Hyperprolactinemia-inducing antipsychotics increase breast cancer risk by activating JAK-STAT5 in precancerous lesions

The mouse mammary tumour virus promoter (MMTV-tva) (MA line) and STAT5a^−/− mice used in this study are on a Friend virus B (FVB) genetic background and have been previously reported [34, 35]. Briefly, lesion initiation is achieved by intraductal injection of a Rous sarcoma virus-based vector - replication-competent avian sarcoma (RCAS) - to deliver an oncogene into a minute subset of mammary epithelial cells in an otherwise normally developed mammary gland [34]. This allows cancer to initiate in a “field” of normal mammary cells in a normal mammary gland as human breast cancer usually initiates and evolves [34]. This subset of mammary epithelial cells was made susceptible to RCAS infection by transgenic expression of the gene encoding the RCAS receptor TVA from the MMTV promoter (MMTV-tva) [34]. STAT5a^−/− mice have been previously described [35]; the STAT5a knockout mice on the FVB background have normal mammary development unlike those on the 129 background [11, 35]. All animals were handled according to the animal protocol approved by Baylor College of Medicine (BCM) Institutional Animal Care and Use Committee (IACUC).

RCAS virus was prepared as previously described [34, 36] and was intraductally injected into MMTV-tva mice at 10 weeks of age. Five days later they were randomized and treated with either a drug or diluent for 2 weeks (early lesion studies) or until euthanasia (tumor study). Mice in the tumor latency study were palpated thrice weekly and tumor size was recorded. When tumors reached 2.0 cm in diameter, cumulatively, the mice were euthanized. Tumor-free mice were euthanized 12 months post injection.

Pimozide (cat. no. P1793; Sigma-Aldrich) was intraperitoneally (IP) administered daily at 5 mg/kg. Risperidone (cat. no. 1604654; Sigma-Aldrich) was delivered IP daily (3 mg/kg) for 2 weeks (early lesion study) or in drinking water (1.56 mg/l) until euthanasia (tumor latency study), resulting in the same daily dose based on the calculation previously reported [37]. Aripiprazole (cat. no. SML0935; Sigma-Aldrich) was delivered via IP injection in a daily dose of 3 mg/kg for 2 weeks, and clomipramine (cat. no. 1140247; Sigma-Aldrich) was delivered in drinking water (190 mg/l), resulting in a daily dose of 28 mg/kg. All drugs were diluted in dimethyl sulfoxide (DMSO) to the appropriate concentrations. Both ruxolitinib and control chow was provided by Incyte Corp. Ruxolitinib chow was packaged in a pre-determined measurement of 2000 mg/kg chow; mice were allowed to free-feed for the duration of the study.

Serum PRL was determined using the Sigma-Aldrich Mouse Prolactin ELISA kit (RAB0408) using the manufacturer’s protocol.

Immunohistochemistry analysis (IHC) and immunofluorescence (IF) were performed as previously described [9, 11, 34]. MOM and vectastain Elite ABC rabbit kits (cat.no. PK-2200 and PK-6101; Vector Laboratories) were used according to the manufacturer’s protocols. Primary antibodies used included mouse monoclonal antibodies against HA (1:250; cat.no.901503; Covance) and BCL-xL (1:50; cat.no. K1308; Santa Cruz) and rabbit antibodies against pSTAT5 1:300; cat.no. 9359 L; Cell Signaling), cleaved caspase 3 (1:300; cat.no. Asp175; Cell Signaling), and Ki67 (1:300; cat.no. MIB-1; Lycra). Secondary antibodies for IF were Alexa Fluor 568 goat-anti-rabbit, and Alexa 488 goat-anti-mouse. Nuclei were counterstained with 4′-6-diamidino-2-phenylindole (DAPI)-containing mounting medium and hematoxylin, respectively, for IF and IHC. TUNEL assay was performed using the ApopTag Red in situ TUNEL detection Kit (Chemicon, S7165). Bright-field images were captured using a Leica DMLB microscope. IF images were captured using the Zeiss Axiskop2 plus microscope.

For quantification of cells stained for a marker, 10 random fields of early lesions in each mammary gland were captured, and both positively stained cells and the total number of cells in the lesion as identified by DAPI or hematoxylin staining were counted to determine the percentage of positivity. ImageJ software was used for counting cells and determining lesion size. The total numbers of cells in IF images were counted using a semi-automotive program that has been previously described [38]. Fixed thresholds were set to analyze both experimental and control mammary glands.

