Skip to main content
Erschienen in: Journal of Translational Medicine 1/2016

Open Access 01.12.2016 | Research

Immune response and innervation signatures in aseptic hip implant loosening

verfasst von: Daniel M. Vasconcelos, Manuel Ribeiro-da-Silva, António Mateus, Cecília Juliana Alves, Gil Costa Machado, Joana Machado-Santos, Diogo Paramos-de-Carvalho, Inês S. Alencastre, Rui Henrique, Gilberto Costa, Mário A. Barbosa, Meriem Lamghari

Erschienen in: Journal of Translational Medicine | Ausgabe 1/2016

Abstract

Background

Aseptic loosening (AL) of hip prosthesis presents inflammation and pain as sign and symptom similarly to arthritis pathologies. Still, the immune and innervation profiles in hip AL remain unclear and their interplay is poorly explored. Herein, local tissue inflammatory response, sensory and sympathetic innervation as well as associated local mediators were assessed in hip joint microenvironment underlying AL and compared to osteoarthritis (OA).

Methods

Histopathological analysis, immune cells (macrophages, T, B cells and PMNs) as well as sensory and sympathetic nerve fibers (SP+, CGRP+, TH+) distribution and profiles were analyzed on tissues retrieved from patients with failed hip prostheses due to AL (n = 20) and hip OA (n = 15) by immunohistochemistry. Additionally, transcriptional levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, IL-12a, iNOS), anti-inflammatory cytokine (IL-10), osteoclastic factor (RANKL) and bone remodeling factor (TGF-β1) were locally evaluated by qRT-PCR. Serum TGF-β1 levels were assessed preoperatively by ELISA.

Results

Histopathological analysis revealed that tissues, aseptic interface membranes of AL patients had distinct tissue architecture and immune cells profile when compared to OA synovial tissues. Macrophages, T cells and B cells showed significant differences in tissue distribution. In OA, inflammation is mostly confined to the vicinity of synovial membrane while in AL macrophages infiltrated throughout the tissue. This differential immune profile is also accompanied with a distinct pattern of sensory and sympathetic innervation. Importantly, in AL patients, a lack of sympathetic innervation aseptic interface membranes without compensation mechanisms at cellular levels was observed with simultaneous reorganization of sensorial innervation. Despite the different histopathological portrait, AL and OA patients exhibited similar transcriptional levels of genes encoding key proteins in local immune response. Nevertheless, in both pathologies, TGF-β1 expression was prominent in sites where the inflammation is occurring. However, at systemic level no differences were found.

Conclusion

These findings indicate that AL patients exhibit different local inflammatory response and innervation signatures from OA patients in hip joint. These insights shed the light on neuro-immune interplay in AL and highlight the need to better understand this crosstalk to unravel potential mechanisms for targeted-therapies to improve hip joint lifetime and treatment.

Background

Osteoarthritis (OA) has long been considered a cartilage driven “wear and tear” disease that may lead to hip joint failure [1, 2]. The pain and diminished hip joint motion induced by OA may be effectively treated through primary hip replacement [3, 4]. Unfortunately, hip replacement is not a permanent solution as prostheses often fail 15–25 years after primary surgery, mostly due to aseptic loosening (AL), infection and dislocation [5, 6]. Other therapeutic solutions are then urgently required to expand implants’ lifetime.
Inflammation is common to AL and OA [1, 7, 8]. Immune cells and cytokines have been previously reported in both clinical scenarios [811]. Synovial inflammation is often observed in OA patients and is frequently characterized by the infiltration of specific immune cell populations, such as macrophages, T cells and mast cells, as well as by the expression of pro-inflammatory cytokines, as Tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) [7]. Nevertheless, these findings were mostly described in studies focusing on the knee or in studies combining data from both knee and hip, without anatomical discrimination [7]. On the other hand, periprosthetic joint inflammation is commonly known as a complex local biological response that takes place on synovial membrane-like interface tissues, triggered by implant released by-products (particles and ions) [1215]. Of note, the nature, size and amount of released particles are recognized to define the inflammatory profile [1316]. While polymeric particles such as polyethylene (PE) and polymethylmethacrylate (PMMA) are often associated with macrophage mediated foreign body reaction and tissue fibrosis, high levels of metallic particles and ions have been demonstrated to promote tissue necrosis and lymphocyte-driven responses [17].
Pain is one of the clinical features observed in both AL and OA conditions [18, 19]. Innervation profile is mostly studied in the context of arthritic diseases but not in the presence of implantable biomaterials. Patients and animal studies highlighted innervation of synovial tissues as a possible player in the pain process and, based on anatomical mapping, suggested a coupling of innervation and inflammation in osteoarthritic synovial tissues [20, 21]. It is well documented that both sympathetic, tyrosine-hydroxylase (TH)+ or neuropeptide Y (NPY)+, and sensory nerve fibers, substance P (SP)+ and calcitonin gene related peptide (CGRP)+, are present in OA synovial tissue and grow towards cartilage along blood vessels [21]. On the other hand, so far, two studies addressed the innervation of the interface membranes surrounding AL hip prostheses [19, 22]. Unfortunately, the data is still unclear. Niissalo et al. reported that the synovial membrane-like interface did not contain C-sensory peptidergic or sympathetic neural structures while Ahmed et al. identified sympathetic nerve fibers in these interface membranes [19, 22]. Thus, innervation profile and its possible association with periprosthetic joint inflammation, triggered by prosthetic debris in AL scenario, should be revised. Furthermore, the comparison of the inflammatory versus innervation profiles of AL and OA has never been examined and requires further investigation. In this study, the immune and innervation profiles of AL and OA were addressed dissecting local players at tissue, cellular and molecular levels with potential systemic translation.

Methods

Patients and samples

Centro Hospitalar São João ethics committee approved this study and all patients consented to the use of their tissue and blood for research purposes. The followed procedures were in accordance with the Helsinki Declaration of 1975, as revised in 2000. Samples from synovial membrane-like interface tissue/aseptic interface membrane were collected from twenty patients during hip revision surgeries due to AL of hip prostheses. All revised hips had a metal-on-polyethylene (MoP) coupling, eleven out twenty cemented and bone defects were classified according to the Paprosky classification [23]. Relevant clinical information is summarized in Table 1. Infection, recurrent dislocation and periprosthetic fracture were considered exclusion criteria in the aseptic loosening group. Osteoarthritic synovial tissues were collected from 15 patients undergoing primary hip replacement surgeries for primary OA. OA patients were classified for OA severity according Tönnis OA grade [24] and presented scores from moderate (2) to severe (3). The clinical information of these patients is summarized in Table 2. For both OA and AL groups, the same orthopedic team performed the collection of tissue samples. Previously to surgery, blood was collected and leukograms and plain radiographies were registered.
Table 1
Clinical data from aseptic loosening patients
Aseptic loosening case number
Age
Gender
Hip prostheses type
Implant fixation
Time to revision (months)
Component revised
Type of bone defect
Metallosis
1
79
M
MoP
Cemented
13
Acetabular
2B
 
2
61
F
MoP
Cemented
24
Acetabular
2A
 
3
74
F
MoP
Cemented
23
Acetabular
2B
 
4
86
F
MoP
Cemented
46
Acetabular
2B
 
5
50
F
MoP
Uncemented
56
Acetabular femoral
3A1
Yes
6
79
F
MoP
Cemented
96
Acetabular
3A
 
7
73
M
MoP
Cemented
108
Acetabular
3A
 
8
69
F
MoP
Cemented
117
Acetabular
2C
 
9
74
M
MoP
Cemented
120
Acetabular femural
2A1
 
10
77
M
MoP
Uncemented
120
Acetabular femoral
2B1
 
11
45
F
MoP
Uncemented
129
Acetabular
3A
 
12
73
F
MoP
Uncemented
130
Acetabular
1
Yes
13
63
F
MoP
Cemented
138
Acetabular
3A
 
14
75
M
MoP
Cemented
144
Acetabular
3A
 
15
62
F
MoP
Uncemented
153
Acetabular
2C
 
16
53
F
MoP
Uncemented
156
Acetabular
2A
 
17
86
F
MoP
Cemented
168
Acetabular femoral
2A1
 
18
71
F
MoP
Uncemented
204
Acetabular
1
 
19
82
F
MoP
Uncemented
216
Acetabular
1
Yes
20
75
M
MoP
Uncemented
240
Acetabular
1
Yes
Table 2
Clinical data from osteoarthritis patients
Osteoarthritis
case number
Age
Gender
OA severity (tonnis
classification)
1
79
F
2
2
45
F
3
3
54
F
3
4
80
F
3
5
55
M
3
6
49
F
2
7
76
M
3
8
51
F
2
9
56
F
3
10
71
M
3
11
74
F
3
12
83
M
3
13
37
F
3
14
74
M
3
15
66
M
2
Immediately after excision, both OA synovial tissues and aseptic interface tissues were split. Half of the tissue was immersed in formalin for further histological analysis, while dry ice was used to freeze the remaining tissue until storage at −80 °C. No more than 4 h elapsed between tissue collection and storage.

