Background
Increasing evidence indicates that tumors are promoted and sustained by inflammatory signals from the tumor microenvironment, and the tumor microenvironment plays important roles in the promotion of cancer [
1,
2]. Cytokines, especially the cytokines secreted by tumor cells, are essential components of the tumor microenvironment. Tumor necrosis factor alpha (TNF-α), interleukin-1β (IL-β) and IL-6 are the most well-characterized cytokines which have been demonstrated to be closely related to cancer progression. A lot of studies have shown that inflammation induced by cytokines plays an important role in the development of gastric cancer [
3]. It is well established that infections, especially those induced by
Helicobacter pylori, are capable of inducing gastric mucosal inflammatory responses, resulting in upregulation of IL-1β, which in turn may promote inflammation-associated carcinogenesis [
4]. However, the underlying molecular mechanisms for the role of IL-1β signaling in gastric carcinogenesis remain largely unknown, and are currently of interest.
P38 is a member of the mitogen-activated protein kinase (MAPK) superfamily. The MAPK signaling pathways have been well investigated, and are comprised of at least three superfamilies of MAPKs which regulate diverse cellular activities [
5]. It is well known that p38 MAPK is capable of regulating a lot of cellular responses to cytokines and stress, including IL-1β [
6]; however, recent data demonstrated that p38 is also closely related to the development of different types of human cancer via its ability to elevate cancer cell migration and invasion in response to various stimuli, including inflammatory factors [
6]. Additionally, p38 is also involved in the regulation of cell differentiation and apoptosis. Four isoforms of p38 have been identified so far: p38-α, p38-β, p38-γ, and p38-δ [
7]. Though the amino acid sequences of these p38 MAPKs are mostly identical, the expression pattern of each isoform varies [
8]. P38-α is the major p38 MAPK and is expressed ubiquitously, p38-β is mainly expressed in the brain, whereas p38γ is abundantly expressed in skeletal muscle [
9] and p38-δ is mainly expressed in endocrine glands [
10]. Many studies have also demonstrated that p38 participates in IL-1β signaling cascades in a set of cell types, especially in mouse embryonic fibroblast (MEF) cells and macrophages cells [
11,
12]; however, very little is known about the function of IL-1β-activated p38 in gastric cancer.
c-Jun N-terminal kinase (JNK) is another MAPK family member which is also well known to play an important role in regulation IL-1β signaling pathway [
13]. In addition to participation in regulation inflammatory signal pathway, JNK performs several other important cellular functions including regulation of cell growth, differentiation, survival and apoptosis. Furthermore, recent studies demonstrate that JNK is frequently over-expressed in different cancer tissues, and up-regulation of JNK may be closely associated with cancer invasion [
14]; however, whether JNK participates in regulation of IL-1β-induced gastric cancer cell migration and invasion remains largely unknown.
Gastric adenocarcinoma (GA) is the most common neoplastic tumor of the stomach; therefore, we focused on GA in this study. Here, we investigated the activation of p38 and JNK in response to IL-1β, and their effect on IL-1β-induced metastatic potential of GA cells in vitro or vivo. Additionally, the expression of phospho-p38 (p-p38) in GA, its relationship to the clinicopathologic features of GA, and the correlation between the expression of IL-1β and p-p38 were investigated in human paraffin-embedded GA tissues using immunohistochemistry. Finally, we also characterized the molecular mechanisms which regulate the IL-1β-induced p38-mediated metastatic potential of GA cells.