Lung metastases were detected by the quantitative-PCR (qPCR) method using a set of primers specific for the RCAS provirus (CTTCCCTGCCGCTTCC; FWD: AGCCGCCTCAAGTCATGATG; GCTCTTTCCAATGTACCGATAACCT). DNA was extracted from the largest, left-most lobe of the lung. A mammary tumor induced by RCAS-caErbB2 was used as positive control, and a lung from a FVB mouse without virus injection was used as negative control. The relative amounts of the RCAS provirus with respect to the endogenous gene β-actin were determined using the 7500 Fast System software provided by Applied Biosystems.

We have reported a mouse model that closely mimics human breast cancer initiation and is ideally suited for studying hormones and other factors that may impact breast cancer risk [9, 11, 34, 38‐42]. Tumor initiation is achieved by intraductal injection of a Rous sarcoma virus-based vector, RCAS, to deliver an oncogene into a small subset of mammary epithelial cells (< 0.3% of the mammary gland) in a normally developed mammary gland so that cancer initiates in a “field” of normal mammary cells in a normal mammary gland as most human breast cancers initiate and evolve [34]. This subset of mammary epithelial cells was made susceptible to RCAS infection by transgenic expression of the gene encoding the RCAS receptor TVA from the MMTV promoter (MMTV-tva) [34]. The transgenic avian tva is only required for the initial virus infection; the virus does not replicate in mammalian cells. Additionally, the oncogene is transcriptionally controlled by the proviral RCAS long terminal repeat (LTR); it is constitutively active and is not influenced by the presence of reproductive hormones such as prolactin [39, 43]. Using this method, we explored the effect of several antipsychotics on mammary cancer development from preexisting early lesions. We injected 10 week-old MMTV-tva mice intraductally with RCAS-caErbB2 to infect approximately 0.3% of the luminal epithelial cells [34, 44]. RCAS-caErbB2 expresses a constitutively active form of rat ErbB2 (HER2/Neu); ErbB2 is amplified/mutated in 20–25% of human breast cancers [45]. Five days following injection, mice were randomized for treatment with risperidone (3 mg/kg daily), a commonly prescribed class 2, “atypical” antipsychotic that is known to cause hyperprolactinemia [2], or with vehicle. Introduction of the oncogene took place before drug treatment so as to specifically investigate antipsychotic effects on preexisting precancerous early lesions rather than the overall risk that antipsychotics may pose on the normal mammary epithelia. Mice were continually treated with either risperidone or the diluent control in drinking water for the duration of the study. While vehicle-treated mice developed tumors with a median latency of 112 days, the risperidone cohort developed tumors with a median latency of only 59 days (p = 0.000138; Fig. 1a). Additionally, the risperidone-treated cohort had a greater tumor multiplicity than the control (p = 0.002; Fig. 1b). When the tumor size reached 2.0 cm in diameter, mice were euthanized. As expected, serum PRL levels were significantly increased in the risperidone cohort (p = 0.004; Fig. 1c). Tumors from both cohorts were high-grade, poorly differentiated, and highly mitotic with areas of necrosis. Many of the tumor cells were highly pleomorphic with large nuclei, often with metaplastic features. These tumors extensively invaded the surrounding fibroadipose tissue, skeletal muscle, and nerves (Additional file 1: Figure S1A). Likewise, incidence of pulmonary metastasis was similar in the two cohorts of mice based on qPCR analysis of the RCAS-proviral load (p = 0.753; Additional file 1: Figure S1B). Therefore, we conclude that treatment with risperidone accelerates tumorigenesis and increases tumor multiplicity in mice with preexisting precancerous mammary lesions, while not influencing the grade, aggressiveness, or metastatic potential of the resulting tumors.

To investigate whether risperidone also accelerated tumorigenesis initiated by other oncogenic events, we injected MMTV-tva mice (n = 25), at 10 weeks of age, with RCAS carrying an activated form of HRas, HRasQ61L (RCAS-HRasQ61L). RAS genes are known to be amplified/overexpressed/mutated in a subset of human breast cancer, and their protein products often activated [46‐49]. Five days following injection, mice were continually treated with risperidone or vehicle in their drinking water. While vehicle-treated mice developed tumors with a median latency of 25 days, the risperidone cohort developed tumors with a median latency of only 11 days (p = 0.003; Fig. 1d). Additionally, the risperidone-treated cohort had a higher tumor multiplicity than the control (p < 0.0001; Fig. 1e). Taken together, these data suggest that risperidone stimulates tumorigenesis initiated by multiple oncogenic events.