Histochemistry and immunostaining

Half of collected tissues were formaldehyde-fixed paraffin embedded and cross-sections of 3 μm thickness were cut. Contiguous sections were stained with hematoxylin & eosin (H&E) and Masson’s trichrome (MT). For immunohistochemistry, tissue sections were deparaffinized and rehydrated before heat induced antigen retrieval (98 °C, 10 mM citrate buffer, pH 6.0). Endogenous peroxidases were blocked using 3 % H2O2 and non-specific binding sites were blocked using Background Block (Cell Marque, USA), previously to the incubation with antibody diluent 1 % BSA (negative control) or with primary antibodies: anti-CD20 (clone L26, dilution 1:100, Cell Marque, USA), anti-CD163 (clone MRQ-26, dilution 1:150, Cell Marque, USA), anti-CD68 (clone 514H12, dilution 1:100, Novocastra, UK), anti-HLA-DR (clone TAL1B5, dilution 1:5000, Abcam, USA) and anti-CD3 (clone PS1, dilution 1:100, Biocare Medical, USA). After primary antibody incubation, tissue sections were incubated with BrightVision Poly-HRP-Anti Mouse/Rabbit/Rat IgG (Immunologic, the Netherlands) and then revealed using DAB Plus Substrate System (Thermo Scientific, USA), before hematoxylin counterstaining. The specificity of immunostainings of CD20, CD163, CD68, HLA-DR and CD3 was confirmed using human spleen as positive control. For immunofluorescence studies, tissue section were deparaffinized and antigen retrieval of rehydrated sections was performed using Proteinase K (0.2 mg/mL in PBS) for NF200 immunostaining and incubated for 20 min at 98 °C in Citrate buffer (pH 6.0), or TE Buffer (pH 9.0) for SP and CGRP staining, respectively. After quenching endogenous fluorescence with 0.1 % sodium borohydride and 100 mM NH4Cl, sections were incubated with blocking buffer (10 % FBS, 1 % BSA, 0.2 % Triton X-100). Primary antibody rabbit anti-human neurofilament heavy subunit (NF200) (dilution 1:1000, Abcam, USA), anti-Substance P (dilution 1: 1000, Millipore, USA), anti-TH (dilution 1:100, Millipore, USA), anti-CGRP (dilution 1:4000, Sigma-Aldrich, USA) or blocking buffer (negative control) was applied overnight at 4 °C. For signal detection, tissue sections were incubated with anti-rabbit Alexa Fluor 568 antibody (dilution 1:1000, Life Technologies, USA), incubated with DAPI and then mounted with Fluoroshield Mounting Medium (Abcam, USA). The specificity of immunostainings for NF200, Substance P, TH and CGRP was confirmed using a specimen of human Morton’s neuroma as positive control.

Semi-quantitative histopathological evaluation

In order to characterize synovial microenvironment, tissues were semi-quantified considering the total immunoreactive area and scored into four categories: absent (0), present (1), frequent (2) or abundant (3), according to the histological grading system illustrated in the Additional file 1: Figure S1 (tissue reaction), Additional file 2: Figure S2 (prosthetic debris accumulation) and Additional file 3: Figure S3 (immune cells distribution), similarly to the methodology followed by others [25, 26].
Structural changes, fibrosis and necrosis in OA synovial tissues and aseptic interface tissues were evaluated after H&E and MT staining. The thickening/hyperplasia and increased villi of synovial membrane were assessed in OA patients. The accumulation of polymeric, ceramic and metallic particles was assessed in synovial membrane-like interface tissues. A polarized filter was used to detect polymeric particles. Ceramic and metallic particles were studied through scanning electron microscopy (SEM) and their elemental composition assessed by energy dispersive spectroscopy (EDS). Additionally, a phase contrast filter (Ph3) was used with an optical microscope to ease the detection of clusters of ceramic or metallic particles in histological slices, allowing a deep study of the interaction between particles and cells. The infiltration of target immune cell populations, identified by immunohistochemistry, was determined regarding the presence of macrophages (CD68+ cells), T cells (CD3+ cells) and B cells (CD20+ cells). The semi-quantification of polymorphonucleated cells (PMNs) was performed after PMNs identification as these cells have a lobed nucleus while multinucleated giant cells (GC) were detected due to their bigger size, multiples nucleus and CD68+ labeling.
Tissue samples retrieved from five out thirty-five patients (4/15 OA and 1/20 AL) were excluded from histopathological evaluation because they do not correspond to OA synovial tissue or aseptic interface tissue. H&E, MT and immunohistochemistry slices were analyzed using a light microscope Olympus CX31 while immunofluorescence, polarized light and phase contrast Ph3 images were captured on Carls Zeiss Axiovert 200 inverted microscope.

Gene expression analysis

Synovial tissues were homogenized in liquid nitrogen using a mortar and pestle to preserve RNA integrity. RNA was extracted and purified using TRIzol (Invitrogen, UK) and Direct-zol™ RNA MiniPrep (ZYMO Research, USA), according to the manufacturers’ instructions. The amount and quality of extracted RNA were evaluated by Nanodrop ND-1000 (Thermo Fisher Scientific, USA) and running RNA samples in a 2 % agarose gel. The transcriptional levels of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, IL-12a and iNOS), anti-inflammatory cytokine (IL-10), osteoclastic factor (RANKL) and bone remodeling factor (TGF-β1) were evaluated by quantitative real time PCR (qRT-PCR) in PCR iQ™5 system (Bio-rad, USA). All used primers, listed in Table 3, were optimized and melting curves of PCR products were evaluated to guarantee primers specificity. β2 microglobulin (B2 M) and β-actin were used as reference genes. Experiments were performed in triplicated. Relative gene expression levels were calculated using the quantification cycle (Cq) method, according to MIQE guidelines [27]. Fourteen out thirty-six cases (5/15 OA and 9/20 aseptic loosening) were excluded from gene expression analysis when average Cq for reference genes was above 26, to avoid bias in the evaluation of genes with later expression.
Table 3
List of primers used for quantitative qRT-PCR analysis
Gene
GenBank number
Forward primer sequence (5′–3′)
Reverse primer sequence (5′–3′)
B2M
[NM_004048]
CCAGCGTACTCCAAAGATTCAG
AGTCAACTTCAATGTCGGATGG
β-actin
[NM_001101]
TACCTCATGAAGATCCTCA
TTCGTGGATGCCACAGGAC
IL-1β
[NM_000576]
CTTCAGCCAATCTTCATT
CACTGTAATAAGCCATCAT
IL-6
[NM_000600]
CAATCTGGATTCAATGAGGAGACT
CTGTTCTGGAGGTACTCTAGGTAT
IL-10
[NM_000572]
GGAGAACCTGAAGACCCTCA
TATAGAGTCGCCACCCTGAT
IL-12a
[NM_000882]
TACCAGGTGGAGTTCAAG
GTTCTTCAAGGGAGGATTT
iNOS
[NM_000625]
AATTGAATGAGGAGCAGGTC
TCCTTCTTCGCCTCGTAA
TNF-α
[NM_000594]
TCTCTCTAATCAGCCCTCTG
TGCTACAACATGGGCTACAG
RANKL
[NM_003701]
GGATGGCTCATGGTTAGA
CAAGAGGACAGACTCACTT
TGF-β1
[NM_000660]
CCTGGACACCAACTATTG
CTTGCGGAAGTCAATGTA

ELISA

Serum transforming growth factor β1 (TGF-β1) concentrations were measured using Quantikine® ELISA Kit for human TGF-β1 (R&D Systems, USA), according to the manufacturer’s protocol. Cytokine concentration was calculated against a standard curve.