Discussion
A number of studies have suggested that IL-1β is capable of activating p38 and JNK [
11,
12], and p38 and JNK play important roles in cancer cell migration and invasion [
14,
23‐
26]. Therefore, we hypothesized that IL-1β may contribute to GA cell invasion and metastasis via activating the p38 and JNK pathways. To investigate this possibility, we assessed the ability of IL-1β to activate p38 and JNK, and promote the migration and invasion of GA cells. Our results showed that IL-1β could activate both p38, and JNK, and increase GA cell migration and invasion, and that these effects could be inhibited by p38 siRNA or the p38 inhibitor SB 202190, but not JNK siRNA or JNK inhibitor SP600125. This is the first demonstration that IL-1β can induce GA cell migration and invasion via activation of p38; however, the underlying molecular mechanisms by which IL-β-mediated p38 signaling is regulated during gastric carcinogenesis remain largely unknown.
One potential mechanism by which p38 could increase the invasion and migration of cancer cells is by elevating the levels of MMPs [
27]. It is well established that secretion of MMPs with the capacity for extracellular matrix (ECM) degradation is a feature of metastatic cancer cells [
28]. MMP2 and MMP9 are two of the most well-characterized MMPs and are closely associated with cancer invasion and metastasis due to their strong proteolytic activity of ECM [
29]. We report here also for the first time that the likely molecular mechanism by which IL-1β promotes GA cell migration and invasion may involve the IL-1β/p38/AP-1(c-fos)/MMP2 & MMP9 signaling pathway. We demonstrated that both MMP2 and MMP9 were upregulated in GA cells in response to IL-1β stimulation; these effects were inhibited by siRNAs against
p38, MMP2 or
MMP9, the p38 inhibitor SB202190, and the MMP2/9 inhibitor BiPs. Furthermore, knockdown of
MMP2 or
MMP9 using siRNAs, or inhibition of MMP2/9 activity using BiPs, significantly decreased IL-1β-induced GA cell migration and invasion. As a serine/threonine protein kinase, p38 is capable of inducing activation of the transcription factor AP-1 [
30]. We further found that the IL-1β-induced, p38-mediated upregulation of MMP2 and MMP9 were AP-1-dependent. IL-1β was only able to activate the transcription of
MMP9 promoter regions containing AP-1 sites, and these effects were attenuated by p38 siRNA and the p38 inhibitor SB202190. Additionally, IL-1β-induced activation of AP-1-dependent transcription was inhibited by p38 siRNA.
Phospho-p38 (p-p38), the activated form of p38, could be detected in nearly 50% of the human GA tissue samples tested by IHC assay, and expression of p-p38 was significantly associated with lymph node metastasis, and invasion beyond the serosa in patients with GA. Moreover, the expression of IL-1β positively correlated with the expression of p-p38, MMP2, MMP9 and c-fos in the clinical GA specimens. Furthermore, in vivo data from the metastasis assay demonstrated that the formation of lung metastatic foci by GA cells, and p38/ p-p38, MMP2, MMP9 and c-fos mRNA and protein expression in the lung metastatic foci were elevated by IL-1β, and reduced by injection of cells transfected with p38 siRNA. Taken together, these data strongly suggest that IL-1β-induced GA cell migration and invasion occur via activation of the p38 signaling pathway which leads to AP-1 activation and upregulation of MMP2 and MMP9. Therefore, p38 plays an essential role in IL-1β-induced metastasis in GA.
JNK is another important MAPK to be well known to play important roles in regulation IL-1β signaling in several different cells [
14,
31]. However, in this study, JNK was found to be not involved in regulation of IL-1β-induced GA cell migration and invasion. JNK siRNA and JNK inhibitor did not attenuate IL-1β induced GA cell migration and invasion, nor attenuate activation of AP-1 induced by IL-1β. Therefore, IL-1β-promoted GA cell migration and invasion are regulated by p38, but not by JNK.
In summary, we have identified for the first time that IL-1β is functionally involved in the regulation of metastasis in GA via activation of p38. This molecular mechanism involves p38-mediated AP-1-dependent upregulation of both MMP2 and MMP9; and this study strongly suggests that the IL-1β/p38/AP-1(c-fos)/MMP2 & MMP9 pathway may be closely related to metastasis in GA, and therapeutic strategies targeting this pathway may enhance the survival of patients with GA.
