Skip to main content
main-content

01.12.2011 | Research | Ausgabe 1/2011 Open Access

Virology Journal 1/2011

Identification of a natural human serotype 3 parainfluenza virus

Zeitschrift:
Virology Journal > Ausgabe 1/2011
Autoren:
Hui-Ting Yang, Qing Jiang, Xu Zhou, Mu-Qun Bai, Hong-Li Si, Xiao-Jing Wang, Yan Lu, Heng Zhao, Hong-Bin He, Cheng-Qiang He
Wichtige Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1743-422X-8-58) contains supplementary material, which is available to authorized users.
Hui-Ting Yang, Qing Jiang contributed equally to this work.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

YHT, and JQ carried out sequence collection, alignment and recombination analysis and drafted the manuscript. ZX and BMQ provided LZ22 viral sequence information. SHL participated in sequence collection. WXJ, LY, ZH participated in revision of manuscript. HHB participated in its design and coordination. And HCQ designed the study and wrote the manuscript. All authors read and approved the final manuscript.

Introduction

Human parainfluenza virus (HPIV) is known to induce acute respiratory infections (ARI) including lower respiratory tract infection, which is a leading cause of morbidity and mortality in infants and young children [ 1, 2]. Until now, four serotypes of parainfluenza virus (PIV) infecting human being have been found. Especially, human PIV (HPIV) 1, 2 and 3 are the second leading causative agents of pediatric hospitalizations due to respiratory disease following respiratory syncytial virus (RSV) [ 3]. It is important to know the mechanism resulting in genetic and antigenic diversity of HPIV for controlling the pathogen.
As one member of the Respirovirus ge nus of the family Paramyxoviridae, HPIV is an enveloped non-segmented negative single-stranded RNA virus [ 4]. RNA viruses usually exhibit genetic variation, which can be attributed to their high rate of mutation during their replication process and the large population size [ 5]. In addition, homologous recombination has been recognized increasingly as a potentially important means of generating and shaping genetic diversity in positive strand RNA virus [ 6]. In several other members of the Paramyxoviridae family, Newcastle disease virus (NDV) [ 711] and human respiratory syncytial virus [ 12], natural recombinants have been detected. Moreover, attenuated vaccines were found to be able to influence the evolution process of NDV through exchanging their genetic material with circulating virus [ 7, 9, 11]. For HPIV, it is unknown whether there is natural recombinant virus circulating in the field.
In this study, we isolated and identified a natural type 3 HPIV mosaic isolate LZ22/FJ455842 (with a mosaic N gene) to show that homologous recombination can occur in HPIV3. Additionally, three HPIV1 isolates (HT88/U01082, HT89a/U01083 and HT89c/U01085) were found to be deposited in previous report. Interestingly, we also found that there were the two Swine PIV3 recombinants with mosaic L protein were thought to be associated with an cross-species infection in previous report [ 13, 14]. Collectively, these recombination events suggested that homologous recombination played a role in HPIV genetic diversity and rapid evolution.