Statistical analysis

Statistical analysis was performed using SPSS 21.0 (SPSS Inc. Chicago, IL, USA). The level of significance was set at p < 0.05 (*). Visual histogram analysis and Kolmogorov–Smirnov test were used to evaluate the normal distribution of continuous variables (gene expression data, TGF-β1 plasma concentration and percentage of immune cells in blood). Accordingly, these variables were analyzed using Student’s t test or its non-parametric counterpart, Mann–Whitney test. Tissue immune response and innervation was histologically classified in different grading categories and comparisons between aseptic interface tissues and OA synovial were done using Chi square test. All graphs were prepared using Prism software (GraphPad software, San Diego, CA, USA).

Results

Local immune responses in OA synovial tissues and synovial membrane-like interface tissue

In this study, 15 patients underwent primary hip replacement due to OA (Fig. 1a) and twenty hip implants were revised and their acetabular defects classified by X-ray imaging (Fig. 1b). Macroscopically, the collected synovial tissues at primary and revision surgeries were morphologically distinct. Synovial surface was white and with diffuse papillary architecture (dashed black line, Fig. 1c, d) whereas synovial membrane-like interface tissues were highly fibrotic (Fig. 1e) or with greyish appearance (Fig. 1f), in case of metallosis.
Semi-quantitative analysis of tissue organization and immune cell distribution in OA synovial tissue and aseptic interface tissues showed distinct local profiles. OA synovial membranes displayed a bicellular lining layer (LL) and a sublining layer (SLL) (Fig. 2a) enriched in blood vessels (black arrows) and collagen (Fig. 2b), as well as structural changes induced by synovial inflammation, such as synovial hyperplasia (Fig. 2c, d) and increased number of villi (Fig. 2e, f). OA patients presented at least one sign of synovial inflammation (thickening or villi) but their magnitude was variable among patients (Fig. 2c, e). Synovial membrane-like interface tissues presented fibrotic stroma with increased collagen deposition (Fig. 2g, h) than OA synovial tissues (p = 0.001) and with some necrotic regions (Fig. 2i).
The accumulation of prosthetic debris in synovial membrane-like interface tissues was semi-quantified. Polymeric particles were just detected in 11/20 analyzed aseptic interface tissues (Fig. 3a) after tissue analysis under polarized light (Fig. 3b, c). No significant difference was found between AL patients with cemented and uncemented MoP bearings regarding the amount of polymeric particles entrapped in synovial membrane-like tissues. Zirconia particles (ZrO2) were observed in almost all synovial membrane-like interface tissues retrieved from patients with loose cemented prostheses (Fig. 3d–f) and mainly phagocytized by macrophages or multinucleated giant cells (Fig. 3g). Ph3 contrast filter eased the detection of ZrO2 particles (Fig. 3e, f). White color particles under Ph3 filter were confirmed to be ZrO2 and to be organized in clusters of nanoparticles by SEM/EDS (Fig. 3h, i). Intense deposition of metallic particles was just found in the four cases of metallosis that were patients with uncemented metal-back acetabular cups (Fig. 3j). Aseptic interface membranes with metallosis presented high deposition of metallic particles with concomitant macrophage infiltration (Fig. 3k), tissue fibrosis (Fig. 3l) and necrosis (Fig. 3m). Under Ph3 filter, metallic nanoparticles and haemoglobin presented violet and red color respectively, which allow distinguishing them from ZrO2 particles (Fig. 3n, o).
Immune cell distribution was studied in tissues from AL and OA patients. In AL, macrophages (CD68+ cells) were more abundant than in OA (p = 0.007; Fig. 4a). While macrophages were often confined to lining layer in OA patients (Fig. 4b), signifficant macrophage infiltration was found in synovial membrane-like interface tissues (Fig. 4c). In these tissues, co-localization between polymeric particles and macrophages was often found (Fig. 4d) and a similar pattern was observed in AL patients with cemented and uncemented MoP bearings. In AL patients, macrophages were the most prevalent immune cell population, even in metallosis cases, and in overall highly express M1 (HLA-DR; Fig. 3e) and M2 (CD163; Fig. 3f) markers. Multinucleated giant cells in foreign body reaction setting were mostly found in synovial membrane-like interface tissues (p = 0.037, Fig. 4g) surrounding big polymeric particles, likely PMMA, with ZrO2 particles entrapped inside (Fig. 4h). T cells (CD3+ cells) (Fig. 4j), and B cells (CD20+ cells; Fig. 4l) in lower number, could be detected in the majority of tissues collected from AL and OA patients (Fig. 4i, k), including AL patients with uncemented implants or signs of metallosis. Moreover, the number of PMNs was also low in both aseptic interface membranes and OA synovial tissues. Overall, the immune cell populations addressed, namely macrophages, T cells, B cells and PMNs, in this study were most located in the vicinity of synovial membrane in OA patients, while in AL patients these cells were identified throughout the aseptic interface membranes.

Local innervation in AL and OA patients

Myelinated nerve fibers identified by NF200 immunoreactivity were detected in both synovial membrane-like interface tissues and OA synovial tissues. They were presented as single fibers (Fig. 5a, c) and were preferentially arranged around blood vessels (Fig. 5c) particularly in tissue regions of reactive vascularization induced by immune responses underlying AL and OA. Alternatively, nerve fibers were also found in neurome-like structures (Fig. 5b, d) in both AL and OA patients. Sensory and sympathetic innervation, as seen by immunohistochemical markers of sensory nerve-associated peptides (SP and CGRP) and catecholaminergic marker of sympathetic neurons (TH), showed different pattern between OA patients and AL patients. TH immunoreactive nerve fibers were observed in OA synovial tissues (Fig. 5f) but not in synovial membrane-like interface tissues (Fig. 5g, h). SP and CGRP were found both in OA synovial tissues and synovial membrane-like interface tissues but showed different pattern. In OA synovial tissues, nerve fibers immunoreactive to SP and SGRP were observed mainly around blood vessels in the vicinity of synovial membrane (Fig. 5j, n). In addition, a high number of cells in the OA synovial membrane also stained for TH, SP and CGRP (Fig. 5e, i, m). In synovial membrane-like interface tissues, the expression of SP and CGRP was also found in both nerve fibers and cells but with a broad distribution throughout the tissue (Fig. 5k, l, o, p).

Local gene expression profile

The expression levels of pro-inflammatory cytokines tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and IL-6 were similar in aseptic interface tissues and OA synovial tissues (Fig. 6a–c). Inducible nitric oxide synthase (iNOS) and IL-12a expression levels were found to be low when compared with the TNF-α, IL-1β and IL-6 mRNA levels detected in AL and OA groups (Fig. 6d, e). Interestingly, the anti-inflammatory cytokine IL-10 presented a tendency (p = 0.084) to be higher expressed in synovial membrane-like tissues than in OA synovial tissues (Fig. 6f). Two genes involved in bone remodeling were evaluated: TGF-β1 and receptor activator of nuclear factor kappa-B ligand (RANKL). The mRNA levels of TGF-β1 were significantly reduced (p = 0.038) in aseptic interface tissues when compared to OA synovial tissues (Fig. 6g). However, no differences between AL and OA patients were verified for RANKL (Fig. 6h) and no correlation was found between mRNA levels of RANKL and the bone defect type.

Local TGF-β1 expression

In both AL and OA patients, TGF-β1 was detected in blood vessels endothelium cells (Fig. 7a), macrophages (Fig. 7b) and fibroblasts (Fig. 7c). Interestingly, differences in the pattern of TGF-β1 expression were found between AL patients and OA. Aseptic interface tissues presented a trend (p = 0.1672) toward increased number of regions expressing TGF-β1 (Fig. 7d). In OA synovial tissues, TGF-β1 was present in the sublining layer of synovial membrane (Fig. 7e), in aggregates of lymphocytes (Fig. 7F) and blood vessels. In synovial membrane-like interface tissues, the distribution of TGF-β1-positive regions was heterogeneous (Fig. 7g, h).

Immune cells proportions and TGF-β1 concentration in blood

The preoperative leukograms were analyzed and the concentration of TGF-β1 determined in plasma of both AL and OA patients. The percentage of circulating monocytes in both groups tended to be similar (Fig. 8a). Interestingly, the percentage of lymphocytes seemed to be low in AL patients but within the reference interval in OA group (Fig. 8b). Neutrophils did not present significant alterations compared with the reference values (Fig. 8c). Remarkably, the levels of TGF-β1 in serum were similar in both groups (Fig. 8d).

