Hyperglycemia enhances arsenic-induced platelet and megakaryocyte activation

Whole blood was collected from healthy donors in the fasting state. Subjects were not on any antiplatelet therapy nor did they have any history of cardiovascular disease, metabolic syndrome or DM. All human experiments were performed in accordance with institutional and state guidelines. Phlebotomy was performed after 10 min of quiet rest. Blood was collected following a clean, problem-free venipuncture, using a 21-gauge needle after a 5 cc discard (a tourniquet was used to obtain access and was removed before blood collection). Blood was collected into vacutainer tubes containing 3.2% (0.105 mol/l) sodium citrate for platelet activity measurements. After collection, each tube was gently inverted 3 times and immediately transferred to the laboratory for processing.

Sodium arsenite was dissolved in dH₂0 for a stock concentration of 1000 µM then added to whole blood at a concentration of up to 10 µM for a total of 30 min, similar to prior studies [10, 11]. Similar procedures were performed to achieve concentrations of 0.1, 1, 5 µM sodium arsenite. d-glucose was dissolved in dH₂O for a stock concentration of 500 mM then added to whole blood and megakaryocytes at concentrations of 5, 15 or 25 mM to approximate euglycemia (5 mM d-glucose ≈90 mg/dl blood glucose) to a range of hyperglycemia common in DM (15 mM ≈ 270 mg/dl, 25 mM ≈ 450 mg/dl).

To examine the effect of iAs on platelet activity, we first measured platelet activation by assessing platelet P-selectin exposure and the presence of monocyte and lymphocyte platelet aggregates (MPA and LPA, respectively) in whole blood samples. We began with a 10 µM concentration of sodium arsenite used in prior in vitro models with aortic endothelial [10, 11] and vascular smooth muscle cell cultures [12, 13], a concentration 50–75% less than that used in prior studies of arsenic and thrombosis [9]. P-selectin expression (CD62P) is a cell surface marker primarily expressed by activated platelets and involved in platelet adhesion. To identify platelet specific P-selectin, we performed flow cytometry on whole blood with CD42b and CD61 to constitutively expressed platelet glycoproteins 1b (GP1b) and IIIa (GPIIIa), respectively. Flow cytometric analysis was performed using the BD Accuri flow cytometer (C6 Flow Cytometer). Whole blood was incubated in the dark for 30 min at room temperature with APC-conjugated mouse antibody specific for CD42b (glycoprotein Ib) and FITC—conjugated mouse antibody specific for CD62P (P-selectin) (BD Biosciences) before the mean fluorescence intensity of P-selectin–bound antibody per 10,000 events was measured. P-selectin is a component of the alpha granule membrane of resting platelets that is only expressed on the platelet surface membrane after alpha granule secretion. In-vivo circulating degranulated platelets rapidly lose their surface P-selectin, but continue to circulate and function [14]. Monocyte and leukocyte platelet aggregates provide complementary information on in vivo platelet activation; are independently associated with cardiovascular disease events; [15, 16] and were assessed as events positive to markers CD14-APC and CD45-APC, respectively, in addition to platelet marker CD-61. MPAs were defined as events positive to both monocyte markers (CD14-APC [BD Biosciences]) and the platelet marker CD61-FITC (Dako). Monocytes were identified by their staining with CD14-APC and by their characteristic orthogonal light scatter. Monocytes with adherent platelets were identified by CD14-APC positivity. LPAs were defined as events positive to both leukocyte markers (CD45-APC [BD Biosciences]) and the same platelet marker CD61-FITC (Dako). The leukocytes with adherent platelets were identified by CD45-APC positivity. Appropriate color compensation was determined in singly labeled samples and matched nonspecific antibody controls (Mouse IgG1 FITC [BD Biosciences]). For the co-incubation experiments, whole blood was first incubated with 5 and 15 mM d-glucose for 30 min. We then used lower concentrations of sodium arsenite at 0, 0.1, 1 and 5 µM which were added to solution and incubated for an additional 30 min. P-selectin expression with unstimulated and stimulated with thrombin 0.025 IU/ml (Sigma) was then assessed.

Meg-01 cells were purchased from American Type Culture Collection (VA) and cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin (Invitrogen, CA, USA) at 37 °C in a 5% CO₂ humidified atmosphere, consistent with prior studies [17, 18]. For adhesion assays, 18 mm glass coverslips (Fisher Scientific) coated with collagen (Helena Laboratories, Beaumont, TX, USA) were blocked with 1% BSA in 12-well plates [17, 18]. Meg-01 cells were stained for 10 min with 1 µM DiOC6 (Fisher Scientific), washed and incubated at 2.5 10⁵ cells/ml for 3 h with and without addition of iAs (0, 1, 5 and 10 µM) in presence of 5 or 25 mM d-glucose. After the supernatant was aspirated, adherent cells were gently washed with FBS. For each well, five random fields were captured and area of coverage was quantified using Image J (National Institutes of Health, Bethesda, MD).

Nuclear transcription factor kappa B (NFκB) gene expression was measured because of its roles in inflammation, platelet activation, and arsenic vasculopathy [18‐20]. Other genes measured include monocyte chemoattractant protein-1 (CCL2) and CD36 that have also been associated with platelet degranulation, diabetes and inflammation. To measure these genes, total RNA was isolated from Meg-01 cells using the Direct-zol RNA Miniprep kit (ZymoResearch, Irvine, CA, USA) and quantified using a Nanodrop ND-2000 spectrophotometer (Wilmington, DE, USA). RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad). Gene expression of GAPDH and NFκB1 using the Sso fast Evagreen Supermix (BioRad) was assessed with real-time PCR (iCycler Real-Time Detection System, Eppendorf). The sequences of the NFκB1, CCL2 and CD36 primers used for qRT-PCR were CAGATGGCCCATACCTTCAAA and TTGCAGATTTTGACCTGAGGG, CCCAAAGAAGCTGTGATCTTCA and GCAGATTCTTGGGTTGTGGA, and CTATTGGGAAGGTCACTGCGA and CAGGTCTCCCTTCTTTGCATT, respectively.

All experimental values are represented as mean ± standard error of the mean (SEM). Differences in selected categorical variables between the respective comparison groups were analyzed with the χ² test of statistical significance. Unpaired two-tailed t tests and ANOVA were used to examine differences in continuous variables overall and at each time point under study in the different comparison groups. A value of P < 0.05 was considered statistically significant.