Results and Discussion

The sequence of LZ22 complete genome has been deposited in GenBank (Access Number, FJ455842). And the PIV3 complete genome sequence alignment dataset was analyzed employing RDP3 software package for scanning the recombinant sequence. And the isolate LZ22 was found to have greatly strong recombination signal: RDP, p-value < 10 -21; GENECOVY, p-value < 10 -21, Bootscan, p-value < 10 -20, MaxChi p-value < 10 -3; Chimaera p-value < 10 -7; Siscan, p-value < 10 -8, 3Seq, p-value < 10 -13. And a breakpoint was located at position 485. Two strains GP and ZHYMgz01 were suggested as representatives of its putative parent lineages.
And then, Simplot software package was used to determine the recombination event [ 15]. Employing the Findsites subprogram of SimPlot, one potential breakpoint was located at parsimonious regions with the maximization of χ 2, from positions 485 to 615 (χ 2 = 122.3, P < 0.0001 of Fisher's exact test). A similarity plot (Figure 1A) which was constructed by using all sites, revealed that the sequence of LZ22 showed greater affinity with one putative parent lineage of GP in the region from position 1 to 485 than the other putative parent ZHYMgz01 (100% versus 94%). However, sequence from positions 486 to 15536, ZHYMgz01 shared greater similarity with LZ22 than GP (98% versus 95%). P value (Fisher's Exact Test) and χ 2 value of the breakpoint were shown on the vertical line in Figure 1. The identical evidence also appeared in BootScanning result (Figure 1B). The region from GP lineage spanned the amino terminal 1/3 of the N protein approximately.
At last, The phylogenic trees were also constructed using Mega 4 to determine the recombination events [ 16]. From positions 1 to 485, LZ22 and GP were clustered into the same sublineage with 98% bootstrap value, while ZHYMgz01 was grouped into distinct sublineage (Figure 2A). But, in the other portion, the arrangement of the phylogenetic tree reflecting the relationship of the three isolates was in contrast with the previous one (Figure 2B). The topology of the two phylogenetic trees around the breakpoint showed a significant statistic discrepancy when the mosaic was included in analyzed data (Shimodaira-Hasegawa test, P < 0.001), constituting a powerful evidence for recombination.
The minor putative parent of LZ22 was isolated from Japan, suggesting the existence of a global reservoir of HPIV with local subreservoirs supporting extensive levels of virus circulation, which permitted co-infection and resulted in the recombination event at last. The potential breakpoint 485 presents in gene N coding nucleoprotein spanning the region from positions 56 to 1737 of genomic sequence [ 17]. In the previous study, viable artificial chimeric HPIV3 recombinants were constructed, which contained the nucleoprotein open reading frame (ORF) from either BPIV3 Kansas or shipping fever (SF) strain in place of the HPIV3 N ORF. The artificial recombinant (PIV3) in which the nucleocapsid N protein had been replaced by that of bovine PIV3 was found to be attenuated in primates [ 18]. Here, we isolated a HPIV3 with a natural mosaic in NP ORF. Interestingly, before the breakpoint, the similarity of peptide sequences was up to 98.5% (129/131) although the similarity of gene sequences was only 94% between the two putative parent lineages. It is unknown whether the recombination in N gene is also associated with their adaptation in host cell via a changed virulence.
In addition, since there has been no report to show homologous recombination can take place between PIVs before this study; we analyzed 55 isolates (Table 1) from GenBank in order to determine to what degree genetic diversity of the virus is affected by the homologous recombination. Five additional mosaic PIV sequences were detected through the analysis of sequences from isolates characterized in previous reports:, HT88 (U01082) [ 19], HT89a [ 19] (U01083), HT89c (U01085) [ 19], 81-19252_Texas-81 (EU439429) [ 13, 14] and 92-7783_ISU-92 (EU439428) [ 13, 14] (Table 2). Two HN gene mosaics, HT88 and HT89a shared the same recombination event (Table 2), suggesting they descended from the same mosaic ancestor. Please also refer additional files 1, 2, 3, and 4 for the detail recombination information of each mosaic strain. These results suggested that homologous recombination did play a potential role in the evolution of the virus.
Table 1
Typical PIV isolates used in the study
GenBank Number
Strain
Serotype
Host
reference
NC_001796
unnamed
HPIV3
Human
[ 29]
AB012132
GP
HPIV3
Guinea pig
[ 30]
EU439429
81-19252_Texas-81
SPIV3
Swine
[ 13]
EU439428
92-7783_ISU-92
SPIV3
Swine
[ 13]
FJ455842
LZ22
HPIV3
Human
This study
NC_002161
unnamed
BPIV3
Bovine
[ 31]
EU424062
14702
HPIV3
Human
Unpublished
EU326526
ZHYMgz01
HPIV3
Human
Unpublished
D84095
910N
BPIV3
Bovine
[ 32]
AF178655
Shipping Fever
BPIV3
Bovine
[ 31]
AF178654
Kansas/15626/84
BPIV3
Bovine
[ 31]
Z11575
JS
HPIV3
Human
[ 33]
U51116
JS
HPIV3
Human
[ 34]
EU277658
Q5592
BPIV3
Bovine
[ 35]
U01082
HT88
HPIV1
Human
[ 19]
U01083
HT89a
HPIV1
Human
[ 19]
U01075
HT82a
HPIV1
Human
[ 19]
U70938
Mil-51/91
HPIV1
Human
[ 36]
U01074
HT81b
HPIV1
Human
[ 19]
U01073
HT81a
HPIV1
Human
[ 19]
U01076
HT82b
HPIV1
Human
[ 19]
U70937
Mil-49/91
HPIV1
Human
[ 36]
M86785
CH-B-73A
HPIV1
Human
[ 37]
U70947
Mil-63/91
HPIV1
Human
[ 36]
U70936
Mil-48/91
HPIV1
Human
[ 36]
M86786
CH-B-73B
HPIV1
Human
[ 37]
M86790
CH-B-83A
HPIV1
Human
[ 37]
U01079
HT85a
HPIV1
Human
[ 19]
M86791
CH-B-83B
HPIV1
Human
[ 37]
M86789
CH-B-79B
HPIV1
Human
[ 37]
U01084
HT89b
HPIV1
Human
[ 19]
U70948
Mil-64/91
HPIV1
Human
[ 36]
M86787
CH-B-77
HPIV1
Human
[ 37]
U01081
HT87
HPIV1
Human
[ 19]
M86784
CH-B-70
HPIV1
Human
[ 37]
U01080
HT85b
HPIV1
Human
[ 19]
U70943
Mil-58/91
HPIV1
Human
[ 36]
U01077
HT83a
HPIV1
Human
[ 19]
U70944
Mil-60/91
HPIV1
Human
[ 36]
U01085
HT89c
HPIV1
Human
[ 19]
U01078
HT83b
HPIV1
Human
[ 19]
AF016280
PIV1/Washington/
20993/1964
HPIV1
Human
[ 38]
M86788
CH-B-79A
HPIV1
Human
[ 37]
U70939
Mil-52/91
HPIV1
Human
[ 36]
U70941
Mil-54/91
HPIV1
Human
[ 36]
M86781
CH-A-80
HPIV1
Human
[ 37]
U70946
Mil-62/91
HPIV1
Human
[ 36]
U70942
Mil-55/91
HPIV1
Human
[ 36]
U70945
Mil-61/91
HPIV1
Human
[ 36]
U70940
Mil-53/91
HPIV1
Human
[ 36]
M86783
CH-A-81B
HPIV1
Human
[ 37]
M86780
CH-A-66
HPIV1
Human
[ 37]
M86782
CH-A-81A
HPIV1
Human
[ 37]
M31228
unnamed
HPIV1
Human
[ 39]
M91648
C39
HPIV1
Human
[ 40]
X55803
unnamed
HPIV1
Human
[ 40]
Table 2
Characteristics of PIV intragenic recombinants
Strain
χ 2 max
Simplot identified breakpoints
RDP identified breakpoints
Putative parent
lineages
Z-score
P-value*
LZ22
122.3
485-615
485
GP;
9.24
2.3E-9
       