Discussion

AL and OA differences rely on tissue architecture, immune cell distribution, local TGF-β1 expression as well as sensory and sympathetic synovial innervation. On the other hand, both pathologies share identical inflammatory mediators mRNA profiles and similar TGF-β1 concentrations in serum, as summarized in Fig. 9.
Synovial membrane-like interface tissues, present in the vicinity of loose prostheses, showed a macrophage-driven chronic inflammation. This immune response is likely influenced by both OA inflammatory background and the presence of prosthetic debris, leading to significant changes of local TGF-β1 expression but not systemically.
Distinct tissue organization and immune cell distribution were found in the tissues retrieved from the hip joint of AL and OA patients. OA synovial tissues presented signs of synovial inflammation (synovitis), such as synovial hyperplasia and villous hypertrophy, while aseptic interface membranes, formed after primary hip replacement, exhibited a particle-driven chronic inflammation. Intense infiltration of macrophages (CD68+ cells) was observed in AL patients in comparison to OA synovial tissues. In synovial membrane-like interface tissues retrieved from AL patients, macrophages were the predominant immune cell type and were involved in the phagocytosis of small particles (<10 μm) or encapsulating bigger polymeric particles as multinucleated giant cells, in line with previous works about the role of macrophages on AL [28]. Although PE particles, released by MoP prostheses, have been pointed out as AL catalyzers [29, 30], other types of particles may play a role on the pro-inflammatory microenvironment underlying osteolysis. Large amounts of metallic particles were observed in four out nine AL patients due to impingement of metallic components of uncemented MoP bearings.
Ceramic ZrO2 particles, incorporated in bone cements for implants fixation as radiopacifier agent, were found in synovial membrane-like interface tissues from all the patients with cemented prostheses. Light microscopy with Ph3 contrast filter and SEM/EDS analysis revealed that ZrO2 gradually migrate from cement particles (PMMA) to other regions of aseptic interface tissues in high number, namely after being phagocytized by macrophages. ZrO2 particles were shown to be moderately toxic, activate macrophages, promote the expression of pro-inflammatory cytokines (TNF-α) and induce osteolysis in vivo [31, 32]. Despite reported not toxic as metallic particles or studied as polymeric debris [12, 33, 34], ZrO2 particles should not be neglected, as they are numerous, common and nano-sized with potential to unbalance inflammation towards osteolysis. It has been reported that particle-induced response is prone to drive macrophages towards M1 phenotype and that M1:M2 ratio was higher in synovial membrane-like interface tissue than in OA synovial tissues [35, 36]. However, macrophage polarization in joint tissues remains controversial. In this study, the density of polymeric, metallic or ZrO2 particles on aseptic interface tissues did not lead to local preferential macrophage polarization in M1 pro-inflammatory (HLA-DR+) or M2 pro-regenerative phenotypes (CD163+) as both receptors were similarly expressed on macrophages. In addition to the involvement of macrophages and lymphocytes in local inflammatory response, preoperative leukograms suggested monocyte expansion and contraction of lymphoid population in AL group.
Cytokines expression profile was found similar in synovial membrane-like interface tissues and OA synovial tissues, despite their distinct tissue architecture and immune cell distribution. The response of macrophages to prosthetic debris is believed to induce the production of the pro-inflammatory markers such as TNF-α, IL-1β, IL-6, IL-12a, and iNOS [28, 34, 37]. However those genes revealed similar mRNA levels in AL and OA patients, which is in line with comparable studies [26, 30, 38]. The changes in cytokine expression induced by AL seem to be controversial [25]. Reduced mRNA levels of IL-6 have also been described in aseptic interface membranes [26] while IL-6 was found significantly increase in synovial fluid of AL patients [25, 30]. A trend for higher mRNA levels of the anti-inflammatory cytokine IL-10 was observed in synovial membrane-like interface tissues in comparison to OA synovial tissues (p = 0.084). This result corroborates with other findings showing significant increase of IL10 protein levels in synovial fluid and interface tissues of AL patients [25, 26, 30]. The up-regulation of IL-10 in aseptic interface tissues may constitute an attempt to balance the pro-inflammatory microenvironment induced by prosthetic debris [39, 40].
Although RANKL is involved in osteoclastogenesis and osteolysis, similar mRNA levels were found in AL and OA patients, in agreement with other authors [26, 30, 38, 41]. In overall, identical pattern regarding the expression of cytokines was found in AL and OA patients. In the context of AL, no significant differences were registered between polyethylene-drive and metallosis cases as previously shown [42]. The expression of TGF-β1 mRNA in synovial membrane-like interface tissues was found significantly lower than in OA synovial tissues but local TGF-β1 immunostaining suggested increased expression of this protein in AL patients in comparison to OA patients. These findings corroborate the results presented by other authors that have also found increased TGF-β1 mRNA levels in OA cartilage [9, 43, 44] and augmented TGF-β1 expression in synovial membrane-like interface tissues [45]. In both AL and OA, TGF-β1+ labeling was prominent in sites where the inflammation is occurring and mostly expressed in macrophages, fibroblasts and endothelium cells. However, while in OA the TGF-β1+ cells were found in the region of synovial membrane, in AL, the distribution was more heterogeneous and throughout different tissue regions. These results suggest a possible association between TGF-β1 and the immune responses that underlie AL and OA. Despite a previous report indicates that in OA pathogenesis, TGF-β1 might have a pro-inflammatory effect by inducing fibroblasts to express TNF-α and IL-1β [46], its involvement in inflammatory response is not fully understood. Although the involvement of TGF-β1 in fibrosis is widely described, this growth factor may have dual effects on arthritic diseases [47]. Both immune cells and fibroblasts are part of the complex microenvironments that underlie AL and OA and in which TGF-β1 may have different effects depending on levels of other inflammatory mediators. Additionally, in the context of particle-induced immune response, TGF-β1 has a conjoint role with other factors on bone remodeling [12].
Moreover, previous studies demonstrated that serum TGF-β1 has not predictive value to assess OA incidence and progression [48, 49]. In our study, despite the difference in tissues regarding TGF-β1, AL and OA patients presented similar concentrations of TGF-β1 in serum.
The crosstalk between inflammation and innervation has been widely investigated in several joint-related disorders but not in presence of prostheses [50, 51]. Previous studies have reported sensory and sympathetic innervation in joints diseases namely OA and rheumatoid arthritis (RA), where an inflammatory response is taken place within synovial tissues or in the vicinity of the articulation. Our study demonstrated for the first time distinct pattern of sensory and sympathetic innervation in AL patients characterized by a loss of sympathetic nerve fibers when compared to OA patients. This differential profile has been also described in a comparative study showing lack of sympathetic innervation in RA patients while in OA patients this does not occur [52]. The authors suggested that the reduction or absence of sympathetic innervation might be a consequence of the initial synovial inflammation, probably involving nerve repellent molecules [53], and a key factor to its maintenance in RA. In AL, a sustained chronic inflammatory response is maintained by the presence of prosthetic debris, primarily generated at the bearing surface of hip prostheses. Therefore, our findings, supported by those described in RA, strongly indicate a close correlation between sympathetic innervation pattern and the degree of the inflammatory response. A previous study described the appearance of TH+ cells in the collagen-induced arthritis in mice and hypothesized that the presence of those cells might be a compensatory mechanism to the deprivation of sympathetic neurotransmitters in the joint [54]. In AL patients, TH+ catecholamine-producing cells were not detected in the synovial membrane-like interface, suggesting total uncoupling of local joint inflammation from the sympathetic activity (nerve fibers and cells).
Several animal and human studies have addressed the pattern of the sensory innervation in arthritis, namely in OA, and reported a significant re-organization of the sensory nerve fibers characterized by an alteration in the morphology, density and sprouting into areas of the joint that are normally poorly innervated [21]. In this study we showed that there is also alteration in the sensorial innervation of synovial membrane-like interface tissues in AL patients with a notable distinct tissue distribution when compared to OA. SP and CGRP immunoreactive nerve fibers were observed in subintima regions (outer layer) mainly around blood vessels while in AL they were distributed throughout synovial membrane-like interface tissues. Of note, SP+ and CGRP+ cells were also found in these tissues as an additional source of these neuropeptides. Although, SP and CGRP are recognized as neuro-inflammatory modulators in arthritic joints, their functional role in the inflammatory response associated to prosthetic debris as well as in the reorganization of sensory and sympathetic nerve fibers in inflamed joint need to be clarified.
We acknowledge certain limitations in this study. To study the differences between AL and OA, thirty-five patients were included in our study, an average number in the field [40]. OA synovial tissues and synovial membrane-like interface tissues were retrieved by the same surgeon to minimize location bias. The histological semi-quantification of accumulation of prosthetic debris in aseptic interface tissues was limited to micro-sized particles, or clusters of nanoparticles, although tissues have been previously evaluated by SEM. Gene expression analysis was successfully performed in eleven out of twenty AL patients due to low RNA quality. Patients’ stratification concerning implant fixation and metallosis (AL group) or disease severity (OA group) was performed but no significant effect was identified. On the other hand, the interpretation of the variability between patients may not be just influenced by a specific biological response in joint region but by other factors such as patients comorbidities (e.g. diabetes mellitus and dyslipidemia), geriatric condition, or genetic susceptibility to AL [16, 55].

