real-Time PCR System (ABI, USA). The results were normalized to the GAPDH internal control. The following primers were used: TIMP-1-F: TTGTGGGACCTGTGGAAGTA, TIMP-1-R: CTGTTGTTGCTGTGGCTGAT, GAPDH-F: ACGGATTTGGTCGTATTGGG, and GAPDH-R: CGCTCCTGGAAGATGGTGAT.

TIMP-1 shRNA lentiviral vectors were created by inserting the TIMP-1 target sequences into the GV248 lentiviral vector (GeneChem Company, Shanghai, China). The following TIMP-1 target sequences were used: shTIMP1-1#: ACAGTGTTTCCCTGTTTAT, shTIMP1-2#: AGCGTTATGAGATCAAGAT, and shTIMP1-3#: AGTCAACCAGACCACCTTA. The resulting shRNA lentiviral vectors were transfected into 293 T cells and the viral supernatants were collected and filtered 48 h after the transfection. MDA-MB-468 and MDA-MB-231 cells were infected with the viral supernatant and successfully infected cells were selected using puromycin (0.5 μg/mL) (#P8833, Sigma).

TIMP-1 levels in preoperative patient serum samples and cell-conditioned medium were detected using Quantikine Human TIMP-1 ELISA Kits (Cat. #DTM100, R&D Systems). ELISA assays were conducted according to the manufacturer’s instructions. All the samples were analyzed in 3 wells in each experiment, and each experiment was repeated 3 times. The serum samples were collected from 81 patients prior to surgery. The use of the patient specimens was approved by the Institutional Ethics Committee of Shanghai Ninth People’s Hospital affiliated with Shanghai JiaoTong University School of Medicine, and written consent was obtained from all participants.

The Sorlie classification method used in the data set was used to assign patients to the different groups according to clinical breast cancer subtype. OS stratified by expression levels of the gene of interest was evaluated using Kaplan–Meier analysis, and comparisons between groups were evaluated using log-rank tests. The statistical analysis was performed according to the manufacturer’s instructions [33] (http://​kmplot.​com/​analysis/​).

DNA was extracted using the Beyotime^® Genomic DNA Mini Preparation Kit (Cat. #D0063, Beyotime, China). The DNA samples (500 μg) were treated with bisulfite using the EZ DNA Methylation Gold™ Kit (Cat. #D5006, ZymoResearch, USA). Bisulfite-converted genomic DNA was amplified using ZymoTaq™ DNA polymerase (Cat. #E2001, CA, USA). The BSP specific primers were designed according to the location of the TIMP-1 CpG islands. The primer sequences are as follows: TIMP-1-BSP-F: TGTATAATAAATGTTGAAGGGTTGAATTA and TIMP-1-BSP-R: ACCATCAATACAAAAACCAAAAAAC. The PCR products were inserted into the pCR2.1 vector using the TA cloning Kit (Cat. #K2020-20, Invitrogen, USA), and 10 clones were sequenced by MeiJi Company (Shanghai, China).

Cells cultured in 6-well plates were harvested, washed once in PBS and fixed in 70 % ethanol for 48 h at 4 °C. The nuclei were stained with 50 μg/ml propidium iodide (PI) in 1 % Triton-X100/PBS containing 100 μg/ml DNase-free RNase, and the DNA content was analyzed using flow cytometry with the FACSCalibur platform (Becton Dickinson, San Jose, USA). The proportion of cells in each phase of the cell cycle was determined using the ModFit LT program (Verity Software House, USA).

For the colony formation assays, 1 × 10³ cells were plated into 6-well plates and cultured for 10 days. At the end of the culture period, the cells were fixed with methanol for 30 min and stained with crystal violet for 30 min. The plates were washed several times with water, and the images of the optical density of the cells were captured using a digital camera.

Cell invasion was examined using a reconstituted extracellular matrix membrane (Cat. #354480, BD Biosciences, San Jose, CA). Cells suspended in serum-free media at a concentration of 3 × 10⁴ cells/0.5 ml were placed in the upper chambers, and complete media containing 10 % fetal bovine serum (FBS) and 1 % antibiotics (Invitrogen Corp., Carlsbad, CA) was added to the lower chambers. The chambers were incubated for 18–24 h at 37 °C and 5 % CO₂. After the incubation, the medium was completely removed from the upper and lower chambers, and the purple residue indicative of noninvasive cells was gently removed from the upper chamber using a cotton-tipped swab. Next, the chambers were fixed with methanol for 30 min and stained with crystal violet for an additional 30 min. The cells were counted in images of the membrane that had been captured using a microscope (Zeiss) with a 10x objective lens.