Methods
Patients and tissue samples
The paraffin embedded blocks from 105 patients with resectable GA who underwent surgery between 2003 and 2005, and pair normal gastric tissues from the same patients were obtained from Fuzhou General Hospital (Fuzhou, Fujian). All of the GA tissue samples chosen in this study were from patients underwent curative gastrectomy with lymph node dissection without surgery related major or serious complications. TNM stages, histological type, and grade of differentiation were identified by several pathologists according to the standards established by NCNN guideline 2011, and no previous benign disease was identified in the samples from patients with metastasis. GA patients were aged 32–84 years old (average 58 years). There were 97 cases with available data of T-stage (92%); T1 (20 cases), T2 (32 cases), T3 (30 cases) and T4 (15 cases). The tissue samples were used with the consent of the patients. This study was approved by the Ethics Committee of Fuzhou General Hospital (Project: 2011-Z032-A).
Immunohistochemistry for phospho-p38, IL-1β, MMP-2 and 9, and c-fos
To detect the expression of p-p38 in the 105 cases of GA tissues and in nude mice lung metastasic gatric cancer by immunohistochemistry (IHC), we used previously described methods [
32‐
34], with the use of a specific anti-p-p38 antibody (#4631) (1:100 dilution, Cell Signaling Company, Danvers, MA, USA). The assessed standards for staining results were also the same as our previously described for p-Akt2 [
33]. Statistical significance was analyzed by the Wilcoxon signed-rank test, Chi-square test, and the Fisher’s exact test. To assess the level of IL-1β, MMP-2 and 9, and c-fos in the tissues mention-above by IHC, we also used the same previous method [
32,
33]. Anti-MMP-2 (ab110186) and MMP9 (ab38898), and c-fos (ab53036) antibodies used for IHC were 1:250, 1:200 and 1:200 dilution, respectively, and they were from Abcam (Cambridge, MA, USA); Anti-IL-1β antibody was from Santa Cruz (sc-7884) (Santa Cruz, CA, USA) and was diluted 1:100 before use. Spearman’s method was used to analyze the correlation in expression levels of p-p38 with IL-1β, MMP-2 and 9, and c-fos in GA tissue.
Cell culture and transfection with siRNA
Cell culture and transfection with siRNA were performed in accord with the methods described by us previously [
33]. AGS or MKN-45 cells (AGS, American Type Culture Collection, Manassas, VA; MKN-45, Health Service Research Resources Bank, Ibaraki-shi, Osaka, Japan) were grown in F12 or DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) at 37°C in an incubator containing 5% CO
2. SiRNA against p38 (Cell Signaling), siRNA against JNK (Cell Signaling) or control siRNA (scrambled siRNA) (used as nonsilencing control) (Cell Signaling) and siRNA against MMP-2 or MMP-9 with the targeted position 498 and 2243 of human MMP-2, and targeted position 372 and 1312 of human MMP-9 which were exact the same as the introduction by Luo Y’s [
19] (Synthesized in GenePharma Company, Shanghai, China) were transfected into cells, respectively with Lipofectamine 2000 according to the manufacturer’s instructions.
Western blotting for p38, p-p38, JNK and p-JNK
Western blotting for the expression of p38, p-p38, JNK and p-JNK in AGS or MKN-45 cells was conducted using previously described methods [
32,
33]. The dilution of primary antibodies used was as followings: rabbit anti-human p38, p-p38, JNK or p-JNK (1:1,000 dilution, Cell Signaling). Anti-β-actin (1:6,000 dilution, Sigma Company) was used as a control for the Western blots.