Conclusions

Overall this study showed that AL and OA are two joint pathologies characterized by local immune response however with distinct tissue organization and immune cell distribution. This differential immune profile is also accompanied with changes of sensory and sympathetic innervation in hip joint. These findings highlight that the interplay between inflammation and innervation may be joint pathology-specific. Therefore, a deeper and conjoint understanding of these processes will constitute a solid base for targeted-therapies to improve hip joint lifetime and treatment.

Authors’ contributions

DMV, MRS and AM carried out the retrieval of synovial tissues and blood samples. DMV, MRS, JMS, GCM and ISA performed gene expression analysis and performed statistical analysis. DMV and RH performed and evaluated tissues architecture, immune cells distribution and accumulation of prosthetic debris by histochemistry and immunohistochemistry analysis. CJA and DPC performed and evaluated tissues’ innervation by immunohistochemistry. GC, MAB and ML conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank orthopaedic surgeons Dr. Rui Pinto, Dr. Manuel Seara, Dr. Silva Pereira, Dr. Nuno Neves, Dr. Carlos Dopico, Dr. Artur Antunes, Dr. João Duarte Silva and Dra. Mariana Cunha Ferreira and nurses from Serviço de Ortopedia e Traumatologia from Centro Hospitalar de S. João and Dr. Francisco Costa Almeida from Serviço de Ortopedia e Traumatologia from Centro Hospitalar V.N.Gaia/Espinho, for the collaboration in samples retrieve and clinical data analysis. Special thank to Dra. Daniela Linhares for the help with statistical analysis. We also thank pathology technicians Paula Lopes and Isa Carneiro from IPO-Porto for their support with immunohistochemistry technique. This work was financed by FEDER - Fundo Europeu de Desenvolvimento Regional funds through the COMPETE 2020 - Operacional Programme for Competitiveness and Internationalisation (POCI), Portugal 2020, and by Portuguese funds through FCT - Fundação para a Ciência e a Tecnologia/ Ministério da Ciência, Tecnologia e Inovação in the framework of the project “Institute for Research and Innovation in Health Sciences” (POCI-01-0145-FEDER-007274). DMV, CJA and ISA were supported by Ph.D. and post-doc fellowships SFRH/BD/87516/2012, SFRH/BPD/63618/2009 and SFRH/BPD/75285/2010, respectively.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Berenbaum F. Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). Osteoarthritis Cartilage. 2013;21:16–21.CrossRefPubMed Berenbaum F. Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). Osteoarthritis Cartilage. 2013;21:16–21.CrossRefPubMed
2.
Zurück zum Zitat Glyn-Jones S, Palmer AJ, Agricola R, Price AJ, Vincent TL, Weinans H, Carr AJ. Osteoarthritis. Lancet. 2015;386(9991):376–87.CrossRefPubMed Glyn-Jones S, Palmer AJ, Agricola R, Price AJ, Vincent TL, Weinans H, Carr AJ. Osteoarthritis. Lancet. 2015;386(9991):376–87.CrossRefPubMed
3.
Zurück zum Zitat Jourdan C, Poiraudeau S, Descamps S, Nizard R, Hamadouche M, Anract P, Boisgard S, Galvin M, Ravaud P. Comparison of patient and surgeon expectations of total hip arthroplasty. PLoS One. 2012;7:e30195.CrossRefPubMedPubMedCentral Jourdan C, Poiraudeau S, Descamps S, Nizard R, Hamadouche M, Anract P, Boisgard S, Galvin M, Ravaud P. Comparison of patient and surgeon expectations of total hip arthroplasty. PLoS One. 2012;7:e30195.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Smith GH, Johnson S, Ballantyne JA, Dunstan E, Brenkel IJ. Predictors of excellent early outcome after total hip arthroplasty. J Orthop Surg Res. 2012;7:13.CrossRefPubMedPubMedCentral Smith GH, Johnson S, Ballantyne JA, Dunstan E, Brenkel IJ. Predictors of excellent early outcome after total hip arthroplasty. J Orthop Surg Res. 2012;7:13.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Ulrich SD, Seyler TM, Bennett D, Delanois RE, Saleh KJ, Thongtrangan I, Kuskowski M, Cheng EY, Sharkey PF, Parvizi J, Stiehl JB, Mont MA. Total hip arthroplasties: what are the reasons for revision? Int Orthop. 2008;32:597–604.CrossRefPubMed Ulrich SD, Seyler TM, Bennett D, Delanois RE, Saleh KJ, Thongtrangan I, Kuskowski M, Cheng EY, Sharkey PF, Parvizi J, Stiehl JB, Mont MA. Total hip arthroplasties: what are the reasons for revision? Int Orthop. 2008;32:597–604.CrossRefPubMed
6.
Zurück zum Zitat Kurtz S, Ong K, Lau E, Mowat F, Halpern M. Projections of primary and revision hip and knee arthroplasty in the United States from 2005 to 2030. J Bone Joint Surg Am. 2007;89:780–5.CrossRefPubMed Kurtz S, Ong K, Lau E, Mowat F, Halpern M. Projections of primary and revision hip and knee arthroplasty in the United States from 2005 to 2030. J Bone Joint Surg Am. 2007;89:780–5.CrossRefPubMed
7.
Zurück zum Zitat de Lange-Brokaar BJ, Ioan-Facsinay A, van Osch GJ, Zuurmond AM, Schoones J, Toes RE, Huizinga TW, Kloppenburg M. Synovial inflammation, immune cells and their cytokines in osteoarthritis: a review. Osteoarthritis Cartilage. 2012;20:1484–99.CrossRefPubMed de Lange-Brokaar BJ, Ioan-Facsinay A, van Osch GJ, Zuurmond AM, Schoones J, Toes RE, Huizinga TW, Kloppenburg M. Synovial inflammation, immune cells and their cytokines in osteoarthritis: a review. Osteoarthritis Cartilage. 2012;20:1484–99.CrossRefPubMed
8.
Zurück zum Zitat Gallo J, Goodman SB, Konttinen YT, Wimmer MA, Holinka M. Osteolysis around total knee arthroplasty: a review of pathogenetic mechanisms. Acta Biomater. 2013;9:8046–58.CrossRefPubMedPubMedCentral Gallo J, Goodman SB, Konttinen YT, Wimmer MA, Holinka M. Osteolysis around total knee arthroplasty: a review of pathogenetic mechanisms. Acta Biomater. 2013;9:8046–58.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Loria MP, Dambra P, Moretti B, Patella V, Capuzzimati L, Cavallo E, Nettis E, Pesce V, Dell’Osso A, Simone C, Tursi A. Role of cytokines in gonarthrosis and knee prosthesis aseptic loosening. J Orthop Sci. 2004;9:274–9.CrossRefPubMed Loria MP, Dambra P, Moretti B, Patella V, Capuzzimati L, Cavallo E, Nettis E, Pesce V, Dell’Osso A, Simone C, Tursi A. Role of cytokines in gonarthrosis and knee prosthesis aseptic loosening. J Orthop Sci. 2004;9:274–9.CrossRefPubMed
11.
Zurück zum Zitat Martinez-Calatrava MJ, Prieto-Potin I, Roman-Blas JA, Tardio L, Largo R, Herrero-Beaumont G. RANKL synthesized by articular chondrocytes contributes to juxta-articular bone loss in chronic arthritis. Arthritis Res Ther. 2012;14:R149.CrossRefPubMedPubMedCentral Martinez-Calatrava MJ, Prieto-Potin I, Roman-Blas JA, Tardio L, Largo R, Herrero-Beaumont G. RANKL synthesized by articular chondrocytes contributes to juxta-articular bone loss in chronic arthritis. Arthritis Res Ther. 2012;14:R149.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Gallo J, Goodman SB, Konttinen YT, Raska M. Particle disease: biologic mechanisms of periprosthetic osteolysis in total hip arthroplasty. Innate Immun. 2013;19:213–24.CrossRefPubMed Gallo J, Goodman SB, Konttinen YT, Raska M. Particle disease: biologic mechanisms of periprosthetic osteolysis in total hip arthroplasty. Innate Immun. 2013;19:213–24.CrossRefPubMed
