Tissue collection
Ovaries with the CL of Holstein cows were obtained at a local abattoir, kept in normal saline at 25 − 30 °C, and delivered to the laboratory within 6 h of being collected. Luteal stages were classified as early-luteal (days 2–3 after ovulation), mid-luteal (days 8–12), late-luteal (days 15–17), and regressed (over day 19) by macroscopic observations of the CL according to a previous study [
21]. The stages of the bovine CL were classified into the early-luteal (
n = 7), mid-luteal (
n = 13), late-luteal (
n = 14), and the regressed stages (
n = 31). Collection of the CL tissues was approved by the local ethical committee of Hokkaido University (Approval no. 13–0052).
The animal procedures used to collect PGF-induced regressing CL tissues were approved by the local Institutional Animal Care and Use Committee of the Polish Academy of Science in Olszyn, Poland (Agreement No. 5/2007, 6/2007 and 88/2007). Healthy, normally cycling Polish Holstein black and white cows were used for the collection of PGF-induced regressing CLs. Estrus was synchronized in cows by two injections of an analogue PGF (25 mg; Dinoprost, Dinolytic; Pharmacia and Upjohn, Puurs, Belgium) with an 11-day interval according to the manufacturer’s instructions. Ovaries were collected 0, 2, 12, and 24 h after the injection of a luteolytic dose of the PGF analogue (25 mg) on post-ovulation day 10 using a Hauptner’s effeninator (Hauptner & Herberholz, Solingen, Germany). Total 25 PGF-treated CL and control mid-luteal CL were used in this study, and detailed information of the tissues is summarized in Table
1.
Table 1
Information on the bovine corpus luteum used for the present study
A: Normal cycling CL |
| Luteal stages |
| | EL | ML | LL | Reg |
Number of samples | For the histological analysis | 7 | 13 | 14 | 31 |
For the qPCR analysis | 4 | 4 | 5 | 7 |
Days after ovulation | 2–3 | 8–12 | 15–17 | >19 |
Color | Flesh, Bloody | Orange | Yellow | Ocher, Brown, White |
Size (cm) | 1.9 ± 0.19 | 2.5 ± 0.07 | 2.1 ± 0.14 | 0.9 ± 0.06 |
B: PGF-induced regressing CL |
| | Hours after the PGF injection |
| | 0 | 2 | 12 | 24 |
Number of samples | For the histological analysis | 4 | 10 | 6 | 3 |
For the qPCR analysis | 5 | 6 | 6 | 4 |
CL tissues dissected out from the ovaries were halved, and either immersed in fixatives as described below for the histological analysis or frozen in liquid nitrogen for RNA purification. Information on the CL used for this study was summarized in Table
1.
Histological analysis
CL tissues were dissected from the ovaries and immersed in 4 % paraformaldehyde for 24 h at 4 °C. Tissues were dehydrated through graded series of ethanol and immersed into xylene, then embedded in paraffin according to the standard methodology, and 5-μm-thick sections were obtained. Sections were de-waxed, subjected to Hematoxylin and Eosin staining, and observed under a light microscope (BX51; Olympus corporation, Tokyo, Japan). The middle CL parenchyma tissues were dissected into small pieces and fixed with 2.5 % glutaraldehyde for ultrastructural observations under a transmission electron microscope (TEM, H-7100; Hitachi, Tokyo, Japan). Tissue pieces were post-fixed with 1 % OsO4 for 1.5 h, dehydrated through a graded series of ethanol, and embedded into Epon resin (Quetol 812). Ultra-thin sections were obtained, stained with uranyl acetate lead citrate, and observed under a TEM.
Immunohistochemistry
All procedures were performed at room temperature. After deparaffinization, endogenous peroxidase was blocked by 3 % H
2O
2 in distilled water for 20 min. Sections were then incubated with Avidin/Biotin blocking solution (Vector Laboratories Inc., Burlingame, CA, USA) for 15 min each. After washing with phosphate-buffered saline (PBS) twice, sections were pre-incubated for non-immune blocking with Block Ace (DS Pharma Biomedical Co., Ltd., Osaka, Japan) for 60 min. Sections were then incubated with a mouse anti-SMA antibody (1:1,000; clone 1A4, #A2574; Sigma-Aldrich Corporation, St. Louis, MO, USA) in PBS overnight. The sections were incubated with biotinylated anti-mouse IgG (1:500; Vector Laboratories Inc.) for 1 h, followed by an incubation using a Vectastain ABC Elite kit (Vector Laboratories Inc.) for 1 h. The reaction site of the primary antibody was visualized using an ImmPACT™ DAB Peroxidase Substrate Kit (Vector Laboratories Inc.) for 3 min. Sections were counterstained with hematoxylin and observed under a light microscope. The total CL area in the section and the SMA-immunoreactive area in the CL were measured using Image J (
http://imagej.nih.gov/ij/), and the percentage of SMA-positive area per the total CL area was calculated. Control sections were incubated with PBS instead of the primary antibody and the disappearance of the signals was confirmed.