Cell migration and invasion assay
For the invasion assay of AGS or MKN-45 cells, we used Sumida T’s and our previous methods [
35,
36]. Millicell Hanging Cell Invasion Chambers with 8-μm pore filter (Millipore Corporation) were coated with 12 μL of ice-cold Matrigel (Becton Dickinson Labware, Bedford, MA). AGS or MKN-45 cells (5 × 10
4 per well) were added to the upper chamber of these matrigel chambers in 200 μl serum-free F12 or DMEM medium with or without 20 ng/ml human IL-1β (R & D Systems). Cells were then placed into 24-well plates in F12 or DMEM medium containing 10% FBS. To evaluate the role of the SB202190 or SP600125 or BiPS inhibitor, cells were pre-treated with the reagent for 3 h, and the stimulations were then performed. To evaluate the role of p38 siRNA or JNK siRNA or MMP2 siRNA or MMP9 siRNA or MMP2 siRNA plus MMP9 siRNA in cell migration and invasion, AGS or MKN-45 cells were transfected with scrambled siRNA or p38 siRNA or JNK siRNA or MMP2 siRNA or MMP9 siRNA or MMP2 siRNA plus MMP9 siRNA for 36 h. Following this, the transfected cells were seeded at a density of 5 × 10
4 per well and then in 200 μl of serum-free medium for the stimulation. When the 20 h incubation was completed, cells were fixed with methanol and stained with Giemsa or crystal violet. Cotton tips were used to remove the cells that remained in the matrigel or attached to the upper side of the filter. Light microscopy was used to count the cells on the lower side of the filter. The assays were performed in duplicate, and the results were then averaged.
The methods used for the migration assay were almost the same as for the invasion assay described above, except no matrigel was used to coat the well and the incubation time was 15 h.
RT-PCR assay
RT-PCR for amplification of human MMP2, MMP9, c-fos, p38 used the methods described by us previously [
36]. Total RNA was extracted from AGS or MKN-45 cells or mouse lung metastatic human gastric cancer cell MKN-45 with the Trizol reagent (Invitrogen). The expression levels of human MMP2, MMP9, c-fos, p38 and GAPDH mRNA were detected by first reverse-transcribing the total RNA, followed by PCR with the following primers: forward: 5′ CCTGATGTCCAGCGAGTG 3′, reverse: 5′ AGCAGCCTAGCCAGTCG 3′ for MMP-2 (295 bp); forward, 5′- CAGTCCACCCTTGTGCTCTTC-3′, reverse, 5′- TGCCACCCGAGTGTAACCAT -3′ for MMP-9 (102 bp); forward: 5′ GTCTCCAGTGCCAACTTCAT 3′, reverse: 5′ CATCTTATTCCTTTCCCTTCG3′ for c-fos (285 bp); forward: 5′ TCCCGTTTGCTGGCTCTT 3′ , reverse: 5′ GGGCACCTCCCAGATTGT 3′ for p38 (442 bp); The expression levels of GAPDH mRNA in each sample were used as controls, and primers used for amplification of GAPDH mRNA were as follows: forward, 5′-GAGTCAACGGATTTGGTCGT-3′, reverse, 5′-TTGATTTTGGAGGGATCTCG-3′ (254 bp).
MMP-2 and 9 zymography assay
MMP-2 and 9 zymography assay— MMP-2 and 9 protease activities in the concentrated supernatant medium of AGS or MKN-45 cells were detected by zymography. Briefly, 8% SDS-PAGE containing gelatin zymogram gels (Applygen Technologies Inc, Beijing, China.) were used to separate the proteins with electrophoresis. Renaturing and developing the gels were performed according to the manufacturer’s instructions, and the gels were then stained with Coomassie blue.
Immunocytochemical staining and confocal microscopy assay
The relationship between the expression of p-p38, MMP2, and MMP9 in response to IL-1β were detected by immunocytochemical staining and confocal microscopy used the methods described by us [
33] instead using anti-p-p38 (Cell signaling), and MMP2 or MMP9 antibody (Abcam).