13.
Zurück zum Zitat Papageorgiou I, Shadrick V, Davis S, Hails L, Schins R, Newson R, Fisher J, Ingham E, Case CP. Macrophages detoxify the genotoxic and cytotoxic effects of surgical cobalt chrome alloy particles but not quartz particles on human cells in vitro. Mutat Res. 2008;643:11–9.CrossRefPubMed Papageorgiou I, Shadrick V, Davis S, Hails L, Schins R, Newson R, Fisher J, Ingham E, Case CP. Macrophages detoxify the genotoxic and cytotoxic effects of surgical cobalt chrome alloy particles but not quartz particles on human cells in vitro. Mutat Res. 2008;643:11–9.CrossRefPubMed
14.
Zurück zum Zitat Germain MA, Hatton A, Williams S, Matthews JB, Stone MH, Fisher J, Ingham E. Comparison of the cytotoxicity of clinically relevant cobalt–chromium and alumina ceramic wear particles in vitro. Biomaterials. 2003;24:469–79.CrossRefPubMed Germain MA, Hatton A, Williams S, Matthews JB, Stone MH, Fisher J, Ingham E. Comparison of the cytotoxicity of clinically relevant cobalt–chromium and alumina ceramic wear particles in vitro. Biomaterials. 2003;24:469–79.CrossRefPubMed
15.
Zurück zum Zitat Gallo J, Slouf M, Goodman SB. The relationship of polyethylene wear to particle size, distribution, and number: a possible factor explaining the risk of osteolysis after hip arthroplasty. J Biomed Mater Res B Appl Biomater. 2010;94:171–7.PubMed Gallo J, Slouf M, Goodman SB. The relationship of polyethylene wear to particle size, distribution, and number: a possible factor explaining the risk of osteolysis after hip arthroplasty. J Biomed Mater Res B Appl Biomater. 2010;94:171–7.PubMed
16.
Zurück zum Zitat Del Buono A, Denaro V, Maffulli N. Genetic susceptibility to aseptic loosening following total hip arthroplasty: a systematic review. Br Med Bull. 2012;101:39–55.CrossRefPubMed Del Buono A, Denaro V, Maffulli N. Genetic susceptibility to aseptic loosening following total hip arthroplasty: a systematic review. Br Med Bull. 2012;101:39–55.CrossRefPubMed
17.
Zurück zum Zitat Watters TS, Cardona DM, Menon KS, Vinson EN, Bolognesi MP, Dodd LG. Aseptic lymphocyte-dominated vasculitis-associated lesion: a clinicopathologic review of an underrecognized cause of prosthetic failure. Am J Clin Pathol. 2010;134:886–93.CrossRefPubMed Watters TS, Cardona DM, Menon KS, Vinson EN, Bolognesi MP, Dodd LG. Aseptic lymphocyte-dominated vasculitis-associated lesion: a clinicopathologic review of an underrecognized cause of prosthetic failure. Am J Clin Pathol. 2010;134:886–93.CrossRefPubMed
18.
Zurück zum Zitat Bijlsma JWJ, Berenbaum F, Lafeber FPJG. Osteoarthritis: an update with relevance for clinical practice. Lancet. 2011;377(9783):2115–26.CrossRefPubMed Bijlsma JWJ, Berenbaum F, Lafeber FPJG. Osteoarthritis: an update with relevance for clinical practice. Lancet. 2011;377(9783):2115–26.CrossRefPubMed
19.
Zurück zum Zitat Niissalo S, Li TF, Santavirta S, Takagi M, Hietanen J, Konttinen YT. Dense innervation in pseudocapsular tissue compared to aneural interface tissue in loose totally replaced hips. J Rheumatol. 2002;29:796–803.PubMed Niissalo S, Li TF, Santavirta S, Takagi M, Hietanen J, Konttinen YT. Dense innervation in pseudocapsular tissue compared to aneural interface tissue in loose totally replaced hips. J Rheumatol. 2002;29:796–803.PubMed
20.
Zurück zum Zitat Pearle AD, Scanzello CR, George S, Mandl LA, DiCarlo EF, Peterson M, Sculco TP, Crow MK. Elevated high-sensitivity C-reactive protein levels are associated with local inflammatory findings in patients with osteoarthritis. Osteoarthritis Cartilage. 2007;15:516–23.CrossRefPubMed Pearle AD, Scanzello CR, George S, Mandl LA, DiCarlo EF, Peterson M, Sculco TP, Crow MK. Elevated high-sensitivity C-reactive protein levels are associated with local inflammatory findings in patients with osteoarthritis. Osteoarthritis Cartilage. 2007;15:516–23.CrossRefPubMed
21.
Zurück zum Zitat Grässel S. The role of peripheral nerve fibers and their neurotransmitters in cartilage and bone physiology and pathophysiology. Arthritis Res Ther. 2014;16:485.CrossRefPubMedPubMedCentral Grässel S. The role of peripheral nerve fibers and their neurotransmitters in cartilage and bone physiology and pathophysiology. Arthritis Res Ther. 2014;16:485.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Ahmed M, Bergstrom J, Lundblad H, Gillespie WJ, Kreicbergs A. Sensory nerves in the interface membrane of aseptic loose hip prostheses. J Bone Joint Surg Br. 1998;80B:151–5.CrossRef Ahmed M, Bergstrom J, Lundblad H, Gillespie WJ, Kreicbergs A. Sensory nerves in the interface membrane of aseptic loose hip prostheses. J Bone Joint Surg Br. 1998;80B:151–5.CrossRef
23.
Zurück zum Zitat Paprosky WG, Perona PG, Lawrence JM. Acetabular defect classification and surgical reconstruction in revision arthroplasty. A 6-year follow-up evaluation. J Arthroplasty. 1994;9:33–44.CrossRefPubMed Paprosky WG, Perona PG, Lawrence JM. Acetabular defect classification and surgical reconstruction in revision arthroplasty. A 6-year follow-up evaluation. J Arthroplasty. 1994;9:33–44.CrossRefPubMed
24.
Zurück zum Zitat Tönnis D. Dysplasia and dislocation of the hip in children and adults. New York: Springer; 1987.CrossRef Tönnis D. Dysplasia and dislocation of the hip in children and adults. New York: Springer; 1987.CrossRef
25.
Zurück zum Zitat Clarke SA, Brooks RA, Hobby JL, Wimhurst JA, Myer BJ, Rushton N. Correlation of synovial fluid cytokine levels with histological and clinical parameters of primary and revision total hip and total knee replacements. Acta Orthop Scand. 2001;72:491–8.CrossRefPubMed Clarke SA, Brooks RA, Hobby JL, Wimhurst JA, Myer BJ, Rushton N. Correlation of synovial fluid cytokine levels with histological and clinical parameters of primary and revision total hip and total knee replacements. Acta Orthop Scand. 2001;72:491–8.CrossRefPubMed
26.
Zurück zum Zitat Jamsen E, Kouri VP, Olkkonen J, Cor A, Goodman SB, Konttinen YT, Pajarinen J. Characterization of macrophage polarizing cytokines in the aseptic loosening of total hip replacements. J Orthop Res. 2014;32:1241–6.CrossRefPubMed Jamsen E, Kouri VP, Olkkonen J, Cor A, Goodman SB, Konttinen YT, Pajarinen J. Characterization of macrophage polarizing cytokines in the aseptic loosening of total hip replacements. J Orthop Res. 2014;32:1241–6.CrossRefPubMed
27.
Zurück zum Zitat Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–22.CrossRefPubMed Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–22.CrossRefPubMed
28.
Zurück zum Zitat Nich C, Takakubo Y, Pajarinen J, Ainola M, Salem A, Sillat T, Rao AJ, Raska M, Tamaki Y, Takagi M, Konttinen YT, Goodman SB, Gallo J. Macrophages-Key cells in the response to wear debris from joint replacements. J Biomed Mater Res A. 2013;101:3033–45.CrossRefPubMedPubMedCentral Nich C, Takakubo Y, Pajarinen J, Ainola M, Salem A, Sillat T, Rao AJ, Raska M, Tamaki Y, Takagi M, Konttinen YT, Goodman SB, Gallo J. Macrophages-Key cells in the response to wear debris from joint replacements. J Biomed Mater Res A. 2013;101:3033–45.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Kobayashi A, Freeman MA, Bonfield W, Kadoya Y, Yamac T, Al-Saffar N, Scott G, Revell PA. Number of polyethylene particles and osteolysis in total joint replacements. A quantitative study using a tissue-digestion method. J Bone Joint Surg Br. 1997;79:844–8.CrossRefPubMed Kobayashi A, Freeman MA, Bonfield W, Kadoya Y, Yamac T, Al-Saffar N, Scott G, Revell PA. Number of polyethylene particles and osteolysis in total joint replacements. A quantitative study using a tissue-digestion method. J Bone Joint Surg Br. 1997;79:844–8.CrossRefPubMed
