Background
Pancreatic carcinoma, which is nearly almost always fatal, is the fourth leading cause of cancer-related death worldwide, with fewer than 7% of patients surviving more than 5 years [
1]. Chemotherapy (mainly based on gemcitabine and capecitabine) and radiation therapy remain the mainstay of treatment for pancreatic cancer, with poor efficacy in terms of extending patient survival [
2,
3]. Additionally, although the curative effect is better, only 15% of patients who undergo surgery survive more than 5 years [
4,
5]. In view of this dismal outcome, to enable treatment of this deadly disease with new druggable targets, there is an urgent need to thoroughly understand the molecular mechanisms of pancreatic cancer pathophysiology and development.
Recent studies have shown that heterogeneous nuclear ribonucleoproteins A2B1 (HNRNPA2B1), two structurally homologous proteins belonging to the hnRNP family, play important roles in normal development as well as in cancer processes in eukaryotic cells [
6]. Indeed, elevated HNRNPA2B1 levels in tumours accelerate pre-mRNA processing via RNA binding, indicating the critical role of HNRNPA2B1 in the development of carcinoma. Recent work shows that the epithelial–mesenchymal transition (EMT), a process in which epithelial cells transform into cells with mesenchymal phenotypes, may be regulated by HNRNPA2B1. During EMT in tumour cells, up-regulation of vimentin and N-cadherin and down-regulation of E-cadherin (cell–cell adhesion molecules) promote cell invasion and metastasis in various cancers, including pancreatic cancer [
7‐
10]. Other factors also directly or indirectly trigger EMT, including claudins, occludin, fibronectin, twist1, ZEB2 and snail [
11‐
15]. Zhou et al. [
16] indicated that HNRNPAB induces EMT and promotes metastasis of hepatocellular carcinoma by transcriptionally activating snail [
16], and Barcelo et al. [
17] showed that HNRNPA2B1 plays a key role in Kras-mutation associated pancreatic cancer [
17]. Based on these findings, HNRNPA2B1 might play an important role in EMT during tumour development.
To date, however, no study has reported on the role of HNRNPA2B1 in EMT in pancreatic cancer. Thus, we aimed to determine the roles and potential application of HNRNPA2B1 in the EMT of pancreatic cancer by exploring the impact of HNRNPA2B1 knockdown and overexpression on EMT and the subsequent invasion and metastasis of pancreatic cancer cells. Furthermore, we here demonstrate the possibility that HNRNPA2B1 regulates and controls EMT in pancreatic cancer cells through the ERK/snail pathway. In conclusion, we conclude that HNRNPA2B1 plays a critical role in pancreatic carcinoma EMT.
Methods
Cell culture
The human pancreatic cancer cell lines used in this study include Patu-8988, MIA Paca-2 and PANC-1. The MIA Paca-2 and PANC-1 lines were obtained from the Institute of Biochemistry and Cell Biology, the Chinese Academy of Science (Shanghai, People’s Republic of China), and Patu-8988 cells were provided by Genechem (Shanghai, China). Patu-8988 cells were cultured in RPMI-1640 medium, and MIA Paca-2 and PANC-1 cells were cultured in DMEM. All media contained 10% foetal bovine serum, penicillin (100 U/mL), and streptomycin (100 μg/mL), and the cells were incubated at 37 °C with 5% CO2. Cell were harvested and passaged at approximately 80–100% confluence using phosphate-buffered saline (PBS) with 0.25% trypsin and 0.01% EDTA.
Reagents and antibodies
Antibodies against HNRNPA2B1, E-cadherin, vimentin, N-cadherin, MMP7, MMP9, ERK1/2 and phosphorylated proteins were purchased from Abcam (Cambridge, USA). An antibody against β-actin was purchased from Bio-world Technology (St Louis Park, MN, USA). An antibody against snail was purchased from Cell Signaling Technology (Danvers, USA). Foetal bovine serum (FBS) was purchased from Sigma Chemical (St Louis, MO, USA). Roswell Park Memorial Institute (RPMI)-1640 medium, Dulbecco’s Modified Eagle’s Medium (DMEM), and trypsin were purchased from GIBCO (Grand Island, NY, USA). ERK-inhibitor (GSK2656157) was purchased from MedChem Express (New Jersey, USA) and gemcitabine was purchased from Jkchem (Shanghai, China).