For luteal steroidogenic cell, macrophage, and proliferating cell staining, antigen retrieval was performed for 1 min in boiling 0.01 M citrate buffer (pH 6.0) using a pressure cooker. Endogenous peroxidase and Avidin/Biotin blocking were then performed as described above. After a pre-incubation with Block Ace for 1 h, the sections were incubated with either goat anti-3β-hydroxysteroid dehydrogenase (3β-HSD) (1:2,000; #sc-30820; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), mouse anti-MAC387 (1:1,000; #ab22506; Abcam Japan Ltd., Tokyo, Japan), which recognizes the L1 or Calprotectin molecule, an intracytoplasmic antigen expressed by tissue macrophages, or rabbit anti-Ki-67 antibody (1:200; ThermoFisher Scientific Inc., Waltham, MA, USA) overnight. Sections incubated with the 3β-HSD antibody were then incubated with a peroxidase-labeled anti-goat IgG (1:200; Vector Laboratories Inc.) for 1 h. On the other hand, MAC387- and Ki-67-stained sections were incubated with biotinylated anti-mouse or rabbit IgG for 1 h and Vecterstain ABC Elite kit as described above. Reaction sites for all three antibodies were visualized using an ImmPACT™ DAB Peroxidase Substrate Kit (Vector Laboratories Inc.) for 3 min and observed under a light microscope as described above. The total CL area in the section and the number of 3β-HSD- or MAC387- immunoreactive cells in the CL was measured using Image J, and the positive cell number in 1 mm2 was calculated.
For double immunostaining for SMA and Ki-67, the deparafinized sections were rinsed in distilled water and antigen retrieval was performed by boiling the sections in 0.01 M citrate buffer (pH 6.0) for 1 min using a pressure cocker. The sections were incubated with Block Ace for 1 h and rabbit anti-Ki-67 antibody overnight as described above. After washing with PBS three times, the sections were incubated with Alexa Fluor 488-conjugated anti-rabbit IgG (1:200; Life Technologies Japan, Tokyo, Japan) for 2 h. The sections were again incubated with Block Ace for 1 h and then incubated with mouse anti-SMA antibody as described above. The binding site for SMA antibody was visualized using AlexaFluor 594-labeled anti-mouse IgG (1:200; Life Technologies Japan) and observed under a confocal laser microscope (FV300; Olympus, Tokyo, Japan).
For triple staining, sections were incubated with a mouse anti-vimentin antibody (1:500; Dako Japan ltd., Tokyo, Japan) overnight, and then with biotinylated anti-mouse IgG for 1 h as described above. The antibody-binding site for the 1st primary antibody against vimentin visualized using the TSA™ Fluorescein System (PerkinElmer Inc., Waltham, MA, USA). The 1st primary antibody was washed out in boiling 0.01 M citrate buffer (pH 6.0) using a microwave for 2.5 min, and sections were then blocked with Block Ace for 1 h. They were incubated with the 2nd primary antibody, a rabbit anti-desmin antibody (1:500; ThermoFisher Scientific Inc.) overnight and with a Cy5-labeled anti-rabbit antibody (1:200; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) for 2 h. Sections were again blocked with Block Ace for 60 min and then incubated with a 3rd primary antibody, the mouse anti-SMA antibody (1:500). The binding site for the 3rd primary antibody was visualized by AlexaFluor 594-labeled anti-mouse IgG (1:200; Life Technologies Japan). Sections were observed under a confocal laser microscope as described above. Lasers used in this study were Ar (488 nm), HeNe (G) (543 nm), and HeNe (R) (633 nm).
Quantitative PCR (qPCR)
Total RNA from bovine CL tissues during the early-luteal (
n = 4), mid-luteal (
n = 4), late-luteal (
n = 5), and regressed stages (
n = 7) was purified using Trizol® (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two hundred nanograms of total RNA were used to prepare cDNA using a QuantiTect Reverse Transcription kit (Qiagen Japan Co. Ltd., Tokyo, Japan). QPCR was performed using a KAPA SYBR First qPCR kit (Nippon Genetics Co., Ltd., Tokyo Japan) according to the manufacturer’s instructions. The sequences of the primer sets used for this study are listed in Table
2. Primers were pre-validated by standard PCR and by generating standard curves using qPCR. The qPCR cycling program consisted of a denaturing step (95 °C for 3 min), annealing and extension step (95 °C for 3 s and 60 °C for 20 s repeated for 40 cycles), and a dissociation step (ramp from 60 to 95 °C) using Corbett Rotor-gene 6000 (Qiagen Japan Co, Ltd.). The relative expression levels of each target to the housekeeping gene (
glyceraldehyde 3-phosphate dehydrogenase:
Gapdh) were quantified using the
ΔCt method.
Table 2
Primers used for the present study
Gapdh
| BC102589 | caccctcaagattgtcagca | ggtcataagtccctccacga | 103 |
Acta2
| NM_001034502 | gccgagatctcaccgactac | gtgatcacctgcccatcag | 202 |
Tgfb1
| NM_001166068 | ccttcctgctcctcatgg | ggttgtgctggttgtacagg | 276 |