ZHYMgz01
   
81-19252_Texas-81
366.9
8686-712
8688
910N;
9.34
2.5E-42
 
83.7
12613-730
12595
Shipping_Fever
   
 
69.1
13619-36
13619
 
6.45
3.5E-6
 
62.6
14134-245
14175
     
92-7783_ISU-92
179.7
14134-206
14137
910N;
9.52
1.3E-7
 
22.6
14863-5071
14989
Shipping_Fever
   
HT88**
7.9; 8.5
300-396
392; 839
Mil-49/91;
6.07
1.2E-7
   
828-867
 
HT89b
   
HT89a**
7.9; 8.5
300-396
392; 839
Mil-49/91;
6.07
1.2E-7
   
828-867
 
HT89b
   
HT89c**
6.4; 14.2
351-392
351; 767
Mil-58/91;
5.98
3.8E-6
   
534-828
 
Mil-51/91
   
*Z-score and p values were calculated with the highest P = 0.01 by using SiScan program in RDP [ 28]
**HN genes of HT88, HT89a and HT89c were only analyzed. The positions of breakpoints indicated the relative sites in HN gene.
Interestingly, two mosaic viruses 81-19252_Texas-81 (U439429) and 92-7783_ISU-92 (EU439428) were reported to be involved in a cross infection between swine and bovine [ 13, 14]. Both of the isolates had a mosaic L gene. The transcription and replication functions of the parainfluenza virus are associated with the large RNA polymerase protein. Additionally, polyadenylation, and RNA editing activities have to do with L protein [ 20]. The two putative mosaics were isolated from pigs in the United States [ 13, 14] while both of their putative parent lineages (Shipping fever and 910N lineages) belonged to BPIV3. Viruses are largely species-specific with respect to their host and usually do not cross species boundaries [ 5]. Recombination processes will allow some viruses to acquire many of the key adaptive mutations in a single step, and thus make a major leap in fitness, which might result in a change of host tropism [ 21]. It might be necessary to further study whether the recombination event is relative to the BPIV3 cross-species infection.
In conclusion, this study provides the potential evidence that there is mosaic PIV in the field. Our observations show that homologous recombination is a molecular mechanism of PIV genetic diversity and evolution. Therefore, this study might be important for knowing the genetic basis resulting in the rapid change of PIV biologic characteristics.