30.
Zurück zum Zitat Wang CT, Lin YT, Chiang BL, Lee SS, Hou SM. Over-expression of receptor activator of nuclear factor-kappaB ligand (RANKL), inflammatory cytokines, and chemokines in periprosthetic osteolysis of loosened total hip arthroplasty. Biomaterials. 2010;31:77–82.CrossRefPubMed Wang CT, Lin YT, Chiang BL, Lee SS, Hou SM. Over-expression of receptor activator of nuclear factor-kappaB ligand (RANKL), inflammatory cytokines, and chemokines in periprosthetic osteolysis of loosened total hip arthroplasty. Biomaterials. 2010;31:77–82.CrossRefPubMed
31.
Zurück zum Zitat Obando-Pereda GA, Fischer L, Stach-Machado DR. Titanium and zirconia particle-induced pro-inflammatory gene expression in cultured macrophages and osteolysis, inflammatory hyperalgesia and edema in vivo. Life Sci. 2014;97:96–106.CrossRefPubMed Obando-Pereda GA, Fischer L, Stach-Machado DR. Titanium and zirconia particle-induced pro-inflammatory gene expression in cultured macrophages and osteolysis, inflammatory hyperalgesia and edema in vivo. Life Sci. 2014;97:96–106.CrossRefPubMed
32.
Zurück zum Zitat Lanone S, Rogerieux F, Geys J, Dupont A, Maillot-Marechal E, Boczkowski J, Lacroix G, Hoet P. Comparative toxicity of 24 manufactured nanoparticles in human alveolar epithelial and macrophage cell lines. Part Fibre Toxicol. 2009;6:14.CrossRefPubMedPubMedCentral Lanone S, Rogerieux F, Geys J, Dupont A, Maillot-Marechal E, Boczkowski J, Lacroix G, Hoet P. Comparative toxicity of 24 manufactured nanoparticles in human alveolar epithelial and macrophage cell lines. Part Fibre Toxicol. 2009;6:14.CrossRefPubMedPubMedCentral
33.
Zurück zum Zitat Lin TH, Yao Z, Sato T, Keeney M, Li C, Pajarinen J, Yang F, Egashira K, Goodman SB. Suppression of wear-particle-induced pro-inflammatory cytokine and chemokine production in macrophages via NF-kappaB decoy oligodeoxynucleotide: a preliminary report. Acta Biomater. 2014;10:3747–55.CrossRefPubMedPubMedCentral Lin TH, Yao Z, Sato T, Keeney M, Li C, Pajarinen J, Yang F, Egashira K, Goodman SB. Suppression of wear-particle-induced pro-inflammatory cytokine and chemokine production in macrophages via NF-kappaB decoy oligodeoxynucleotide: a preliminary report. Acta Biomater. 2014;10:3747–55.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Hallab NJ, Caicedo M, Finnegan A, Jacobs JJ. Th1 type lymphocyte reactivity to metals in patients with total hip arthroplasty. J Orthop Surg Res. 2008;3:6.CrossRefPubMedPubMedCentral Hallab NJ, Caicedo M, Finnegan A, Jacobs JJ. Th1 type lymphocyte reactivity to metals in patients with total hip arthroplasty. J Orthop Surg Res. 2008;3:6.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Goodman SB, Gibon E, Pajarinen J, Lin TH, Keeney M, Ren PG, Nich C, Yao Z, Egashira K, Yang F, Konttinen YT. Novel biological strategies for treatment of wear particle-induced periprosthetic osteolysis of orthopaedic implants for joint replacement. J R Soc Interface. 2014;11:20130962.CrossRefPubMedPubMedCentral Goodman SB, Gibon E, Pajarinen J, Lin TH, Keeney M, Ren PG, Nich C, Yao Z, Egashira K, Yang F, Konttinen YT. Novel biological strategies for treatment of wear particle-induced periprosthetic osteolysis of orthopaedic implants for joint replacement. J R Soc Interface. 2014;11:20130962.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Lin TH, Kao S, Sato T, Pajarinen J, Zhang R, Loi F, Goodman SB, Yao Z. Exposure of polyethylene particles induces interferon-gamma expression in a natural killer T lymphocyte and dendritic cell coculture system in vitro: a preliminary study. J Biomed Mater Res A. 2014;103(1):71–5.CrossRefPubMedPubMedCentral Lin TH, Kao S, Sato T, Pajarinen J, Zhang R, Loi F, Goodman SB, Yao Z. Exposure of polyethylene particles induces interferon-gamma expression in a natural killer T lymphocyte and dendritic cell coculture system in vitro: a preliminary study. J Biomed Mater Res A. 2014;103(1):71–5.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Hukkanen M, Corbett SA, Batten J, Konttinen YT, McCarthy ID, Maclouf J, Santavirta S, Hughes SPF, Polak JM. Aseptic loosening of total hip replacement: macrophage expression of inducible nitric oxide synthase and cyclo-oxygenase-2, together with peroxynitrite formation, as a possible mechanism for early prosthesis failure. J Bone Joint Surg Br. 1997;79-B:467–74.CrossRef Hukkanen M, Corbett SA, Batten J, Konttinen YT, McCarthy ID, Maclouf J, Santavirta S, Hughes SPF, Polak JM. Aseptic loosening of total hip replacement: macrophage expression of inducible nitric oxide synthase and cyclo-oxygenase-2, together with peroxynitrite formation, as a possible mechanism for early prosthesis failure. J Bone Joint Surg Br. 1997;79-B:467–74.CrossRef
38.
Zurück zum Zitat Koulouvaris P, Ly K, Ivashkiv LB, Bostrom MP, Nestor BJ, Sculco TP, Purdue PE. Expression profiling reveals alternative macrophage activation and impaired osteogenesis in periprosthetic osteolysis. J Orthop Res. 2008;26:106–16.CrossRefPubMed Koulouvaris P, Ly K, Ivashkiv LB, Bostrom MP, Nestor BJ, Sculco TP, Purdue PE. Expression profiling reveals alternative macrophage activation and impaired osteogenesis in periprosthetic osteolysis. J Orthop Res. 2008;26:106–16.CrossRefPubMed
39.
Zurück zum Zitat Baer M, Dillner A, Schwartz RC, Sedon C, Nedospasov S, Johnson PF. Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappaB p50. Mol Cell Biol. 1998;18:5678–89.CrossRefPubMedPubMedCentral Baer M, Dillner A, Schwartz RC, Sedon C, Nedospasov S, Johnson PF. Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappaB p50. Mol Cell Biol. 1998;18:5678–89.CrossRefPubMedPubMedCentral
40.
Zurück zum Zitat Gallo J, Vaculova J, Goodman SB, Konttinen YT, Thyssen JP. Contributions of human tissue analysis to understanding the mechanisms of loosening and osteolysis in total hip replacement. Acta Biomater. 2014;10:2354–66.CrossRefPubMedPubMedCentral Gallo J, Vaculova J, Goodman SB, Konttinen YT, Thyssen JP. Contributions of human tissue analysis to understanding the mechanisms of loosening and osteolysis in total hip replacement. Acta Biomater. 2014;10:2354–66.CrossRefPubMedPubMedCentral
41.
Zurück zum Zitat Koivu H, Mackiewicz Z, Takakubo Y, Trokovic N, Pajarinen J, Konttinen YT. RANKL in the osteolysis of AES total ankle replacement implants. Bone. 2012;51:546–52.CrossRefPubMed Koivu H, Mackiewicz Z, Takakubo Y, Trokovic N, Pajarinen J, Konttinen YT. RANKL in the osteolysis of AES total ankle replacement implants. Bone. 2012;51:546–52.CrossRefPubMed
42.