We next determined if this tumorigenic acceleration was due to antipsychotic effects on early lesion development. Here we used RCAS-caErbB2-infected mice and treated them with risperidone or vehicle for only 2 weeks. Early lesions were defined as any hyperplastic ductal foci comprised of three or more layers of epithelial cells stained positively for the provirus-encoded oncogene product HA tag. Risperidone-treated mice had more early lesions and higher early lesion burden than the vehicle control cohort (Fig. 2a). Therefore, we conclude that risperidone promotes early lesion progression.

To test whether the above-observed risperidone effect on mammary early lesions is broadly applicable across different subtypes of breast cancer, we administered risperidone or vehicle to mice transgenic for MMTV-Wnt1 [50], which develops basal-like tumors and some estrogen receptor (ER)-positive tumors [51‐53]. Mice treated with risperidone for 2 weeks developed extensive ductal branching and many more and larger early lesions compared to vehicle-treated mice (Additional file 2: Figure S2A-2B). Taken together, these data suggest that risperidone stimulates the progression of early lesions that are the precursor to multiple breast cancer subtypes.

To determine the underlying mechanisms by which risperidone spurred early lesion expansion, we first compared the precancerous cell proliferation in these two cohorts of mice injected with RCAS-caErbB2. Ki67 staining detected approximately 20% of positive cells in both sets of early lesions (p = 0.469; Fig. 2b), suggesting that proliferation did not play a significant role in risperidone acceleration of early lesion development. Besides cell proliferation, evasion of apoptosis serves a key role in the progression of precancerous early lesions to cancer [54, 55]. We have reported that apoptosis was rapidly activated in mammary cells following ErbB2 activation to provide a barrier to cancer [11, 42, 44]. Both cleaved caspase 3 (CC3) and TUNEL detected robust apoptosis (3.6% (2.7–6.3%) and 3.5% (2.8–4.1%), respectively) in early lesions in vehicle-treated mice, as expected; however, these apoptosis levels were diminished in the risperidone cohort (0.2% (0.07–0.5%), p = 0.006 and 0.5% (0.05–0.9%), p = 0.0286, respectively) (Fig. 2c-d). These results demonstrate that treatment with risperidone allows precancerous cells to suppress the apoptotic anticancer barrier to increase early lesion burden.

To test whether other hyperprolactinemia-inducing antipsychotics also instigate early lesion progression, we treated a separate cohort of early lesion-bearing mice with pimozide, which is a “typical”, class 1 antipsychotic that is also known to induce hyperprolactinemia [10]. As expected, this antipsychotic also led to hyperprolactinemia in these mice (p = 0.007; Additional file 3: Figure S3A). Like risperidone, pimozide (5 mg/kg daily) for 2 weeks increased early lesion numbers (from 22 (12.8–31) to 64 (42.5–98), p = 0.004) and led to a greater early lesion burden (Additional file 4: Figure S4A). While not affecting cell proliferation (Additional file 4: Figure S4B), pimozide suppressed apoptosis in early lesions based on both CC3 and TUNEL (p = 0.0002 and p = 0.0007, respectively; Additional file 4: Figure S4C-3D). Taken together, these data indicate that hyperprolactinemia-inducing antipsychotics dismantle the apoptosis anticancer barrier in early lesions and instigate their progression to cancer.

To investigate whether antipsychotics that do not cause hyperprolactinemia have the potential to accelerate early lesion progression, we tested aripiprazole, a widely prescribed class 2, “atypical” antipsychotic that does not elevate prolactin levels but is otherwise mechanistically similar to risperidone [2]. Two weeks of aripiprazole (28 mg/kg daily) did not elevate serum prolactin levels (Additional file 5: Figure S5A), and failed to increase the load of RCAS-caErbB2-initiated early lesions (Additional file 5: Figure S5B). Likewise, this drug did not affect cell proliferation (Additional file 5: Figure S5C) or apoptosis as tested by TUNEL (Additional file 5: Figure S5D). In addition, clomipramine, a commonly prescribed antidepressant that did not cause hyperprolactinemia in our mouse model (p = 0.151; Additional file 5: Figure S5E) also failed to increase early lesion burden (p = 0.687; Additional file 5: Figure S5F). Together, we conclude that hyperprolactinemia-inducing antipsychotics cause preexisting early lesion to suppress the apoptosis anticancer barrier and to accelerate progression to cancer; these cancer-promoting effects are associated with hyperprolactinemia.