Material and methods

Virus and sequencing

The virus LZ22 was isolated from lower respiratory tract of a patient infant with pneumonia in Lanzhou, Gansu Province of China in 2003. The virus was identified using previously described protocols [ 22]. After isolated, LZ22 was also purified 3 times by the plaque forming method in Vero cells. Before sequencing, LZ22 was passaged 13 times and amplified in Vero cells for RT-PCR. Viral RNA was extracted from Vero cell virus cultures using RNAeasy mini kit (Qiagen, Netherlands) following the manufacturer's instructions. Reverse transcription was performed using SuperScriptΠ one-step RT-PCR platinum Taq HiFi kit (Invitrogen, USA). 3' and 5' RACE were performed using 5'-full RACE CORE kit and 3'-RACE kit (Takala Dalian) to analyze the 3' and 5' UTR sequences. The primers of PCR and 3' and 5' RACE used in this study were listed in Table 3. The full genome of LZ22 was amplified and sequenced referring to previous report [ 22]. All PCR products were cloned into pGEM-T-vector (Promega USA) and sequenced by Takara Biotechnology (Dalian, China).
Table 3
Primers for sequencing of genome of HPIV-3 LZ22 strain
Fragment
(Positions)
Primer
(5'-3')
Sequence
NP
NPS
ACCAAACAAGAGAAGAGACTTGTTTGG
(1-1843)
NPA
TTCCTCTTCCCAAGAATCCATGATTTG
PP
PPS
GGACGAAATAGACGATCTGTTCAATGC
(1616-3485)
PPA
CTGTTCATTGACTTTGAGTGGTAATGG
M
MS
TCACTAGTTGCAGTCATCAACAACAGC
(3452-5183)
MA
CCCTTTGGGACTATTGACCAATACACC
F
FS
TGCAATTTTCCAACCTTCTTTACCTGG
4724-7104)
FA
AAGAAGCCTTGTATTCACTCCTGACTG
HN
HNS
AAATCGAGTGGATCAAAATGATAAGCC
(6644-8744)
HNA
TGTGTAATTGTGCTATTCTACCTTTAACG
L1
L1S
TGTTCAAAACAGAGATTCCAAAAAGCTGC
(8489-10684)
L1A
TCCAAATAGAGCCGTTGATTCATATCTCC
L2
L2S
CTGGAGATATGAATCAACGGCTCTATTTG
(10654-12958)
L2A
AATTGCATGTATAATGTCAGTATCATCCC
L3
L3S
TATTGGGATGATACTGACATTATACATGC
(12926-15461)
L3A
ACCAAACAAGAGAAGAACTCTGCTTGGTA
3'RACE (617)
S
TTGAACATAGAGCACAGACTGG
 
A*
TACCGTCGTTCCACTAGTGATTT
(399)
Sn
GCTGATACGGATTCAGATTCATTCAAATTATC
 
An*
CGCGGATCCTCCACTAGTGATTTCACTATAGG
5'RACE
S*
CATGGCTACATGCTGACAGCCTA
(15088)
A
AATAGCTCCTAAACATGATGGATACCC
 
Sn
CGCGGATCCACAGCCTACTGATGATCAGTCGATG
(15423)
An
TGACATCTGCATTACTTCCATTTGTTGTTAGG
*Primers were supplied by manufacturer

Recombination analysis

Compete genome and HN gene of PIV were retrieved from GenBank and aligned with CLUSTALW [ 23]. PIV3 compete genome and HPIV1 HN genes sequences analyzed in the study were listed in Table 1. Phylogenetic Neighbor-Joining (NJ) trees were set up by MEGA4 [ 16]. The nucleotide substitution models were optimized for Maximum-Likelihood (ML) trees employing jmodeltest (version 0.1.1) [ 24]. ML trees were constructed employing Phyml software with nucleotide substitution model of general time reversible model (GTR) and gamma distributed 4 (G4) [ 25], and displayed as graphics by using MEGA4 to determine the topology of each tree. Identification methods of homologous recombination were described as previous report [ 26, 27]. Briefly, the sequence alignment files were sought for potential mosaic isolates using RDP software package [ 24, 28]. The gene sequence similarity of mosaics and their putative parents were compared and displayed as graphics with Simplot software [ 15]. At last, incongruent phylogenetic relations of different gene regions delimited by crossover point were determined by phylogenetic trees.