Knockdown and overexpression of HNRNPA2B1
A lentivirus plasmid containing a short hairpin RNA (shRNA) for HNRNPA2B1(KH)and its negative control (NKH) and a lentivirus plasmid containing HNRNPA2B1 driven by the CMV promoter (OH) and its negative control (NOH) were designed and produced by Genechem (Shanghai, China). For transfection, MIA Paca-2, PANC-1 and Patu-8988 cells were seeded in 6-well plates at 5 × 104 cells and allowed to attach until nearly 30–40% confluent. After removal of the culture medium, the plates were washed three times with PBS, and lentivirus and 50 μg/mL polybrene was added to each plat. After 12 h of transfection, the transfection medium was replaced with standard medium. Cells were harvested for passaging or testing when they occupied 80% of the plate. All procedures were performed using biohazard safety equipment.
Western blot analysis
Protein was extracted by adding RIPA buffer (Beyotime, Shanghai, China) with protease inhibitor (Beyotime, Shanghai, China) and phosphatase inhibitor (Roche Diagnostics GmbH, Mannheim, Germany). The final protein lysate was centrifuged, and the supernatant was collected. BCA (Beyotime, Shanghai, China) was used to measure the protein concentration. After denaturing, the protein mixture was separated using a 10% polyacrylamide gel; a prestained protein marker was included. The separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes, which were blocked with 5% skim milk in Tris-buffered saline (10 mmol/L Tris–HCl, pH 8.0, containing 150 mmol/L NaCl and 0.1% Tween-20) for 2 h at room temperature before being incubated at 4 °C overnight with primary antibodies diluted in First Ab Dilute. The membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Bio-world Technology, MN, USA) for 2 h at room temperature after washing with TBST. The densities of the protein bands were recorded and measured by AlphaEaseFC (STandalone).
RNA extraction and quantitative real-time PCR analysis
When the cells were approximately 90% confluent, total RNA was extracted using TRzol Reagent (Ambion, Carlsbad, California, USA) according to the manufacturer’s instructions. To obtain cDNA, reverse transcription was performed with RevertAid First Strand cDNA Synthesis Kit(Thermo, Manassas, USA). qRT-PCR was performed with SYBR Green Master (Biosystems, Foster City, CA, USA) using a 7500 Real-Time PCR System (Applied Biosystems, Foster City, USA). β-Actin was amplified as an internal standard, and ΔCt values were used for analysis of the quantitative real-time PCR data. Polymerase chain reaction (PCR) primers were purchased from Synbio Tech (Jiangsu, People’s Republic of China); the sequences are listed in Table
1.
Table 1
The sequences of the primers used for quantitative real-time PCR
β-actin | GACATCCGCAAAGACCTG | GGAAGGTGGACAGCGAG |
HNRNPA2B1 | ATGGCTGCAAGACCTCATTC | TAATTCCGCCAACAAACAGC |
E-cadherin | GACCGAGAGAGTTTCCCTAC | GGTGGGATTGAAGATCGGAG |
N-cadherin | GTGACCGATAAGGATCAACC | TTGACCACGGTGACTAACCC |
Vimentin | GGATGTTGACAATGCGTCTC | CTCCTGGATTTCCTCTTCGT |
Mmp7 | TGAGGATGAACGCTGGACG | CACTGCATTAGGATCAGAGGAA |
Mmp9 | AGTCCACCCTTGTGCTCTTC | GCCACCCGAGTGTAACCAT |
ERK | ATCCCCATCACAAGAAGA | GCTTTGGAGTCAGCATTT |
Snail | CTTCTCCTCTACTTCAGTCTCTTCC | TGAGGTATTCCTTGTTGCAGTATTT |
Cell viability assay
The different cell models were plated into 96-well plates containing 1 mL 10% FBS medium at a density of 10,000 cells per well and incubated for 24 h. The cells were starved in FBS-free medium for 12 h when the cells in each well reached 70% confluence. The medium was discarded, and the cells were washed once with PBS before; 100 μL FBS-free medium containing 10 μL Cell Counting Kit 8 (CCK8; Dojindo, Kuma-moto, Japan) solution was added to each well and incubated for 1–2 h. Cell viability is expressed as the fold change in absorbance at 490 nm for each well, as measured using a microplate reader (BioTek, Winooski, VT, USA).