PRL is a key hormone released during pregnancy and lactation, and activates STAT5 via its receptor PRLR and the receptor-associated JAK2 [7]. Forced or pregnancy-associated JAK2/STAT5 activation lowers the apoptosis anticancer barrier in preexisting early lesions and advances the progression to cancer [11]. To understand the underlying mechanism by which hyperprolactinemia-inducing antipsychotics suppress the apoptosis anticancer barrier and increase breast cancer risk, we asked whether treatment with risperidone activates the STAT5 signaling pathway. In vehicle-treated mice bearing early lesions initiated by RCAS-caErbB2, pSTAT5+ cells were detected in 11% (5.7–30.3%) of precancerous cells, a level similar to those previously reported [11]; however, 2 weeks of risperidone treatment increased their population size to 86.4% (84.2–94.3%) (p = 0.0079; Fig. 3a). Induction of STAT5 activity was also detected in normal ducts that did not gain caErbB2 (Fig. 3a). We confirmed that serum PRL levels were significantly increased in the risperidone cohort (p = 0.029; Fig. 3c). Bcl-xL and β-casein are genes that are transactivated by STAT5, and their gene products contribute to cell survival and alveolar differentiation, respectively [56, 57]. As expected, β-casein was induced in early lesions and in normal ducts (Fig. 3b). Likewise, Bcl-xL was induced in early lesions (Fig. 3d). Additionally, we found that pSTAT5 levels were elevated in lesions of the risperidone-treated MMTV-Wnt1 transgenic mice compared to the vehicle-treated control cohort (Additional file 2: Figure S2C).

Next, we tested whether pSTAT5 and its transcriptional target β-casein were also upregulated by pimozide. While 7.3% (3.4–14.6%) of cells in the early lesions of vehicle-treated mice were pSTAT5+, 58% (50–89%) of cells in the early lesions of pimozide-treated mice were pSTAT5+ (p = 0.0007; Additional file 3: Figure S3B). β-casein was also induced following pimozide administration (Additional file 3: Figure S3C). Of note, pimozide has been reported to block STAT5 activation in cultured cells [58, 59], but this potential direct effect on STAT5 was overridden in vivo by hyperprolactinemia-induced PRL signaling. To further test the association between hyperprolactinemia and activation of STAT5, we also stained for pSTAT5 in early lesions in mice treated with aripiprazole, which did not increase PRL. No evidence of STAT5 activation was detected (Additional file 3: Figure S3D). Together, these data suggest that hyperprolactinemia-inducing antipsychotics activate STAT5 and its transcriptional targets to suppress the apoptosis-anticancer barrier in preexisting precancerous cells, while simultaneously inducing alveolar differentiation in both early lesions and normal ducts.

PRL-PRLR signaling activates STAT5 and possibly several other pathways including extracellular signal-related kinase (Erk) and protein kinase B (Akt) [60]. We tested whether the gene encoding STAT5a, the predominant form of STAT5 in the mammary gland and tumorigenesis [35, 61], is required for the above-observed effects of risperidone on early lesion progression, to investigate whether STAT5 activation is the crucial factor mediating antipsychotic stimulation of carcinogenesis. We utilized STAT5a^−/− mice on the FVB background as STAT5a ablation on this background does not significantly impair normal mammary development and lactogenesis [11]. These STAT5a knockout mice were bred to MMTV-tva mice, infected with RCAS-caErBb2, and 5 days later, continually treated with either risperidone or vehicle control for 2 weeks. STAT5a^+/+/MMTV-tva mice infected with RCAS-caErbB2 were also treated with risperidone for 2 weeks for comparison. Risperidone treatment failed to activate STAT5 in STAT5a^−/− mice – the percentage of pSTAT5+ cells was comparable to that in the vehicle-treated mice (p = 0.908) and much lower than that in STAT5a wild-type mice treated with risperidone (p = 0.004; Fig. 4a). The residual levels of pSTAT5 in STAT5a^−/− mice were likely due to the minor player pSTAT5b. Additionally, β-casein, a transcriptional target of STAT5, was elevated in the risperidone-treated STAT5a wild-type mice, but severely diminished in the STAT5a knockout risperidone-treated group (Additional file 6: Figure S6). Next, we asked if STAT5a-knockout-induced diminishment of STAT5 activity restored apoptosis in early lesions in the risperidone cohort. In comparison to the wild-type mice treated with risperidone, the STAT5a^−/− mice treated with risperidone had significantly elevated levels of apoptosis as measured by TUNEL (p = 0.0002; Fig. 4b), which were comparable to those in the vehicle-treated STAT5a^−/− mice (p = 0.981; Fig. 4b). This finding indicates that STAT5a plays a pivotal role in the effects of risperidone on evading the apoptotic anticancer barrier. Next, we examined whether STAT5 activity reduction also led to a lower early lesion burden in risperidone-treated mice. Indeed, STAT5a^−/− mice treated with risperidone had significantly lower levels of the early lesion burden than the STAT5a^+/+ mice treated with risperidone (p = 0.005; Fig. 4c), and further, these low levels were comparable to the levels in the vehicle control STAT5a^−/− mice (p = 0.995; Fig. 4c). Taken together, these results demonstrate that STAT5 activity is responsible for evading the apoptosis anticancer barrier in early lesions and for instigating early lesion progression.