Acknowledgements

We would like to thank Prof. Elankumaran S for the detailed information of the two mosaic isolates 81-19252_Texas-81 (EU439429) and 92-7783_ISU-92 (EU439428); and the anonymous reviewers for helpful comments. This work was supported by a Project of Shandong Province Higher Educational Science and Technology Program (J09LCD209-12) and a Shangdong Province Young and Middle-Aged Scientists Research Awards Fund (BS2009NY011) to H.C.Q. State Scientist in Industrial Technology System of Dairy Cattle (H.H.B), Taishan Scholar and Distinguished Experts from overseas (H.H.B), A Major Application of Technological Innovations of Agriculture of Shandong Province (H.H.B).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

YHT, and JQ carried out sequence collection, alignment and recombination analysis and drafted the manuscript. ZX and BMQ provided LZ22 viral sequence information. SHL participated in sequence collection. WXJ, LY, ZH participated in revision of manuscript. HHB participated in its design and coordination. And HCQ designed the study and wrote the manuscript. All authors read and approved the final manuscript.
Zusatzmaterial
Additional file 1:The detail recombination information of mosaic strain 81-19252_Texas-81_EU439429. (A, B) Results of Similarity and Bootscanning analysis of 81-19252_Texas-81_EU439429. The y-axis in Similarity plot (A) gives the percentage of identity within a sliding window of 500 bp wide centered on the position plotted, with a step size between plots of 20 bp, while in Bootscanning plot (B) represents the percentage of permuted trees. Shipping_Fever_AF178655 and 910N_D84095 were used as two parental sequences and Q5592_EU277658 an outgroup sequence. Four breakpoints were identified and located by GARD at position 8688, 12595,13619 and 14175, respectively, with value maximized. The query sequence 81-19252_Texas-81_EU439429 demonstrated greater sequence identity and Bootscanning support with 910N_D84095 in the second and fourth regions while otherwise with Q5592_EU277658 in the complementary regions. (C-G) Neighbor-Jointing Phylogenetic profiles of separate regions of 81-19252_Texas-81_EU439429 partitioned by cross-over events. The scale corresponds to the number of nucleotide substitutions per site. The putative recombinants were showed with "black square". C-G) represent the phylogeny of fir-(1-8688), sec-(8689-12595), thi-(12596-13619), fou-(13620-14175) and fin-(14176-15536) part of full length segment, respectively. The sec-and fou-part of mosaics demonstrated higher level of congruence with the 910N_D84095 lineage, while the otherwise converge with Shipping_Fever_AF178655. (DOC 1006 KB)
Additional file 3:The detail recombination information of mosaic strains HT88_U01082 and HT89a_U01083. (A, B, C, D) Results of Similarity and Bootscanning analysis of HT88_U01082 and HT89a_U01083. The y-axis in Similarity plot (A) gives the percentage of identity within sliding windows of 400 or 300 bp wide centered on the position plotted, with a step size between plots of 20 bp, while in Bootscanning plot (B, D) represents the percentage of permuted trees. Mil-49/91_U70937 and HT89b_U01084 were used as two parental sequences and CH-A-81A_M86782 and CH-A-81B_M86783 outgroup sequences. Two breakpoints were identified and located by GARD at position 392 and 839, respectively, with value maximized. The query sequences HT88_U01082 and HT89a_U01083 demonstrated greater sequence identity and Bootscanning support with HT89b_U01084 in the middle region while otherwise with Mil-49/91_U70937 in the complementary regions. (C-E) Maximum-Likelihood Phylogenetic profiles of separate regions of HT88_U01082 and HT89a_U01083 partitioned by cross-over events. The scale corresponds to the number of nucleotide substitutions per site. The putative recombinants were showed with "black square" (HT88_U01082) and "black triangle" (HT89a_U01083). E-G) represent the phylogeny of pre-(1-392), mid-(393-839) and post-(840-1728) part of complete segment HN, respectively. The pre-and post-part of mosaics demonstrated higher level of congruence with the HT89b_U01084 lineage, while the mid-part converge with Mil-49/91_U70937. (DOC 564 KB)
Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 1/2011

Virology Journal 1/2011 Zur Ausgabe

Neu im Fachgebiet Innere Medizin

Mail Icon II Newsletter

Bestellen Sie unseren kostenlosen Newsletter Update Innere Medizin und bleiben Sie gut informiert – ganz bequem per eMail.

© Springer Medizin 

Bildnachweise