The Western blot assays were conducted as previously described [34]. Briefly, cells were washed with cold PBS 3 times and harvested in RIPA buffer [1× PBS, 1 % NP40, 0.5 % sodium deoxycholate, 0.1 % SDS, phosphatase inhibitor cocktail (Roche, Indianapolis, IN), 0.1 mg/ml PMSF and 1 mM sodium orthovanadate]. Proteins extracted from the cells or tissue lysates were resolved using 8 %, 10 % or 12 % SDS-polyacrylamide gel electrophoresis, transferred to a nitrocellulose membrane, blocked in 5 % nonfat milk and blotted with the appropriate antibody.

The mouse xenograft tumor assays were performed in the animal center of Shanghai Jiao Tong University School of Medicine after obtaining approval from the Shanghai Medical Experimental Animal Care Commission. Twenty 6-week old female mice were obtained from the Shanghai Medical Experimental Animal Care Commission. All the animal experiments were performed in a designated animal center. The mice were subcutaneously injected (2 injection sites per mouse) with 1 × 10⁶ MDA-MB-468 cells and divided into 2 groups (N = 10 for each group). Five days later, the mice were injected with a neutralizing antibody against TIMP-1 (10 μg per 25 g of body weight) (Cat. #AF970, R&D Systems) or the IgG control, and the injections were repeated once a week for 4 weeks. Tumor volumes were measured regularly using the formula V = 0.5 × L × W², where L was the longest diameter, and W was the shortest diameter, before the animals were sacrificed, and the tumors were isolated.

To characterize the role of TIMP-1 in breast cancer, we analyzed TIMP-1 mRNA expression in breast cancer specimens from the publicly available cancer microarray database ONCOMINE (https://​www.​oncomine.​org/​). We found that TIMP-1 expression was significantly increased in invasive breast carcinoma (Fig. 1a) and ductal breast carcinoma (Fig. 1b) compared with normal breast tissues. We also evaluated the levels of TIMP-1 mRNA and protein in breast cancer cell lines and found that TIMP-1 expression was significantly elevated in the TNBC cell lines (MDA-MB-231, MDA-MB-468, MDA-MB-435 and BT549) compared with the luminal (MCF-7 and BT474) and HER2+ breast cancer cell lines (SK-BR-3) and the normal epithelial cell line (MCF-10A) at the mRNA and protein levels (Fig. 1c and d).

TIMP-1 was initially identified in human serum derived from skin fibroblasts in 1975 [35]. Based on this finding, we assessed the association between serum levels of TIMP-1 breast cancer clinical parameters, including age (< or ≥50 years), T status, lymph node metastasis, and the ER, PR and HER2 status (Table 1). Serum TIMP-1 were significantly elevated in malignant tissues compared with benign tissues (p < 0.001) and in ER-negative breast cancer patients compared with ER-positive patients (p = 0.002). Stratifying TIMP-1 levels according to molecular subtype revealed that serum levels of TIMP-1 were significantly higher in patients with the luminal-A (p < 0.001), HER2+ (p < 0.001) and TNBC (p < 0.001) subtypes compared with patients with benign disease. However, there were no significant differences in TIMP-1 levels among the 3 malignant subtypes (p > 0.05, data not shown).

These results suggested that elevated TIMP-1 expression might play an important role in breast cancer development.

To further explore the relationship between TIMP-1 and clinical prognosis in patients with breast cancer, we evaluated the prognostic value of TIMP-1 in a large publically available clinical breast cancer microarray database [33] that includes data from 1027 patients (459 luminal-A, 308 luminal-B, 75 HER2+ and 185 TNBC). We found that higher levels of TIMP-1 expression were associated with poor overall survival (OS) in TNBC patients (p = 0.032, Fig. 2e) but not in the overall breast cancer population or in the other subtypes evaluated (p > 0.05, Fig. 2a-d).