Cell invasion assay
Transwell Permeable Supports (Costar, Kennebunk, USA) with matrigel Basement Membrane Matrix (Corning, Franklin Lake, NJ, USA) bedding were used with an 8 μm porosity polyethylene terephthalate membrane. Cells (5 × 104) were starved overnight and added to the upper chamber in 200 μL FBS-free medium; 500 μL RPMI-1640 (for Patu-8988 cells) or DMEM (for PANC-1 and MIA Paca-2 cells) with 10% FBS was added to the lower compartment as a chemoattractant. The cells were incubated for 24 h, and the filters were washed three times with PBS, fixed with 4% paraformaldehyde for 30 min, stained with 4 g/L crystal violet for 15 min and washed twice with PBS. The cells on the upper surface of the filter were gently scraped off. The stained cells in randomly selected fields were observed and counted using a 200× inverted microscope.
Cell cycle analysis
The cell cycle analysis was measured using the Propidium iodide Kit for Flow Cytometry (Multiscience, Hangzhou, Zhejiang, China), according to the manufacturer’s instructions. After the treatments, cell cycle analysis was measured using a Thermo Attune and analyzed using the ModFit LT2.0 software (Coulter, Miami, FL).
Establishment of the xenografted tumor model in nude mice
Athymic nude mice (BALB/C-nu/nu, 6–8 weeks old, female) were gained from the Animal Center of Chinese Academy of Science (Shanghai, China) and fed under specific pathogen-free conditions in the laboratory animal center of Wenzhou Medical University (Wenzhou, Zhejiang, China). We established a pancreatic xenografted tumor model through subcutaneous injection of 1 × 107 pancreatic cancer cells per mouse. After the treatments, we observe the growth rate of tumor volume and the change of weight on each mice. All researches involving animals were approved by the Animal Ethics Committee of Wenzhou Medical University.
Statistical analysis
Data are expressed as the mean ± standard error of the mean (SEM) for at least three independent experiments. Analysis of variance was utilised to distinguish differences in each group. A value of P < 0.05 was considered to be statistically significant. All analyses were performed using SPSS 16.0 software (IBM, USA).
Discussion
Pancreatic cancer, which currently has the worst prognosis, is the most common malignant tumour of the digestive system and among the top ten malignant tumours in our country [
26]. Although surgery is the only radical treatment presently available, the curative rate of pancreatic cancer remains very low because surgery is often no longer an option at the time of diagnosis [
27]. Accordingly, biotherapy treatments have become more popular over the past few years. Encouraging results have been reported by recent studies showing that pancreatic carcinoma could be inhibited by controlling several biomarkers such as SMAD4, CXCR2, ABCG2 and Kras [
28‐
34]. In addition, Barcelo et al. showed that HNRNPA2B1 interacts with and regulates oncogenic Kras in pancreatic ductal adenocarcinoma cells, and Tauler et al. indicated that HNRNPA2B1 modulates EMT in lung cancer cell lines [
17,
35]. However, a clear relationship between HNRNPA2B1 and EMT in pancreatic cancer and the signalling pathway involved remain elusive.