Many older women on hyperprolactinemia-inducing antipsychotics may have already accumulated early lesions and subsequently may be at increased risk of breast cancer due to family history, older age, or other reasons. Our aforementioned findings suggest that these antipsychotics likely also stimulate the progression of the early lesions in these high-risk women. For these women, it may be advisable to switch to another antipsychotic that does not cause hyperprolactinemia; however, switching to another drug is often difficult for fear of relapse and/or withdrawal effects. Consequently, it is important to identify effective breast cancer preventive strategies in high-risk women who need to take these types of antipsychotics. There are currently only a few US Food and Drug Administrtion (FDA)-approved drugs for breast cancer chemoprevention, all of which antagonize estrogen signaling [62]. As these drugs require 5 years of continuous treatment to lower breast cancer risk by 50%, do not prevent estrogen receptor (ER)-negative cancer, and can have significant side effects, they are not widely used for prevention [62]. However, we have previously reported that short-term suppression of either pSTAT5 or JAK1/2 activity can restore the apoptosis anticancer barrier and reduce mammary tumor risk in mouse models [11]. Ruxolitinib is an FDA-approved small molecule inhibitor of JAK1/2 for the treatment of myelofibrosis and polycythemia vera; it has minimal significant side effects following short-term use in healthy individuals [63‐66]. Therefore, we asked whether short-term ruxolitinib treatment could prevent mammary tumors in early lesion-bearing mice on risperidone. Here, ruxolitinib-supplemented or control chow was fed to risperidone-treated mice bearing early lesions initiated by RCAS-caErbB2. After 2 weeks of treatment, serum PRL levels in both cohorts remained elevated, as expected (p = 0.98; Additional file 7: Figure S7A); however, ruxolitinib significantly lowered the percentages of pSTAT5+ cells in early lesions (p < 0.0001; Additional file 7: Figure S7B), indicating that risperidone-induced activation of STAT5 depends on JAK1/2 activity. Ruxolitinib did not affect precancerous cell proliferation based on Ki67 (p = 0.629; Fig. 5a), as expected from non-detectable impact on precancerous cell proliferation by risperidone; however, mice fed with ruxolitinib chow had restored apoptosis in early lesions as measured by CC3 and TUNEL (p = 0.006 and 0.0357, respectively; Fig. 5b-c), reaching/surpassing the levels detected in early lesions in mice not treated with any antipsychotic (Fig. 2c-d). Importantly, these mice had a much lower early lesion burden than the mice on the control chow (p = 0.024; Fig. 5d). Furthermore, we investigated whether ruxolitinib could prevent/delay tumor appearance. Here, we injected MMTV-tva mice (n = 14), 10 weeks of age, with RCAS-HrasQ61L virus. Five days later, we randomized the mice into two groups for risperidone water plus ruxolitinib-supplemented chow or for risperidone water plus control chow. While the control-chow-treated mice on risperidone developed tumors with a median latency of 9 days, the ruxolitinib-chow cohort on risperidone developed tumors with an extended median latency of 13 days (p = 0.008; Additional file 7: Figure S7C). These data further confirmed the importance of PRL-stimulated JAK-STAT5 signaling in lowering the apoptosis anticancer barrier and in increasing early lesion burden and progression in mice on risperidone. Taken together, short-term treatment with ruxolitinib restores apoptosis in early lesions, reduces early lesion burden, and lowers mammary tumor risk in mice on hyperprolactinemia-inducing antipsychotics; therefore, these data suggest that prophylactic treatment with ruxolitinib may lower breast cancer risk in high-risk women who are on these antipsychotics.