AP-1 luciferase reporter gene assay
AP-1 luciferase reporter gene assay were performed. Cells were transfected with AP-1 luc vector (1 μg) or AP-1 plus scramble siRNA or p38 siRNA or JNK siRNA with Lipofectamine2000. B-gal plasmid (containing–galactosidase reporter gene) was co-transfected with AP-1 reporter plasmids to serve as the control for transfection efficiency. Thirty-six hours after transfection, the cells were left untreated or were treated with 20 ng/ml of IL-1β for 12 h. The luciferase assay (for AP-1) and enzyme assay (for B-gal) were then performed according to the instructions of the Promega kit (Madison, WI, USA).
MMP9-promoter luciferase assays were performed as the same methods mentioned-above for AP-1. Cells were transfected by various human MMP9 promoter-luciferase vectors (1 μg) constructed by Genomeditech.com, Shanghai, China, or co-tranfected with scramble siRNA or p38 siRNA with Lipofectamine2000. B-gal plasmid was co-transfected with MMP9 promoter-luciferase plasmids to serve as the control for transfection efficiency. Thirty-six hours after transfection, the cells were left untreated or were treated with 20 ng/ml of IL-1β for 12 h. Luciferase activities were determined using the luciferase assay kit (Promega, Madison, WI) in accordance with the manufacturer’s instruction.
Invasion assay in nude mice
For the in vivo invasion assay, we followed the protocols described by Yan et al. with minor modifications [
37]. Three groups were established; each group contained six mice. Briefly, 2 × 10
6 MKN-45 cells were injected into the tail vein of 6-week-old male BALB/c nude mice (nu/nu). Group 1 and 2 were injected with MKN-45 cells that had been transfected with a scrambled siRNA; Group 3 was injected with MKN-45 cells that had been transfected with p38 siRNA; group 1 did not receive IL-1β treatment, and group 2 and 3 were treated with IL-1β. The mice were intraperitoneally injected with IL-1β at a concentration of 20 μg/kg/day in 200 μl of PBS for 14 days (one injection every two days), beginning on the day of injection of the MKN-45 cells; the control animals (group 1) were injected with 200 μl of PBS. The mice were euthanized 45 days post-injection of the cells, and the lungs were excised, and subjected to histological analysis under a light microscope after HE staining to determine the extent of metastasis. The total number of metastases per lung was determined by counting the number of metastatic lesions in 6 of lung sections. The methods used for selection of sections and counting the metastases were based on the descriptions by Yan et al [
37]. RT-PCR and immunohistochemical analysis of p38 or p-p38, MMP2, MMP9, and c-fos were performed as described above.
Statistical analysis
Statistical analysis was performed using methods previously described by our laboratory [
33,
36]. The IHC results were evaluated using the Wilcoxon signed-ranks test, Chi-square test, and the Fisher’s exact test. Spearman’s correlation was used to analyze the relationship between the expression levels of p-p38 and IL-1β, MMP2, MMP9 or c-fos in the GA tissue samples. For the other experiments, all values are expressed as the mean ± SD, and the independent samples
t-test was performed to determine the significance of the differences between groups.
P-values < 0.05 were considered statistically significant.
Acknowledgements
This work was supported by the National Natural Science Foundation of China (Grant No. 81372788), the Medical Scientific Research Key Foundation of Nanjing Command (No.11Z032), the Army Clinical High and New Technology Major Project (No. 2010 gxjs026), Fujian Provincial Major Project (No. 2012 YZ 0001), Fujian Provincial Major Project (No. 2011 Y0042) and the Medical Scientific Research Foundation of Nanjing Command (No.11MA107).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
QH performed the major experiments, data analysis and wrote the manuscript. FL participated in the design of some of the studies and guided some experiments. XW, JH, YL, YX, XY, HW and LD performed some of the experiments. YY, FX and WL carried out immunohistochemical samples collecting and the results analysis. OX provided clinical data. FZ participated in some experiment design and data analysis. LW and JT contributed to design the study, interpret the data, and funding support. All authors read and approved the final manuscript.