We previously discovered that the level of HNRNPA2B1 expression is higher in pancreatic cancer than in non-lesion tissue, as are other cancers, such as lung cancer [
36], hepatocellular carcinoma [
16] and glioblastoma [
37]. Based on our study, we chose several pancreatic carcinoma cell lines to simulate different types of pancreatic cancers and generated models of HNRNPA2B1 depletion and overexpression using Crispr/Cas9 genetic technology. Unsurprisingly, conforming to the manifestation of an oncogene, both the mRNA and protein levels of HNRNPA2B1 were closely related with EMT, which plays an important role in the invasion and metastasis of cancer cells [
38,
39]. Moreover, we found that the ERK/snail signalling pathway, regulated by HNRNPA2B1, plays a crucial role in pancreatic carcinoma.
EMT has a vital function in the process of phenotypic conversion [
15,
40‐
42]. Accumulating experimental evidence suggests that many pancreatic cancer cell lines express higher levels of mesenchymal biomarkers, such as vimentin and N-cadherin, and lower levels of epithelial biomarkers, such as E-cadherin, than normal pancreatic cell lines. In our study, we found that the cell lines expressing higher levels of HNRNPA2B1 had enhanced invasive and migration capacities as well as lower expression of E-cadherin and higher expression of vimentin and N-cadherin than the others cells. Moreover, we detected levels of MMP7 and MMP9 expression and found that HNRNPA2B1 promoted expression of these MMPs, with a correlated change in of MMP expressions and EMT development. In addition, transwell invasiveness assays showed a greater number of cells passing through the membrane when MMP levels were higher due to extracellular matrix degradation. What’s more, vivo study showed that the cells with higher expression of HNRNPA2B1 could induce bigger xenografted tumor in mice. Therefore, we speculate that HNRNPA2B1 may be a potent inducer of EMT in pancreatic carcinoma. Meanwhile, snail, an important transcription factor up-regulation in EMT, is noteworthy because snail triggers EMT by coordinating the induction of mesenchymal biomarkers and the repression of epithelial biomarkers, which could induce EMT and promote metastasis of hepatocellular carcinoma. We found that the expression level of snail mRNA and protein consistently increased when HNRNPA2B1 was overexpressed. However, the concrete mechanism by which this occurs in pancreatic cancer requires further investigation.
As one of the most important intracellular pathways, RAS/RAF/MEK/ERK signalling causes multiple changes in the expression of various genes, transmitting signals from receptors to regulate gene expression and prevent apoptosis [
43‐
46]. Recent studies have shown that activation of the ERK pathway, not only by growth factors but also by mutations occurring in cancer cells in the genes encoding RAS or RAF, contributes to EMT. RAS and RAF signalling also activate expression of snail1 and/or snail2, therefore promoting cell motility and invasive behaviour in cancer-associated EMT [
13]. Moreover, Hsu et al. showed that snail promotes cell motility and invasive behaviour in cancer-associated EMT by activating the ERK signalling [
22], HNRNPA2B1, a member of a heterogeneous group of nuclear ribonucleoproteins, has been shown to contribute to ERK activation by controlling A-RAF splicing [
18]. We explored the relationship between snail and the ERK pathway and found that the expression level of snail was notably decreased with attenuation of ERK phosphorylation caused by HNRNPA2B1 knockdown. Futher more, when we inhibited the activation of ERK1/2, both of HNRNPA2B1 and EMT were decreased. Therefore, we tentatively conclude that HNRNPA2B1 promotes EMT by activating the ERK/snail pathway in pancreatic cancer, revealing a potential connection between HNRNPA2B1 and EMT. Nonetheless, the mechanism of specific subunit by which HNRNPA2B1 affects the intracellular RAS/RAF/MEK/ERK cascade is still unknown, and the mechanism by which HNRNPA2B1 transfers a signal to various pathways and which subunits are involved requires further investigation.
Authors’ contributions
DSJ carried out the molecular genetic studies, participated in the Western blot analysis and drafted the manuscript. ZJ, LB and HXC carried out the cell viability assay and cell invasion assay. HSH and YTT participated in the design of the study and performed the statistical analysis. FBB performed the study in vivo experiment. ZMT and CBC conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.