Zurück zum Zitat Dapunt U, Giese T, Lasitschka F, Reinders J, Lehner B, Kretzer JP, Ewerbeck V, Hansch GM. On the inflammatory response in metal-on-metal implants. J Transl Med. 2014;12:74.CrossRefPubMedPubMedCentral Dapunt U, Giese T, Lasitschka F, Reinders J, Lehner B, Kretzer JP, Ewerbeck V, Hansch GM. On the inflammatory response in metal-on-metal implants. J Transl Med. 2014;12:74.CrossRefPubMedPubMedCentral
43.
Zurück zum Zitat van der Kraan PM, Blaney Davidson EN, van den Berg WB. A role for age-related changes in TGFbeta signaling in aberrant chondrocyte differentiation and osteoarthritis. Arthritis Res Ther. 2010;12:201.CrossRefPubMedPubMedCentral van der Kraan PM, Blaney Davidson EN, van den Berg WB. A role for age-related changes in TGFbeta signaling in aberrant chondrocyte differentiation and osteoarthritis. Arthritis Res Ther. 2010;12:201.CrossRefPubMedPubMedCentral
44.
Zurück zum Zitat Pombo-Suarez M, Castano-Oreja MT, Calaza M, Gomez-Reino J, Gonzalez A. Differential upregulation of the three transforming growth factor beta isoforms in human osteoarthritic cartilage. Ann Rheum Dis. 2009;68:568–71.CrossRefPubMed Pombo-Suarez M, Castano-Oreja MT, Calaza M, Gomez-Reino J, Gonzalez A. Differential upregulation of the three transforming growth factor beta isoforms in human osteoarthritic cartilage. Ann Rheum Dis. 2009;68:568–71.CrossRefPubMed
45.
Zurück zum Zitat Konttinen YT, Waris V, Xu JW, Jiranek WA, Sorsa T, Virtanen I, Santavirta S. Transforming growth factor-beta 1 and 2 in the synovial-like interface membrane between implant and bone in loosening of total hip arthroplasty. J Rheumatol. 1997;24:694–701.PubMed Konttinen YT, Waris V, Xu JW, Jiranek WA, Sorsa T, Virtanen I, Santavirta S. Transforming growth factor-beta 1 and 2 in the synovial-like interface membrane between implant and bone in loosening of total hip arthroplasty. J Rheumatol. 1997;24:694–701.PubMed
46.
Zurück zum Zitat Cheon H, Yu SJ, Yoo DH, Chae IJ, Song GG, Sohn J. Increased expression of pro-inflammatory cytokines and metalloproteinase-1 by TGF-beta1 in synovial fibroblasts from rheumatoid arthritis and normal individuals. Clin Exp Immunol. 2002;127:547–52.CrossRefPubMedPubMedCentral Cheon H, Yu SJ, Yoo DH, Chae IJ, Song GG, Sohn J. Increased expression of pro-inflammatory cytokines and metalloproteinase-1 by TGF-beta1 in synovial fibroblasts from rheumatoid arthritis and normal individuals. Clin Exp Immunol. 2002;127:547–52.CrossRefPubMedPubMedCentral
47.
Zurück zum Zitat Pohlers D, Brenmoehl J, Loffler I, Muller CK, Leipner C, Schultze-Mosgau S, Stallmach A, Kinne RW, Wolf G. TGF-beta and fibrosis in different organs—molecular pathway imprints. Biochim Biophys Acta. 2009;1792:746–56.CrossRefPubMed Pohlers D, Brenmoehl J, Loffler I, Muller CK, Leipner C, Schultze-Mosgau S, Stallmach A, Kinne RW, Wolf G. TGF-beta and fibrosis in different organs—molecular pathway imprints. Biochim Biophys Acta. 2009;1792:746–56.CrossRefPubMed
48.
Zurück zum Zitat Nelson AE, Fang F, Shi XA, Kraus VB, Stabler T, Renner JB, Schwartz TA, Helmick CG, Jordan JM. Failure of serum transforming growth factor-beta (TGF-beta1) as a biomarker of radiographic osteoarthritis at the knee and hip: a cross-sectional analysis in the Johnston County Osteoarthritis Project. Osteoarthritis Cartilage. 2009;17:772–6.CrossRefPubMed Nelson AE, Fang F, Shi XA, Kraus VB, Stabler T, Renner JB, Schwartz TA, Helmick CG, Jordan JM. Failure of serum transforming growth factor-beta (TGF-beta1) as a biomarker of radiographic osteoarthritis at the knee and hip: a cross-sectional analysis in the Johnston County Osteoarthritis Project. Osteoarthritis Cartilage. 2009;17:772–6.CrossRefPubMed
49.
Zurück zum Zitat Nelson AE, Golightly YM, Kraus VB, Stabler T, Renner JB, Helmick CG, Jordan JM. Serum transforming growth factor-beta 1 is not a robust biomarker of incident and progressive radiographic osteoarthritis at the hip and knee: the Johnston County Osteoarthritis Project. Osteoarthritis Cartilage. 2010;18:825–9.CrossRefPubMedPubMedCentral Nelson AE, Golightly YM, Kraus VB, Stabler T, Renner JB, Helmick CG, Jordan JM. Serum transforming growth factor-beta 1 is not a robust biomarker of incident and progressive radiographic osteoarthritis at the hip and knee: the Johnston County Osteoarthritis Project. Osteoarthritis Cartilage. 2010;18:825–9.CrossRefPubMedPubMedCentral
51.
Zurück zum Zitat Prod’homme T, Weber MS, Steinman L, Zamvil SS. A neuropeptide in immune-mediated inflammation, Y? Trends Immunol. 2006;27:164–7.CrossRefPubMed Prod’homme T, Weber MS, Steinman L, Zamvil SS. A neuropeptide in immune-mediated inflammation, Y? Trends Immunol. 2006;27:164–7.CrossRefPubMed
52.
Zurück zum Zitat Miller LE, Justen HP, Scholmerich J, Straub RH. The loss of sympathetic nerve fibers in the synovial tissue of patients with rheumatoid arthritis is accompanied by increased norepinephrine release from synovial macrophages. FASEB J. 2000;14:2097–107.CrossRefPubMed Miller LE, Justen HP, Scholmerich J, Straub RH. The loss of sympathetic nerve fibers in the synovial tissue of patients with rheumatoid arthritis is accompanied by increased norepinephrine release from synovial macrophages. FASEB J. 2000;14:2097–107.CrossRefPubMed
53.
Zurück zum Zitat Fassold A, Falk W, Anders S, Hirsch T, Mirsky VM, Straub RH. Soluble neuropilin-2, a nerve repellent receptor, is increased in rheumatoid arthritis synovium and aggravates sympathetic fiber repulsion and arthritis. Arthritis Rheum. 2009;60:2892–901.CrossRefPubMed Fassold A, Falk W, Anders S, Hirsch T, Mirsky VM, Straub RH. Soluble neuropilin-2, a nerve repellent receptor, is increased in rheumatoid arthritis synovium and aggravates sympathetic fiber repulsion and arthritis. Arthritis Rheum. 2009;60:2892–901.CrossRefPubMed
54.
Zurück zum Zitat Capellino S, Weber K, Gelder M, Harle P, Straub RH. First appearance and location of catecholaminergic cells during experimental arthritis and elimination by chemical sympathectomy. Arthritis Rheum. 2012;64:1110–8.CrossRefPubMed Capellino S, Weber K, Gelder M, Harle P, Straub RH. First appearance and location of catecholaminergic cells during experimental arthritis and elimination by chemical sympathectomy. Arthritis Rheum. 2012;64:1110–8.CrossRefPubMed
55.
Zurück zum Zitat Blaney Davidson EN, van der Kraan PM, van den Berg WB. TGF-beta and osteoarthritis. Osteoarthritis Cartilage. 2007;15:597–604.CrossRefPubMed Blaney Davidson EN, van der Kraan PM, van den Berg WB. TGF-beta and osteoarthritis. Osteoarthritis Cartilage. 2007;15:597–604.CrossRefPubMed
Metadaten
Titel
Immune response and innervation signatures in aseptic hip implant loosening
verfasst von
Daniel M. Vasconcelos
Manuel Ribeiro-da-Silva
António Mateus
Cecília Juliana Alves
Gil Costa Machado
Joana Machado-Santos
Diogo Paramos-de-Carvalho
Inês S. Alencastre
Rui Henrique
Gilberto Costa
Mário A. Barbosa
Meriem Lamghari
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
Journal of Translational Medicine / Ausgabe 1/2016
Elektronische ISSN: 1479-5876
DOI
https://doi.org/10.1186/s12967-016-0950-5

Weitere Artikel der Ausgabe 1/2016

Journal of Translational Medicine 1/2016 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.