DNA methylation is a key epigenetic modification in the mammalian genome that regulates gene expression. To determine if DNA methylation is associated with the transcriptional silencing of TIMP-1 in different subtypes of breast cancer, we analyzed the promoter sequence of TIMP-1. We identified 1 CpG island located between bp −157 and −32 (Fig. 3a) and analyzed its methylation status in breast cancer cell lines and in clinical samples from breast cancer patients. As shown in Fig. 3b and c, the methylation status of the CpG island in the TIMP-1 promoter was greater than 20 % in non-TNBC cell lines (37.3 % in MCF-10A, 29.1 % in BT474 and 20 % in SK-BR-3 cells) and non-TNBC patients (26.4 % in benign, 24.5 % in luminal-A, 38.2 % in luminal-B and 33.6 % in HER2+ patients). In contrast, CpG methylation in the TIMP-1 promoter was less than 10 % in TNBC cell lines (MDA-231 and MDA-468) and TNBC patients. Among the breast cancer patients evaluated in these studies, 5 had luminal-A disease, 3 had luminal-B disease, 3 had HER2+ disease and 3 patients had TNBC. The average methylation status associated with each subtype is presented in Fig. 3c, and the data are summarized in Fig. 3d. These data indicate that methylation of the TIMP-1 promoter is significantly greater in TNBC (p < 0.05). In addition, RT-PCR analysis of MDA-231 and BT474 cells treated with various concentrations of 5-Aza-2′-deoxycytidine (5-Aza) for 48 h demonstrated that TIMP-1 mRNA levels increased in BT474 cells but not in MDA-231 cells (Fig. 3e). Together, these findings indicate that high levels of TIMP-1 expression in TNBC might be associated with TIMP-1 promoter hypomethylation.

Based on the observation that TIMP-1 is highly expressed in TNBC cells, we evaluated the role of TIMP-1 in TNBC cells by transfecting MDA-MB-468 and MDA-MB-231 cells with a vector expressing a short hairpin RNA (shRNA) targeting TIMP-1. Three shRNAs, referred to as shTIMP1-1#, −2#, and −3#, were used in these experiments. The shRNA knockdown efficiency of TIMP-1 expression was confirmed using real-time PCR and ELISA assays in both cell lines.

To determine the role of TIMP-1 in TNBC cell proliferation, we examined cell cycle distribution using flow cytometry. TIMP-1 knockdown increased the proportion of cells in the G1 phase (81.61 % of shTIMP1-1# cells and 74.92 % of shTIMP1-3# cells vs. 59.66 % of control cells, Fig. 4c), and decreased the proportion of cells in the G2 and M phases compared with the control (Fig. 4c). Similar results were observed in MDA-231 cells (Fig. 4d). In addition, TIMP-1 knockdown significantly reduced colony formation in MDA-MB-468 and MDA-MB-231 cells compared with the control (Fig. 4e and f). CCK-8 assays showed that cell growth was restrained in TIMP-1 knockdown MDA-468 cells (Fig. 4g). However, no differences in cell invasion were observed between TIMP-1 knockdown TNBC cells and control TNBC cells (Fig. 4h).

Together, these results demonstrate that the loss of TIMP-1 expression can induce cell cycle arrest in the G1 phase and reduce colony formation in TNBC cells.

To further investigate the molecular mechanism by which TIMP-1 regulates TNBC cell cycle distribution, we examined the levels of cyclin proteins in TIMP-1 knockdown and control MDA-MB-468 cells using Western blot. Cyclin D1, a protein encoded by the CCND1 gene, is required for cell cycle progression from the G1 to the M phase [36]. As shown in Fig. 5a-c, cyclin D1 levels decreased in TIMP-1 knockdown cells. In contrast, TIMP-1 overexpression enhanced cyclin D1 expression in MCF-10A cells (Fig. 5d). The results indicated that TIMP-1 induced cell cycle arrest by upregulating cyclin D1 expression at the mRNA and protein levels.

In TIMP-1 knockdown MDA-MB-468 cells, the Akt (mainly at Ser473 residue) and NF-κB signaling pathways were strongly inhibited, whereas the MAPK1/2 and GSK-3β pathways were unaffected (Fig. 5e). In MDA-468 cells treated with exogenous TIMP-1 (100 ng/mL, Cat#: 970-TM, R&D systems), Akt phosphorylation (primarily at Ser473) increased within 5 min (Fig. 5f), suggesting that the Akt signaling pathway is involved in TIMP-1-induced breast cancer cell proliferation. Figure 5g presents a schematic by which TIMP-1 regulates cyclin D1 expression in TNBC cells via activation of the Akt signaling pathway.

To determine if TIMP-1 is involved in tumor growth in vivo, we used a neutralizing antibody to block TIMP-1 activity in TNBC cells. We used this approach rather than engineering TIMP-1 knockdown cells as TIMP-1 is a secreted protein. Ultimately, 13 tumors derived from the cancer cell injections were identified in each group and used for further analysis. A significantly lower rate of tumor growth was observed in mice injected with neutralizing antibodies against TIMP-1 compared with mice injected with the control IgG. The 26 tumors 5 weeks after the tumor cell injections are shown in Fig. 6a. We observed a strong reduction in tumor volume and total tumor burden in mice injected with the neutralizing antibody compared with control mice (Fig. 6b and c). Together, these data suggest that blocking TIMP-1 activity might be an effective approach for treating triple-negative breast cancer.